ID: 1152809589

View in Genome Browser
Species Human (GRCh38)
Location 17:82375299-82375321
Sequence GGCCCCGCACGCGGCCGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152809589_1152809597 -7 Left 1152809589 17:82375299-82375321 CCTGCGCGGCCGCGTGCGGGGCC 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1152809597 17:82375315-82375337 CGGGGCCCGGGCAGCGGGGGAGG 0: 1
1: 0
2: 11
3: 158
4: 1183
1152809589_1152809603 0 Left 1152809589 17:82375299-82375321 CCTGCGCGGCCGCGTGCGGGGCC 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1152809603 17:82375322-82375344 CGGGCAGCGGGGGAGGCCGGGGG 0: 1
1: 0
2: 1
3: 70
4: 688
1152809589_1152809598 -3 Left 1152809589 17:82375299-82375321 CCTGCGCGGCCGCGTGCGGGGCC 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1152809598 17:82375319-82375341 GCCCGGGCAGCGGGGGAGGCCGG 0: 1
1: 1
2: 0
3: 81
4: 831
1152809589_1152809602 -1 Left 1152809589 17:82375299-82375321 CCTGCGCGGCCGCGTGCGGGGCC 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1152809602 17:82375321-82375343 CCGGGCAGCGGGGGAGGCCGGGG 0: 1
1: 0
2: 9
3: 79
4: 2041
1152809589_1152809596 -10 Left 1152809589 17:82375299-82375321 CCTGCGCGGCCGCGTGCGGGGCC 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1152809596 17:82375312-82375334 GTGCGGGGCCCGGGCAGCGGGGG 0: 1
1: 0
2: 11
3: 68
4: 599
1152809589_1152809600 -2 Left 1152809589 17:82375299-82375321 CCTGCGCGGCCGCGTGCGGGGCC 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1152809600 17:82375320-82375342 CCCGGGCAGCGGGGGAGGCCGGG 0: 1
1: 1
2: 8
3: 55
4: 657

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152809589 Original CRISPR GGCCCCGCACGCGGCCGCGC AGG (reversed) Exonic