ID: 1152815217

View in Genome Browser
Species Human (GRCh38)
Location 17:82403921-82403943
Sequence GGACAAGGTGAGCGCGCCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 2, 2: 1, 3: 9, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152815217 Original CRISPR GGACAAGGTGAGCGCGCCCG TGG (reversed) Exonic