ID: 1152814160

View in Genome Browser
Species Human (GRCh38)
Location 17:82397656-82397678
Sequence GGCACTGCTGTGTCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 1, 2: 0, 3: 48, 4: 331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152814156_1152814160 27 Left 1152814156 17:82397606-82397628 CCACAAGTTCAAGGAGCAGAGGA 0: 1
1: 0
2: 0
3: 19
4: 251
Right 1152814160 17:82397656-82397678 GGCACTGCTGTGTCTGCAGCAGG 0: 1
1: 1
2: 0
3: 48
4: 331
1152814159_1152814160 -3 Left 1152814159 17:82397636-82397658 CCGCTCGGCAAATGCTCACTGGC 0: 1
1: 0
2: 2
3: 9
4: 101
Right 1152814160 17:82397656-82397678 GGCACTGCTGTGTCTGCAGCAGG 0: 1
1: 1
2: 0
3: 48
4: 331
1152814154_1152814160 28 Left 1152814154 17:82397605-82397627 CCCACAAGTTCAAGGAGCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1152814160 17:82397656-82397678 GGCACTGCTGTGTCTGCAGCAGG 0: 1
1: 1
2: 0
3: 48
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152814160 Original CRISPR GGCACTGCTGTGTCTGCAGC AGG Intronic
900094816 1:936087-936109 GGCTCCGCTGTGGCTGCCGCTGG + Intronic
900244427 1:1630834-1630856 GGGACTCCTGTGTCTGCCCCCGG + Intergenic
900505259 1:3027201-3027223 GTGACTGCTTTGTCTGCAGGTGG + Intergenic
901130632 1:6960737-6960759 GGCAGTGCTGCGTGTGCAGTGGG + Intronic
901478223 1:9505405-9505427 GGCCCTGCTGTGTGAGCAGGTGG - Intergenic
902944572 1:19825529-19825551 GGCACTGCTGGGCCTGCAGGTGG + Intergenic
903345906 1:22684258-22684280 GGCCCTGCTGCGGCTCCAGCTGG - Intergenic
903956812 1:27031664-27031686 GGAACTGCTGTCGCTGCAGCGGG - Intergenic
904566770 1:31433000-31433022 GGCACTCCTCGGTCTGCATCAGG - Exonic
904677457 1:32207078-32207100 GGAATTGCTGTGGCTGCAACAGG + Exonic
905631449 1:39521312-39521334 ACCGCTGCTGTGTCTGCTGCAGG + Intronic
905666305 1:39764859-39764881 ACCGCTGCTGTGTCTGCTGCAGG - Intronic
906787832 1:48631267-48631289 GGAACTGCAGTGTTTGCAACTGG + Intronic
907577128 1:55536675-55536697 GGCACTGTTTTCTCTGAAGCTGG - Intergenic
907702975 1:56807151-56807173 GTGACTGTTCTGTCTGCAGCAGG - Intronic
908089168 1:60668677-60668699 GGCACGGCAGTGACAGCAGCTGG - Intergenic
911426699 1:97724438-97724460 GGCTCTTCTGTGTCTCCAGCTGG - Intronic
912435931 1:109661081-109661103 TGACCTGCTGTGTCTGCAGTGGG + Intronic
912437874 1:109674663-109674685 TGACCTGCTGTGTCTGCAGTGGG + Intronic
912440384 1:109693122-109693144 TGACCTGCTGTGTCTGCAGTGGG + Intronic
914196752 1:145451732-145451754 TGCTCGCCTGTGTCTGCAGCAGG - Intergenic
915579519 1:156805069-156805091 GGCAGGGCTGTGTCTGCCCCTGG - Intergenic
915828839 1:159106115-159106137 GGCACTTCTGAGACTGCAGGGGG + Intronic
918148535 1:181779136-181779158 GCCAGGGCTGTGTCTGCATCTGG + Intronic
918321795 1:183371683-183371705 AGCTCTGCTGAGTCTGCTGCTGG + Intronic
919664919 1:200282746-200282768 GCCACTGCTTTCTCAGCAGCAGG + Intergenic
920009300 1:202856148-202856170 TGCACTGGTCTGTCTGGAGCAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923215240 1:231842974-231842996 TGCCGGGCTGTGTCTGCAGCTGG + Intronic
923678928 1:236103312-236103334 GGCTCGGCGGTGACTGCAGCTGG + Intergenic
924514058 1:244751647-244751669 GGCACTGCTCCATCTGCACCTGG - Intergenic
1062861876 10:816554-816576 GGAGCTGCTGTTTCTGAAGCAGG + Intronic
1064053927 10:12081590-12081612 GTCCCTGCAGTGTCTGCACCAGG - Exonic
1065711904 10:28526400-28526422 GGCAGTGCTGAGTCTCCAGGGGG - Intergenic
1066067374 10:31772182-31772204 GGCACTGATGTGTCTCAATCTGG - Intergenic
1066656165 10:37701409-37701431 AGGACTGCTGTGTCAGCAGGTGG + Intergenic
1067152369 10:43747394-43747416 TACACTGCTGTCTCTGCAGGTGG + Intergenic
1067152377 10:43747470-43747492 CACACTGCTGTCTCTGCAGGTGG + Intergenic
1067152387 10:43747594-43747616 CACACTGCTGTCTCTGCAGGTGG + Intergenic
1069570085 10:69489526-69489548 TCCTCTGCTGTGGCTGCAGCTGG + Intronic
1069833779 10:71296295-71296317 GGCGCTGCTGGGTGGGCAGCGGG - Intronic
1070131829 10:73661374-73661396 GGCACTGGGGTCTCTGCTGCTGG - Intronic
1070808702 10:79286456-79286478 GCCACTTCTGCTTCTGCAGCAGG + Intronic
1071334707 10:84591161-84591183 GACAGTGCAGGGTCTGCAGCTGG - Intergenic
1071595247 10:86917513-86917535 CTCACTGCTGTTTCTTCAGCTGG - Intronic
1073432283 10:103494258-103494280 GGCCCTGCTGGGGCTGCAGCCGG - Exonic
1073455016 10:103631482-103631504 GGGACTACTGTATCTGGAGCTGG + Intronic
1074307704 10:112294160-112294182 GTCACTGCTGTAACTCCAGCAGG - Intronic
1075780401 10:125013657-125013679 GGCGCTGCTGTTTCCCCAGCAGG + Intronic
1076649693 10:131979382-131979404 CCCACTGCTGTGTCTGCAACTGG - Intronic
1076779079 10:132714066-132714088 GGCCCTGCCGTGTCTGCTGTTGG + Intronic
1076806113 10:132859663-132859685 GGCCCTGCTGTGGCTGCTCCGGG - Intronic
1076981153 11:205542-205564 GACACTGCAGGCTCTGCAGCAGG + Intronic
1077269925 11:1671126-1671148 GACTCTGCTGGGTCTGCAGCTGG - Intergenic
1077385063 11:2265441-2265463 GGCTCTGCTGTGGGGGCAGCAGG - Intergenic
1078436152 11:11327609-11327631 GCCACTGCTGGGTCTGCAGGAGG - Intronic
1078616551 11:12871215-12871237 GACACTGCTGTCGCTGCAGCTGG - Intronic
1078795143 11:14584825-14584847 GGCCCTGTTCTGTCTCCAGCTGG + Intronic
1083888969 11:65586337-65586359 GGCAGTGCTGGGACTCCAGCTGG - Intronic
1084206933 11:67600544-67600566 GGGACCTCTGTGGCTGCAGCCGG - Intergenic
1084479560 11:69410835-69410857 TGCATTTCTGTTTCTGCAGCTGG - Intergenic
1085346900 11:75774087-75774109 GGCTCACCTGTGTCTGCAGCAGG + Intronic
1085404464 11:76253811-76253833 GGCACTCCTTTGCTTGCAGCTGG + Intergenic
1085480660 11:76820338-76820360 GCCAATGCTGTGTCTCAAGCTGG - Intergenic
1089036207 11:115395424-115395446 CTCACTGCTGTTTCTGAAGCTGG + Intronic
1089367097 11:117927520-117927542 GGCACTCCTCTGTCAGCTGCTGG - Intronic
1092082928 12:5733048-5733070 GGCACATCTGTTTCTCCAGCTGG - Intronic
1092312168 12:7369534-7369556 GGAAGTGGTGTGTCAGCAGCTGG - Exonic
1095043413 12:37470442-37470464 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1096181636 12:49554422-49554444 CGTCCTGCAGTGTCTGCAGCTGG + Exonic
1097383959 12:58927277-58927299 GGCACAACTGTGACTACAGCAGG + Intergenic
1097500182 12:60392127-60392149 GGCACTTCTGAGTCTGCAGAGGG - Intergenic
1099971746 12:89507237-89507259 GGCCTTGCTCTGTCTGGAGCAGG - Intronic
1102010507 12:109615732-109615754 GGCACTGCTCTGGATGTAGCAGG - Intergenic
1103180385 12:118906250-118906272 GACAGTCCTGTTTCTGCAGCTGG - Intergenic
1103822836 12:123712362-123712384 CGGACTGCTGTGGCGGCAGCTGG + Exonic
1104019214 12:124980548-124980570 GGCAGTGGTGGGGCTGCAGCTGG + Exonic
1104217600 12:126749548-126749570 TCCAAGGCTGTGTCTGCAGCAGG + Intergenic
1104227281 12:126847903-126847925 GGCACTGCTGTTTTTGATGCTGG - Intergenic
1104903204 12:132200093-132200115 GGCAGTGCTGAGTGTGCATCGGG - Intronic
1104947718 12:132424033-132424055 GGCCCTTGTGGGTCTGCAGCTGG - Intergenic
1105817596 13:24051278-24051300 GGACATGCTGTGCCTGCAGCCGG + Intronic
1105896265 13:24719197-24719219 GGCACTCCTGTGGCTCCAGTGGG - Intergenic
1107779107 13:43879518-43879540 GGAACTGCTGAGGCAGCAGCGGG + Exonic
1108515629 13:51200051-51200073 TGCACTGTTGTGTCTGGAGTTGG + Intergenic
1108573630 13:51772693-51772715 GGCAATAGTGTGACTGCAGCTGG - Intronic
1109104934 13:58239156-58239178 GGAACTGCTGGGTCTAAAGCTGG - Intergenic
1110821226 13:79919306-79919328 GCCACAGCTGTATCAGCAGCTGG + Intergenic
1111693422 13:91593024-91593046 GGCACAGATGGGTCTTCAGCCGG - Intronic
1112339885 13:98544304-98544326 GGGACTTCTGTGTCTGCAGTTGG - Intronic
1112569433 13:100580379-100580401 GGCTCTGCTGTGTCTTCACATGG - Intronic
1112957900 13:105084253-105084275 AGCACGGCTTTGTCAGCAGCAGG - Intergenic
1113906888 13:113823463-113823485 AGCACGCCTGTGTCTGCGGCTGG + Exonic
1113954596 13:114090693-114090715 GGCACGGGCGTCTCTGCAGCAGG + Intronic
1114228210 14:20757721-20757743 GGCAATACTGTGACTGGAGCAGG + Intergenic
1114399972 14:22401171-22401193 TTCTCTGCTGTGTCTCCAGCTGG - Intergenic
1117211569 14:53506335-53506357 GCCACTGCTGTGTCCTAAGCAGG + Intergenic
1121009539 14:90512043-90512065 GACAGTGCTGTGTCTGGAGATGG - Intergenic
1121109245 14:91301267-91301289 TCCCTTGCTGTGTCTGCAGCAGG - Intronic
1121256300 14:92532654-92532676 GGAACTGCTGAGTAAGCAGCAGG + Intronic
1121287628 14:92748613-92748635 GGCACTGCTGTGATTGCTGCGGG + Exonic
1121690888 14:95876543-95876565 CGCACTGCTGTGCTTGCGGCCGG + Intergenic
1122992181 14:105241632-105241654 GGCCCTAGCGTGTCTGCAGCAGG - Intronic
1202941958 14_KI270725v1_random:158054-158076 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1124108565 15:26764780-26764802 GGCACTGCTGAGTGGGCAGGCGG + Intronic
1125711354 15:41789560-41789582 GGCACTGCAGGGTCAGAAGCAGG - Intronic
1126101211 15:45119345-45119367 AGGACTGCTGTGTGTGCTGCTGG - Exonic
1126291494 15:47085410-47085432 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1126410493 15:48368481-48368503 TGCACTGCTGTGTTTGGAGCTGG - Intergenic
1127904108 15:63363574-63363596 AACACTGCTGTGCATGCAGCAGG + Intronic
1127975001 15:63990676-63990698 GGAACTGCGGTGTCTGCGGTGGG - Intronic
1128016210 15:64349588-64349610 AGCCATGCTTTGTCTGCAGCAGG - Intronic
1128700365 15:69799522-69799544 GCCACAGCTGTGCCTGGAGCTGG - Intergenic
1129526316 15:76217596-76217618 GGCAGTGCAGTGGCTGCAACTGG + Intronic
1129946524 15:79543333-79543355 GGCATTGCTGAGCCTGCAGTGGG + Intergenic
1130319592 15:82829535-82829557 TGCATGGCTGTGTCTGCATCAGG + Intronic
1130924011 15:88371710-88371732 GGCACTGCTGCCTCTGCTGCCGG - Intergenic
1131015373 15:89053464-89053486 GGCACTGCTCAGTCAGCAGTTGG - Intergenic
1131388277 15:92026041-92026063 AGCTCTGCTCTGTGTGCAGCAGG + Intronic
1132196680 15:99918965-99918987 GGCTCTCCTGGGTCTCCAGCTGG - Intergenic
1132352043 15:101145805-101145827 GGCAGAGCTGAGTCTGCAGAAGG + Intergenic
1132389444 15:101427751-101427773 GGCACTGCTGCGTCTGGCCCAGG + Intronic
1132587214 16:710784-710806 GGCACTGTGGTGTCCCCAGCGGG + Intronic
1132855072 16:2041073-2041095 GGCAGGGCTGGGGCTGCAGCTGG - Intronic
1133038410 16:3046941-3046963 GGCGCTGCTGCTTCTGCTGCTGG + Exonic
1133944320 16:10335760-10335782 AGCACAGCTGTGTCTTCAGGAGG + Intronic
1134055913 16:11169800-11169822 GGCCCTGCCGTGGCTACAGCAGG - Intronic
1135551211 16:23399586-23399608 AGCACTCATGTGTCTGCAGGGGG - Intronic
1137668096 16:50263365-50263387 GGCAGTGCTGAGGCTGCAGCAGG + Intronic
1137786523 16:51141781-51141803 GGTACTGCTGTGGCTGCCGCTGG + Exonic
1138392585 16:56681517-56681539 GACACTGCTGGGTCTGAATCCGG - Intronic
1140596393 16:76419833-76419855 CTCTCTGCTGTGTCTGCACCTGG + Intronic
1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG + Exonic
1141602565 16:85135353-85135375 AGCCCTGTGGTGTCTGCAGCGGG - Intergenic
1141638575 16:85328655-85328677 GGCCCTGCAGGGTCTGCAGTGGG + Intergenic
1142301766 16:89262771-89262793 GCCACATCTGTGTCTGCAGATGG + Intergenic
1145234666 17:21200141-21200163 GTCACTGCTGGGGCTGCAGCCGG - Intronic
1145370501 17:22303003-22303025 GCCATTGCTGTGGCTGCAGCAGG + Intergenic
1146221999 17:31032083-31032105 GCCAGTGCAGTGTCTGCACCGGG + Intergenic
1147243717 17:39107374-39107396 GACCCAGCTGTCTCTGCAGCTGG + Intronic
1148623727 17:49053566-49053588 GGCAGTGCTATCTCTGCAGTAGG - Exonic
1148699827 17:49580678-49580700 GACCCTGCTGGGTCTGCAGATGG - Intronic
1149606902 17:57931534-57931556 GGCACTGCTGTTCCTGCAGTGGG + Intronic
1150296185 17:64008855-64008877 GGCCCTGCTGTGTATGCAGGTGG - Intronic
1150410809 17:64939210-64939232 GGCATTGCTGAGCCAGCAGCAGG + Intergenic
1151787360 17:76281587-76281609 GGCACTGATCTGTCCTCAGCCGG + Intronic
1152754231 17:82080438-82080460 GGCTCTGCTGGGCCTGCAGCTGG + Exonic
1152814160 17:82397656-82397678 GGCACTGCTGTGTCTGCAGCAGG + Intronic
1154317965 18:13320937-13320959 GCCACGCCTGTGTCTGCAGGTGG + Intronic
1155258336 18:24017672-24017694 GTCACTGCTGAGCCTTCAGCAGG - Intronic
1156642197 18:39116040-39116062 GGATCTCCTGTGTCAGCAGCAGG - Intergenic
1156869964 18:41934032-41934054 AGCACTCCTGTTACTGCAGCAGG - Intergenic
1157075065 18:44456759-44456781 ACCACTGCTGTCTCTGCTGCTGG - Intergenic
1157207126 18:45710229-45710251 GTCACTGCTGTGTGTGCACGTGG + Intergenic
1157273562 18:46294594-46294616 GGGACTGCTGTGTGTGTGGCAGG - Intergenic
1157501002 18:48190758-48190780 AGCAAGGCTGTGTCTGCAGTGGG - Intronic
1158962819 18:62600810-62600832 GGGATGGGTGTGTCTGCAGCTGG - Intergenic
1159715264 18:71813818-71813840 TGCACTGAGGTCTCTGCAGCAGG + Intergenic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1160034173 18:75285949-75285971 GGTACTGCTGTGGCTGGTGCTGG - Exonic
1160586169 18:79914792-79914814 GGCAGGGCTGAGTCTGGAGCCGG - Intronic
1160800485 19:965443-965465 GACACTGCTGTGTGTGCTGTTGG - Intronic
1160919191 19:1511956-1511978 GCCACTGCTGAGGCTGGAGCAGG + Intronic
1161133912 19:2608519-2608541 GGCACAGGTGTGCCTGCATCTGG - Intronic
1162006142 19:7780803-7780825 GGCACAGATGTTTCTGCAACTGG - Intergenic
1163408056 19:17135979-17136001 GGCCCTGGGGTGTCTGCAGCAGG - Intronic
1163480904 19:17555761-17555783 GGCGCTGCTGCTTCTGCTGCTGG + Exonic
1164595152 19:29527207-29527229 GGGACTTCTGTGAATGCAGCTGG - Exonic
1164734971 19:30534578-30534600 GAAACAGCTGTGTCAGCAGCTGG - Intronic
1165048589 19:33126355-33126377 GGTTCTGCTGTGTCTGTTGCTGG + Intronic
1165178800 19:33949928-33949950 GGCACTGCTGTTTCTGTGACTGG + Intergenic
1166315541 19:41987578-41987600 GGCCCTGATGTATCAGCAGCGGG + Intronic
1166410229 19:42551802-42551824 TGCACTGCTGTCTCTGAAGATGG + Intronic
1168263568 19:55209086-55209108 GACACTGTCGTGTCTGCTGCGGG - Intronic
1168269385 19:55241388-55241410 GGCCTCCCTGTGTCTGCAGCTGG - Exonic
925656273 2:6152894-6152916 ACCACAGATGTGTCTGCAGCTGG + Intergenic
925754186 2:7118218-7118240 GGCAGAGCACTGTCTGCAGCTGG - Intergenic
925836220 2:7949676-7949698 TGCACTGCTGTGTCTGGTCCAGG - Intergenic
926092148 2:10058070-10058092 GGCACTGCTGTGCCTGGGGCAGG + Exonic
927083033 2:19649117-19649139 GGCATTCCTTTGTCTGCAGGAGG - Intergenic
927865686 2:26585888-26585910 GGGACAGCTGTGAGTGCAGCAGG - Intronic
927968941 2:27291896-27291918 GGGACTGTGGTGTCAGCAGCAGG + Intronic
928617343 2:33053755-33053777 GGCCCTGCTTTGCCTACAGCAGG - Intronic
930780950 2:55224466-55224488 GGCGCTGCAGTTTGTGCAGCAGG + Intronic
931282815 2:60808658-60808680 GGCTCTGCTGTGTCTGCGGGTGG + Intergenic
932059630 2:68482901-68482923 TGCTATGCTGTTTCTGCAGCTGG + Intronic
932714939 2:74094043-74094065 GGCACTGCTCTGCATGCTGCGGG + Intronic
932768554 2:74487069-74487091 GACACTGCTGTGGCTGGAGGAGG + Intronic
933030858 2:77326980-77327002 GGCTCAGCTGTTTCTGCTGCAGG + Intronic
933749852 2:85596197-85596219 GGCACTGCTGTTACTGGACCTGG + Intronic
934161445 2:89253318-89253340 GGCATTGCCATGTCTGCTGCTGG + Intergenic
934205834 2:89929097-89929119 GGCATTGCCATGTCTGCTGCTGG - Intergenic
934531075 2:95089513-95089535 GGCAGGGCTGTGACTGCACCGGG - Intronic
934637817 2:96007079-96007101 GTCACTGCTGTGTGGGCGGCTGG - Intergenic
934795843 2:97098332-97098354 CTCACTGCTGTGTGGGCAGCTGG + Intergenic
937151892 2:119691850-119691872 GACATTGCTGTGGCAGCAGCTGG + Intergenic
937334110 2:121050404-121050426 GCCACTGCTGCGACTGGAGCAGG - Intergenic
938128611 2:128692232-128692254 GGCACTGCTCTGTCGGAAGCAGG - Intergenic
938929736 2:136076160-136076182 GGCACTGATGTTTCTGCAACTGG + Intergenic
940879155 2:158929195-158929217 GGGAAGGGTGTGTCTGCAGCAGG - Intergenic
941554412 2:166958523-166958545 GGCACTTCAGTGTGTGAAGCTGG + Intronic
942085697 2:172441814-172441836 GGCACAGCTCTGTCTGTAGCTGG - Intronic
942512990 2:176722671-176722693 AAGACTGCTGTGTCTGCAGTGGG + Intergenic
943226433 2:185185033-185185055 GGCACTTCTGAGTCTGCGGTGGG - Intergenic
943681310 2:190770787-190770809 GGCACTGCTGCATCTGGAACAGG + Intergenic
947060041 2:226153949-226153971 GGCTGTGGTATGTCTGCAGCAGG - Intergenic
947463678 2:230323647-230323669 GCCCCTGTTGTATCTGCAGCTGG - Intergenic
947585993 2:231357306-231357328 AGCACTGCTCTGCCTCCAGCCGG - Intronic
947716117 2:232339653-232339675 GGATCTGCTGTGCCTGCAGCTGG + Intronic
947767588 2:232647466-232647488 GGCACTGCTGGAACTGCACCAGG + Intronic
948264485 2:236627041-236627063 GGCACTTATGTGGCAGCAGCAGG - Intergenic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
948767644 2:240231714-240231736 GGGACTGGTGGGTCTGCTGCTGG - Intergenic
1168794638 20:603370-603392 GTCTCTGCTGGGTCTGCAGTGGG + Intergenic
1170728941 20:18955584-18955606 GGCAAGGCTGTGATTGCAGCTGG + Intergenic
1171020078 20:21577020-21577042 GGAAGTTCTGTGTCTGCAGAAGG - Intergenic
1171803318 20:29648603-29648625 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1171840803 20:30208511-30208533 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1172502066 20:35434475-35434497 GGCCCAGCTGTGCCTGGAGCTGG - Exonic
1173000309 20:39100982-39101004 GGAAGTGCTGTGGCTGCAGCAGG + Intergenic
1173078069 20:39839690-39839712 GTGCCTGCTGTGTCTGCAGTGGG - Intergenic
1173332310 20:42085557-42085579 GTCATTGCTGAGTCTGGAGCCGG + Intronic
1173450500 20:43159377-43159399 GGCAATGATGACTCTGCAGCAGG - Intronic
1173586752 20:44188009-44188031 GGGTCTGCTGGGTCTGCGGCAGG - Intergenic
1174219926 20:48946166-48946188 AGCACTGATGTATCTGCAGCTGG - Intronic
1174494609 20:50930906-50930928 GGCACGGCGGTGGCGGCAGCGGG + Exonic
1175064279 20:56272225-56272247 GGCACTTCTGAGTCTGCAGGGGG - Intergenic
1176111663 20:63413713-63413735 GGCCCTTCTGTGTGTGGAGCTGG - Intronic
1176581210 21:8528880-8528902 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1177286627 21:19059909-19059931 GCCACTGCTGTGTCTGAAAGAGG + Intergenic
1177653102 21:23983182-23983204 CTTACTGCTGTGTCTGCTGCTGG + Intergenic
1178915556 21:36703911-36703933 GGCACTGCTGAGTCTGGTGCTGG - Intronic
1179440115 21:41387755-41387777 GGCACTGGTGAATCGGCAGCTGG - Intronic
1179940652 21:44637278-44637300 GGCATTGCTGAGTCTCCTGCTGG + Intronic
1181374650 22:22447292-22447314 AGCAGTGCTGTGTCTACAGTGGG + Intergenic
1181847602 22:25724770-25724792 GATACCGCTGTGTCTGCACCCGG + Exonic
1182150004 22:28021215-28021237 GGCCCTACTGTCTCTGCAGTAGG + Intronic
1182795249 22:32986991-32987013 GGCTCTTTTGTGGCTGCAGCAGG + Intronic
1183461562 22:37953979-37954001 GGCCCTCCTGTGCCTCCAGCCGG - Intronic
1183582366 22:38733599-38733621 GACCCTTCTGTGTGTGCAGCAGG + Intronic
1184237020 22:43187789-43187811 GGCGCTTCTGTGCCTGCACCGGG + Intergenic
1184449058 22:44572159-44572181 GCCACTGCTGTGGTTCCAGCCGG - Intergenic
1184457032 22:44616652-44616674 GGCACGCCTGTGTCTGCACCTGG - Intergenic
1185344623 22:50305879-50305901 GGCCCTGCTGAGCCTGCAGTGGG - Intronic
949300606 3:2579417-2579439 AGCTCTGCAGTGTCTCCAGCTGG - Intronic
949752603 3:7372010-7372032 GGCCCTGCTGTCTCTGCACATGG - Intronic
950154185 3:10709348-10709370 GGCACTGCAGTGCCTCCAGATGG + Intergenic
953748069 3:45590446-45590468 GGCACAGCTGTGGCTGGACCAGG + Intronic
954300733 3:49699552-49699574 GGCAGTGCTGAGTGTGGAGCTGG + Exonic
955365423 3:58306319-58306341 GGCCCAGCTGTGGCTGCTGCCGG + Exonic
955403662 3:58611394-58611416 GTCACTGGTGTGGCTTCAGCAGG + Intronic
955703737 3:61707383-61707405 GGCTCTCCTGGGTCTCCAGCTGG - Intronic
957197548 3:77089601-77089623 GGCACTGCTGTGCTTCCAGAAGG + Intronic
958537141 3:95418410-95418432 TGCACTGGTGGGTCAGCAGCGGG + Intergenic
960979602 3:123210532-123210554 GGCACTGCTAGGTAAGCAGCTGG + Intronic
961365893 3:126398993-126399015 GGCACTGCTGTGTCCTCCACAGG + Intronic
961791226 3:129378242-129378264 GGCACTGCTGAGCCTGCAAGGGG + Intergenic
962171327 3:133104607-133104629 GGCCCTGCTGTGTGCACAGCTGG + Intronic
962251569 3:133839173-133839195 AGGACTGCTGTGTCTGGGGCAGG + Intronic
963459261 3:145586909-145586931 GGCACTCCTGTGGCTGCCACAGG - Intergenic
963506840 3:146196790-146196812 GTCACTGTTTTGTTTGCAGCTGG - Exonic
965367677 3:167820427-167820449 GGCACTTCTGAGCCTGCAGTGGG - Intronic
967720412 3:192810128-192810150 GGTACTGCTGTGTCTGTAAAGGG - Intronic
968687685 4:1972516-1972538 GGCATTCCTGTGACTCCAGCGGG + Intronic
968756086 4:2417355-2417377 GGCCCTGCTCCGGCTGCAGCGGG + Intronic
969252729 4:5980251-5980273 GGCACTGCAGGGTCAGCACCCGG + Exonic
969498199 4:7538270-7538292 GGGACTGCTGATTCTGCTGCAGG - Intronic
969603186 4:8189034-8189056 GGCAAAGCTGTGTGGGCAGCTGG - Intronic
969842380 4:9892016-9892038 GGCACTGGGGTCCCTGCAGCTGG - Intronic
971173316 4:24256641-24256663 GCTACTGCTGTGTCTACAGGAGG + Intergenic
972177144 4:36422038-36422060 GACAATGCTGCCTCTGCAGCGGG - Intergenic
972312076 4:37891150-37891172 GGACCTGCTGTGTCCTCAGCTGG + Exonic
972629021 4:40827555-40827577 GCCACTGCTGTGGCTGCCGCTGG - Intronic
973553684 4:52060347-52060369 GGCCCTGGTCTGTCTGCAGTGGG + Intronic
974537384 4:63188866-63188888 GGCTCAGCTTTGTCTACAGCAGG + Intergenic
978704496 4:111690668-111690690 TCCACTGCTGTGTCTGCCCCTGG + Intergenic
978822375 4:112980296-112980318 GGCACTTCTGAGCCTGCAGGTGG + Intronic
979450479 4:120864957-120864979 GACACAGCTGTGTCTGTAGCAGG - Intronic
980395548 4:132209336-132209358 TTCACTGCTGTATCTGCAGCTGG - Intergenic
982400265 4:154959034-154959056 GGCATTGCTGTGACAGCAACAGG - Intergenic
983125954 4:163950453-163950475 GGCACTTCTGAGCCTGCAGCAGG + Intronic
983699372 4:170572695-170572717 GGCTCTTCTGGGTCTCCAGCTGG + Intergenic
984849917 4:184144333-184144355 GGCACTGCTGGGGCTCCTGCTGG - Intronic
985123031 4:186662551-186662573 AGCAGTGCTGTATCTGCAGGTGG - Intronic
985788765 5:1914123-1914145 GGCACTGCTGTGTGCGCTCCCGG - Intergenic
985925103 5:3009677-3009699 GGCACTGTTAGGTCTGCAGATGG + Intergenic
986027460 5:3864480-3864502 GTCACTAGTGTGGCTGCAGCTGG + Intergenic
986754921 5:10826610-10826632 GGTACTGCTGTCTCTGGAGATGG - Intergenic
987583466 5:19824693-19824715 GGGACTGCTGGGCCTGAAGCTGG - Intronic
988683135 5:33502795-33502817 GGCACTGTCATGTCTGTAGCTGG + Intergenic
990341903 5:54831654-54831676 GGCATTGCTGTCCTTGCAGCAGG - Intergenic
991096615 5:62746557-62746579 GGCTCTGTTGTATCTTCAGCTGG + Intergenic
992397083 5:76378220-76378242 GGCACTGCAGGGTGTGAAGCAGG + Intergenic
992758597 5:79932209-79932231 GCCTCTGCCATGTCTGCAGCTGG - Intergenic
994125531 5:96166095-96166117 GGCGCTCCTGAGTCTTCAGCTGG + Intergenic
997631786 5:135374226-135374248 ACCTCTGCTGTCTCTGCAGCAGG - Intronic
997655134 5:135548805-135548827 GACATTGCTGTGTTTGGAGCTGG + Intergenic
998659447 5:144219909-144219931 AGCACTTCTGTTTCGGCAGCAGG - Intronic
1000152280 5:158515070-158515092 GCCACTGCTGTCTCTGTAACTGG - Intergenic
1001003548 5:168029998-168030020 GGCACTGCTGAGTTTGGAGGGGG + Intronic
1002097716 5:176841262-176841284 GGCACAGCTCTGTCTGCAAACGG - Intronic
1003495085 6:6656764-6656786 GGCACTCCAATGTCTGAAGCTGG - Intergenic
1003995783 6:11538120-11538142 GGCGCTGCTGCTGCTGCAGCCGG - Intergenic
1004165550 6:13253678-13253700 GGCTCTGCTGAGTCTAAAGCAGG - Intronic
1004459350 6:15821028-15821050 GGCACCACTGTGTCTCCATCTGG + Intergenic
1005284766 6:24313603-24313625 AGCAATGCTGAGTATGCAGCGGG + Intronic
1006132258 6:31876869-31876891 GGGATTGTTGTGTCTGGAGCAGG - Intronic
1006294441 6:33163806-33163828 GGCCTTGCTGTGTCTTCAGGGGG + Exonic
1006723059 6:36172685-36172707 GGCACAGCTGGCTCTTCAGCAGG - Intergenic
1007108982 6:39302130-39302152 GGCACTGCCATGACTGCAGAGGG + Intronic
1011177542 6:84581308-84581330 GACACTGATGGGTCTGTAGCAGG + Intergenic
1012133511 6:95525270-95525292 GTCACTGCTGTGTCTGGAATTGG - Intergenic
1013366892 6:109443647-109443669 GGCACTGCTGTGTGTCCTGGCGG + Exonic
1016767910 6:147815542-147815564 GTCCCTGCTGTGTCTGCCTCAGG - Intergenic
1018906132 6:168077248-168077270 TGCACATCTGTGTCTGCAGTTGG - Intronic
1018906149 6:168077345-168077367 TGCACATCTGTGTCTGCAGTTGG - Intronic
1018906165 6:168077439-168077461 TGCACATCTGTGTCTGCAGTTGG - Intronic
1018906181 6:168077533-168077555 CGCACATCTGTGTCTGCAGTTGG - Intronic
1018952111 6:168386002-168386024 GGCACCTCTGTGTCTGCCGGTGG + Intergenic
1019145477 6:169972968-169972990 GACACAACTGTGTGTGCAGCAGG + Intergenic
1019727928 7:2613217-2613239 GACACTGCTGAGGCTGAAGCTGG + Exonic
1020376967 7:7498755-7498777 GCCACTGCAGTGTCTTCAGAGGG - Intronic
1020728952 7:11856341-11856363 TGAACTGGTTTGTCTGCAGCAGG + Intergenic
1022718077 7:32916579-32916601 GGCCAGGGTGTGTCTGCAGCTGG - Intergenic
1023445268 7:40224963-40224985 GCCCCAGCTGTGTCTGCAGTGGG + Intronic
1023938811 7:44757356-44757378 GGCAATCCTGTGTCTCCTGCAGG + Exonic
1024114392 7:46178659-46178681 GGCATTGCTGTGTCTGCACTGGG + Intergenic
1024667247 7:51559273-51559295 GCCACTGCTGGGACTGAAGCAGG - Intergenic
1024679093 7:51664995-51665017 GGCAATGATGTGTTTTCAGCGGG + Intergenic
1027734372 7:81914405-81914427 GCTGCTGCTGAGTCTGCAGCGGG + Intergenic
1027780011 7:82508350-82508372 GGCACTTCTGAGCCTGCAGGGGG + Intergenic
1029111617 7:98215651-98215673 TGGCCTGCTGTGTCTGCAGGTGG - Exonic
1031120704 7:117718603-117718625 GGCACTCTAGTATCTGCAGCAGG - Intronic
1031838370 7:126706327-126706349 AGCACTCCTGGGTCTCCAGCTGG - Intronic
1033243394 7:139699585-139699607 GGCAAGGCTGGGCCTGCAGCTGG + Intronic
1034206509 7:149320518-149320540 GGCACTTCTGTGGCTGGAGCAGG + Intergenic
1034442038 7:151090604-151090626 GCCACAGCTGTGACTGCAGTTGG + Intronic
1034442834 7:151095633-151095655 GGCACTTCTGTGCCTGGAGGAGG + Intronic
1034943005 7:155244175-155244197 GGCACTTCTGTGTTGGGAGCAGG - Intergenic
1035279802 7:157770729-157770751 GACCTTGCTGTGTCTGGAGCTGG - Intronic
1035372641 7:158389068-158389090 GGCACTGCCCTGCCTGCATCTGG - Intronic
1035929764 8:3767127-3767149 GAGGCTGCTGTGTCTCCAGCTGG + Intronic
1036823442 8:11957690-11957712 GCCACTGCTGGGTCTGACGCAGG - Intergenic
1036825714 8:11974368-11974390 TGCTCTGCTGTTGCTGCAGCTGG - Intronic
1037063509 8:14546184-14546206 GGCAGTGCGGTCTCTGCTGCTGG + Intronic
1037752628 8:21692712-21692734 GGGGCTGGTGGGTCTGCAGCTGG - Exonic
1037920913 8:22804853-22804875 GGGACTGGTGTGGCTGCAGCAGG - Intronic
1041381993 8:57260589-57260611 GGCCCTGCGGTCCCTGCAGCTGG - Intergenic
1041451359 8:58009999-58010021 GGCACGGCTCTCTCTGTAGCTGG + Intronic
1049205135 8:141360121-141360143 GGCTCTGCGGTCTCTGGAGCTGG + Intronic
1049608494 8:143541145-143541167 GGCCCTGCTGGGGCTGCAGAGGG - Intronic
1049646404 8:143737808-143737830 GCCACAGCTGCATCTGCAGCTGG + Intergenic
1056089055 9:83186575-83186597 GGCACAGCAGTGTTTGCAGCAGG - Intergenic
1056810082 9:89757364-89757386 GGTCCTGCTGGGACTGCAGCTGG + Intergenic
1056993804 9:91436109-91436131 GGCACTGCTGTCTCTGCTGTAGG + Intergenic
1059328957 9:113523139-113523161 GGCACTGGAGTGTGTGCTGCTGG + Intronic
1059380421 9:113919299-113919321 CCCACTGGTGTGTCTGTAGCTGG + Intronic
1059649702 9:116304406-116304428 AGCACTGTTGTTTCTGAAGCAGG - Intronic
1060965793 9:127711752-127711774 GGCCTGGCTGTGTCTGCAGCTGG + Intronic
1061375191 9:130219924-130219946 GTCCCAGCTGTGTCTGCAGAGGG + Intronic
1061579239 9:131526777-131526799 GGGACAGCTGTGTCTGCAGTTGG + Intronic
1061593221 9:131612322-131612344 GACACTACTGTGCCTGAAGCTGG + Intronic
1062387597 9:136319170-136319192 TGCACTGCTGTGCCCGCTGCGGG + Intergenic
1062394666 9:136348011-136348033 GGCTCCGCTGAGTCTGCAGCTGG + Intronic
1062547772 9:137071293-137071315 GCCTCTGCTGTGTTTCCAGCTGG + Intergenic
1062604410 9:137338988-137339010 GGCTCTGCTGTGTCTGCAGCTGG - Intronic
1062697980 9:137885102-137885124 TGCTCGCCTGTGTCTGCAGCAGG + Intronic
1203611228 Un_KI270749v1:6925-6947 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1185488811 X:503745-503767 GCCACTGCTGTGCTTGCTGCTGG + Intergenic
1186369043 X:8927824-8927846 AGCGCTGCGGGGTCTGCAGCGGG - Intergenic
1187035131 X:15530327-15530349 GGCACTCCTGTGGCTGCATTTGG + Intronic
1188712329 X:33415888-33415910 GCCATGGCTGTGTCTGTAGCAGG - Intergenic
1190263550 X:48814656-48814678 CACACTCCTGTGTCTGCAGGTGG + Exonic
1193489707 X:82134050-82134072 GGCACTTGTGTGTGTGCAGAAGG - Intergenic
1194382963 X:93218181-93218203 GTCACTGCTTTGACTGAAGCAGG - Intergenic
1196828517 X:119758892-119758914 GGAACTGCTGGGGCTGCAGCGGG + Exonic
1197053502 X:122090161-122090183 GGCAGTGTTTTGTCTTCAGCAGG - Intergenic
1197701181 X:129601112-129601134 TGCCCAGCTGTGTCAGCAGCTGG - Intergenic
1198725824 X:139676075-139676097 GACACTGCTGTGTTAGCAGTAGG + Intronic
1200216798 X:154371655-154371677 GGGACTGCTTGGCCTGCAGCCGG + Intronic
1200880598 Y:8208170-8208192 GGCACAGCTTTGCCTACAGCAGG - Intergenic