ID: 1152815811

View in Genome Browser
Species Human (GRCh38)
Location 17:82407089-82407111
Sequence CTGTAATCCCAGCTGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 998
Summary {0: 1, 1: 1, 2: 17, 3: 94, 4: 885}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152815804_1152815811 22 Left 1152815804 17:82407044-82407066 CCCATGTCTACTAAAAATACAAA 0: 1217
1: 94042
2: 246506
3: 151734
4: 74243
Right 1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG 0: 1
1: 1
2: 17
3: 94
4: 885
1152815805_1152815811 21 Left 1152815805 17:82407045-82407067 CCATGTCTACTAAAAATACAAAA 0: 2995
1: 205611
2: 139830
3: 62519
4: 41655
Right 1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG 0: 1
1: 1
2: 17
3: 94
4: 885
1152815803_1152815811 23 Left 1152815803 17:82407043-82407065 CCCCATGTCTACTAAAAATACAA 0: 1150
1: 88102
2: 176243
3: 171464
4: 104161
Right 1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG 0: 1
1: 1
2: 17
3: 94
4: 885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152815811 Original CRISPR CTGTAATCCCAGCTGTAGCT GGG Intronic
901008271 1:6182190-6182212 CTGTAGTCCCAGCTGCTACTGGG - Intronic
901575290 1:10195887-10195909 CTGTAGTCCCAGCTGCTTCTTGG - Intergenic
902309451 1:15569905-15569927 CTGTAATCCCAGCAGCACTTTGG - Exonic
903204600 1:21771794-21771816 CTGTAATCCCAGCTGTCAGGGGG + Intronic
903206729 1:21787962-21787984 CTGTAATCCCAGCTATCGGGAGG + Intergenic
903274684 1:22212971-22212993 CTGGAATCCCACCTGGAACTCGG - Intergenic
903363040 1:22789009-22789031 CTGTAATCCCAGCTTTAGGGAGG - Intronic
903403536 1:23076837-23076859 CTGTAATCCCAGCAGTTACTTGG + Intronic
903926219 1:26832615-26832637 TTCTACTCCCAGCTGAAGCTGGG + Intronic
903988313 1:27245825-27245847 CTGTAATCCCAGCACTTTCTGGG - Intronic
904023106 1:27483511-27483533 CTGTAATCCCAGCTGCTACTAGG + Intronic
904524809 1:31125006-31125028 CTGTAATCCCAGCTTTCGGGAGG + Intergenic
904648865 1:31989158-31989180 CTGTAATCCCAGCAGCACTTTGG - Intergenic
904736520 1:32638445-32638467 CTGTAATCCCAGCTTTTGGGAGG - Intronic
905575134 1:39038010-39038032 CTGTAATCCCAGCTACAGGGAGG - Intergenic
905659569 1:39711085-39711107 CTGTAATCCCAGCTCAAGATGGG + Intronic
905662299 1:39736938-39736960 CTGTACTCCCAGCTGCTACTCGG + Intronic
905713882 1:40131633-40131655 CTGTAATCCCAGCTACAGGCTGG - Intergenic
906160634 1:43646672-43646694 CTGTAATCCCAGCACTAGGGAGG - Intergenic
906269427 1:44463211-44463233 CTGTAATCCCAGCTCTTGGGAGG + Intronic
906301959 1:44689182-44689204 CTGTAATCCCAGCTCTTGGGAGG - Intronic
906366906 1:45218197-45218219 CTGTAATTCCAGCTGCTACTTGG - Intronic
906434396 1:45782531-45782553 CTGTAATCCCAGCTATATGGGGG + Intergenic
906502299 1:46350271-46350293 CTGTAATCCCAGCACAAGCTAGG + Intronic
907181895 1:52578117-52578139 CTGTAGTCTCAGCTGAACCTGGG + Intergenic
907193858 1:52670448-52670470 CTGTAATCCCAGCTATTGGGAGG + Intergenic
908189421 1:61686538-61686560 CTGTAATCCCAGCTACTACTAGG + Intronic
908263112 1:62353924-62353946 CTGTATTTCCAGCTGAAACTGGG - Intergenic
908769454 1:67583003-67583025 CTGCAATCCCAGCAGTGGGTAGG - Intergenic
908835698 1:68227293-68227315 CTGTAATCCCAGCTATCGGGAGG + Intronic
908998975 1:70195756-70195778 CTGTAAGTCCAGCTGCTGCTCGG - Intronic
909010715 1:70331698-70331720 CTGTAATCCCAGCTACTACTAGG + Intronic
909617623 1:77629494-77629516 CTGTAGTCCCAGCAGCAACTTGG + Intronic
910396002 1:86794408-86794430 CTGTAATCCCAGCTCTCGGGAGG + Intergenic
912114461 1:106388160-106388182 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
912340385 1:108908759-108908781 CTGTAATCCCAGCTCTTGGGAGG + Intronic
912835855 1:112995798-112995820 CTGTAATCCCAGCTACAGGGAGG + Intergenic
913477384 1:119251493-119251515 CTGTAATCCCAGCCGAGGCAGGG + Intergenic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
915226063 1:154412376-154412398 CAGTAATCCCAGCTGAGGCCAGG - Intronic
915389294 1:155526946-155526968 CTGTAATCCCAGCAGTTGGGAGG + Intronic
915413551 1:155722143-155722165 CTGTAATCCCAGCTGCACTTTGG + Intronic
915436223 1:155908683-155908705 CTGTAATCCCAGCTACTGCGGGG - Intronic
916127889 1:161587642-161587664 CTGTAATCCCAGCTCTTGGGAGG + Intronic
916137805 1:161669446-161669468 CTGTAATCCCAGCTCTTGGGAGG + Intronic
916527217 1:165621922-165621944 CTGTAATCCCAGCATAGGCTAGG + Intergenic
917174195 1:172213704-172213726 CTGTAATCCCAGCTATCGGGAGG + Intronic
917521559 1:175752121-175752143 CTGTAGTCCCAGCTACAGGTGGG + Intergenic
917565034 1:176204800-176204822 CTGTAATCCCAGCTACTACTCGG + Intronic
918176271 1:182048428-182048450 CTGTCACCCCACCTGTAGCAAGG + Intergenic
918525319 1:185458287-185458309 CTGTAATCCCAGCTTTTGGGAGG - Intergenic
918659425 1:187071667-187071689 CTGTAATCCCAGCAGCACCTTGG - Intergenic
919186981 1:194163628-194163650 CCCTAATCCCAGCTGTATGTTGG - Intergenic
919876517 1:201873183-201873205 CTGTAATCCCAGCACTTGGTGGG + Intronic
919983027 1:202654117-202654139 CAGTAAGCTCAGCTGTGGCTGGG - Intronic
920373646 1:205494805-205494827 CTGTAATCCCAGCTTTTGGGAGG - Intergenic
921171982 1:212558566-212558588 CTGAAATCCGAGCAGGAGCTGGG - Intergenic
921246882 1:213253129-213253151 CTGTATTTCCTGCTGTATCTTGG + Intronic
921764298 1:218952404-218952426 CTGTAATCCCAGCTTTACTCAGG - Intergenic
921858988 1:220020998-220021020 CTGTAATCCCATCTATACCTGGG - Intronic
922230383 1:223680568-223680590 CTGTAATCCCAGCTATTGGGAGG - Intergenic
922672215 1:227519175-227519197 CTGTGTTCTCAGCTGAAGCTGGG + Intergenic
922846186 1:228686860-228686882 CTGTAATCCCAGCTATTGGGAGG - Intergenic
923489189 1:234468329-234468351 CTGTAATCCCAGCTACTGGTGGG + Intronic
923490947 1:234483585-234483607 CTGTAATCCCAGCTGCACTGGGG - Intergenic
923593055 1:235337704-235337726 CTGTAGTCCCAGCTGAGGCACGG + Intronic
923656990 1:235925606-235925628 CTGTAATCCCAGCAGCACTTTGG + Intergenic
923668423 1:236019160-236019182 CTGTTATGCAAGCTGGAGCTGGG + Intronic
924148964 1:241108179-241108201 CTGTAATCCCAGCTATCGGGAGG + Intronic
924763653 1:247011506-247011528 CTGTAATCCCATCTATAGGGAGG + Intergenic
924822169 1:247503801-247503823 CTGTGTTCTCAGCTGAAGCTGGG + Intergenic
1062980614 10:1719084-1719106 CTGTAATCCCAGCTACTACTTGG - Intronic
1063027217 10:2192241-2192263 CTGTAATCCCAGCTGTGATTGGG - Intergenic
1063047605 10:2409064-2409086 CTGTAATCCCAGCTACATTTTGG - Intergenic
1063249582 10:4259368-4259390 CTGTAATCCCAGCTTTTGGGAGG - Intergenic
1063293557 10:4777484-4777506 CTGTAGTCCCAGCTATAGCCTGG - Intergenic
1063337845 10:5233943-5233965 CTGTATTCCCAGCTAAATCTAGG - Intergenic
1063595108 10:7427843-7427865 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1063642332 10:7842280-7842302 CTGTGATCCCAGCTGGTGGTAGG - Intronic
1063771287 10:9205003-9205025 CTGTAATCCCAGCTATAGGGAGG + Intergenic
1064045556 10:12011473-12011495 CTGTAGTCCCAGTTATTGCTTGG + Intronic
1064368710 10:14731302-14731324 CTGTAATCCCAGCAGTATGGGGG + Intronic
1064654613 10:17544817-17544839 CTGTAATCCCAGCTACAACGAGG + Intergenic
1065058815 10:21875800-21875822 CTGTAATCCCAGCTATTCCAGGG + Intronic
1065207737 10:23373171-23373193 TGGGAGTCCCAGCTGTAGCTGGG + Intergenic
1065207738 10:23373178-23373200 CTGCAGTCCCAGCTACAGCTGGG - Intergenic
1065252766 10:23833211-23833233 CTGTAAGCCAAGCTTTTGCTAGG - Intronic
1065561041 10:26964034-26964056 CTGTAATCCCAGCTACACTTGGG - Intergenic
1066538051 10:36412726-36412748 CTGTAGTCCCAGCAGTTACTAGG + Intergenic
1067075081 10:43173868-43173890 CTGTAATCCCAGCTGTTCAGCGG + Intronic
1067117214 10:43444825-43444847 CTGTAATCCCAGCACTGCCTGGG - Intronic
1067471185 10:46539720-46539742 CTGTAATCCCAGCTACAGTCAGG - Intergenic
1068085442 10:52368230-52368252 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1068571937 10:58639518-58639540 CTGTAATCCCAGCTACTACTTGG - Intronic
1068707799 10:60096049-60096071 CTGTAATCCCAGCTATCGGGAGG + Intronic
1069476996 10:68743421-68743443 CTGTAATCCCAGCACTTCCTGGG - Intronic
1069518608 10:69100094-69100116 CTGTAATCCCAGCTATTGAGAGG + Intronic
1069551233 10:69365951-69365973 CTGTAATCCCAGCACTAGGGGGG - Intronic
1069637164 10:69931921-69931943 CTGTATTCTCATCTGGAGCTAGG + Intronic
1069905527 10:71730092-71730114 CTGTAATCCCAGCAGCACTTTGG - Intronic
1070003871 10:72403235-72403257 CTGTAATCCCAGCTTTTGGGAGG + Intronic
1070183473 10:74037178-74037200 CTGTAATCCCAGGCGTAAGTGGG - Intronic
1070215024 10:74369095-74369117 CTGTAATCCCAGCTCTTTGTGGG + Intronic
1070650984 10:78236261-78236283 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1071267894 10:83980615-83980637 CTGCAATCCCACTTGCAGCTGGG + Intergenic
1071770330 10:88722170-88722192 CTGTAATCCCAGCTATTCCGGGG + Intergenic
1071893762 10:90041716-90041738 CTGAACTCCCAGCAGTATCTAGG + Intergenic
1072088694 10:92105836-92105858 CTGTAATCCCAGCTACTGGTGGG - Intronic
1072104729 10:92263196-92263218 CTGTAATCCCAGCTACTCCTGGG - Intronic
1072343967 10:94484367-94484389 CTGTAATCCCAGCTGCTGGGAGG - Intronic
1072470635 10:95709896-95709918 CTGTAATCCCAGCTACTGGTGGG - Intergenic
1072854469 10:98932580-98932602 CTGTAACTCCATCTGGAGCTGGG + Intronic
1073004651 10:100314078-100314100 CTGTAATCCCAGCAGTCTGTGGG - Intronic
1073392016 10:103186789-103186811 CTGTAATCCCAGCACTAGGGAGG + Intronic
1074202970 10:111256236-111256258 CTGTAATCCCAGCTACTACTCGG + Intergenic
1074526477 10:114267552-114267574 CTGTAATCCCAGCTATCGGGAGG - Intronic
1075312835 10:121429369-121429391 CTGTAATCCCAGCTCTCGGGAGG - Intergenic
1076020031 10:127065129-127065151 CTGTAATCCCAGCTGCTGGGAGG - Intronic
1077068467 11:655952-655974 CTGTAGTCCCAGCTGTGGGGAGG - Intronic
1077629230 11:3799413-3799435 CTATAATCCCAGCTGCTTCTCGG + Intronic
1078059608 11:8034596-8034618 CAGTAATCCCAGCCTGAGCTGGG + Intronic
1079114947 11:17634933-17634955 CTCTCACCACAGCTGTAGCTGGG - Exonic
1079204445 11:18402076-18402098 CTGTAATCCCAGCTCTTGGGAGG - Intronic
1080007796 11:27428257-27428279 CTGTAATCCCAGCTCTCGGGAGG - Intronic
1080010556 11:27454636-27454658 CTGTAATCCCAGCTACATCAGGG + Intronic
1081321602 11:41698491-41698513 CTGTAATCCCAGCTCTTGGGAGG - Intergenic
1081508714 11:43745772-43745794 CTGTAATCCCAGCTTTTGGAAGG + Intronic
1082040346 11:47679761-47679783 CTGTAATCCCAGCTCTCGGGAGG - Intronic
1082251435 11:49985559-49985581 GTGTACTCTCTGCTGTAGCTGGG - Intergenic
1082665028 11:55964834-55964856 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1083125534 11:60561915-60561937 CTGTAATCCCAGCTCTTGGGAGG - Intergenic
1083864744 11:65447521-65447543 CTGTAATCCCAGCTGCTACTCGG + Intergenic
1084314815 11:68339298-68339320 CTGTAATCCCAGCTCTACTTGGG - Intronic
1085065836 11:73494875-73494897 CTGTAATCCCAGCTACTACTTGG + Intronic
1087020044 11:93592901-93592923 CTGTAATCCCAGCTACTACTTGG + Intergenic
1087068074 11:94046214-94046236 CTGTAATCCCAGCACTAGAGAGG - Intronic
1087634090 11:100683892-100683914 CTGTAATCCCAGCAGGTACTAGG - Intergenic
1088201468 11:107339788-107339810 CTGTAATCCCAGCTGTTGTGGGG - Intronic
1088249814 11:107852747-107852769 CTGTAATCCCAGCTACTACTAGG + Intronic
1088446902 11:109940530-109940552 CTGTAATCTCAGCTGCTACTTGG + Intergenic
1088614755 11:111614204-111614226 CTGTAATCCCAGGTTGACCTGGG - Intronic
1088629564 11:111761700-111761722 CTGTAATCCCAGCCGTCGGGAGG + Intronic
1089387194 11:118076144-118076166 CTGTAATCCCAGCAGCTACTTGG + Intergenic
1089487392 11:118857533-118857555 CTGTAGTCCCAGCTTAAGCCTGG - Intergenic
1089837384 11:121383133-121383155 CTAGAATCCCAGTTGGAGCTTGG + Intergenic
1090700822 11:129294079-129294101 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1090793801 11:130116591-130116613 CTGTAATCTCAGCTGCAGGGTGG - Intronic
1091924827 12:4337286-4337308 CTGTAATCCCAGCTATTGGGAGG - Intronic
1092197222 12:6556596-6556618 CTGTAATCCCAGCACTTTCTGGG - Intergenic
1092365929 12:7877123-7877145 CTGTAATCCCAGCTCTTGGGAGG - Intronic
1092602204 12:10079562-10079584 CTGTAATCCCAGCAGTTGGGAGG + Intronic
1093015936 12:14154750-14154772 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1093180363 12:15960513-15960535 CTGTAATCCCAGCTGCTGGGAGG + Intronic
1093359739 12:18209054-18209076 CTGTAAACCCAGCAGTATATTGG - Intronic
1093913055 12:24769028-24769050 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1094565379 12:31593613-31593635 CTGTAATCCCAGCTCTACTTGGG + Intergenic
1094812387 12:34151283-34151305 CTGTGTTCTCAGCTGAAGCTGGG - Intergenic
1095420002 12:42015617-42015639 CTGTAATCCCAGCTACAGGGGGG - Intergenic
1095811679 12:46378667-46378689 CTGTAATCCCAGCTGTAGGGAGG - Intergenic
1096017186 12:48287229-48287251 CTGTAATCCCAGCACTTGGTGGG - Intergenic
1096296202 12:50386304-50386326 CTGTAATCCCAGCTATAGGGAGG + Intronic
1096300560 12:50423875-50423897 CTGTAATCCCAGCTACTACTCGG - Intronic
1096364646 12:51018270-51018292 CTGTAATCCCAGCTATTGGGAGG + Intronic
1096432346 12:51557083-51557105 CTGTAATCCCAGCTGCTTGTGGG + Intergenic
1096603503 12:52747474-52747496 CTGTTCACCCAGCTGTAGCCTGG - Intergenic
1096644918 12:53027390-53027412 CTGTAATCCCAGCAGCACTTTGG - Intronic
1096655054 12:53084378-53084400 CTGTAATCCCAACAGTTGGTGGG - Intergenic
1097024672 12:56046054-56046076 CTGTAATCCCAGCTACTGGTAGG - Intergenic
1097568634 12:61302833-61302855 CTGTAATCCCAGCTGCTGGGAGG + Intergenic
1097782701 12:63726483-63726505 CTGTAATCCCAGCTACTACTCGG + Intergenic
1098898534 12:76089201-76089223 CTGTAATCCCAGCTACTACTTGG - Intergenic
1098970424 12:76849184-76849206 CTGTAATCCCAGCTGCTGGTGGG + Intronic
1100544325 12:95586827-95586849 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1100545254 12:95596278-95596300 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1100602838 12:96126757-96126779 ATGTAATCCCCACTGTTGCTGGG - Intergenic
1100845110 12:98650237-98650259 TTGTAATCCCAGCTGAGGCGTGG + Intronic
1101115327 12:101525810-101525832 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1101752759 12:107596488-107596510 CTGTAATCCCAGCTGTAATCGGG + Intronic
1101884954 12:108654822-108654844 CTATAATCCCAGCTCTTGCCAGG - Intronic
1101907105 12:108835316-108835338 CTGTAATCCCAGCTATTGGGAGG + Intronic
1102273684 12:111562308-111562330 CTGTAGTCCCAGCTACAGATGGG + Intronic
1102311299 12:111846619-111846641 CTGTAATCCCAGCTACTACTCGG - Intronic
1102417174 12:112773957-112773979 CTGTAATCCCAGCTACTACTTGG + Intronic
1102532901 12:113559847-113559869 CTGTAGTCCCAGCTCCAGCCTGG - Intergenic
1102684842 12:114716766-114716788 CTGTAATCCCAGCTCCTCCTGGG - Intergenic
1103058100 12:117837236-117837258 CATTAGTCCCTGCTGTAGCTGGG + Intronic
1103348594 12:120267072-120267094 CTGTAATCCCAGCAGGAGGCAGG - Intergenic
1103473703 12:121202457-121202479 CTGTAATCCCAGCTACTACTTGG + Intergenic
1103593065 12:122005981-122006003 CTGTAATCCCAGCTGTATCCTGG - Intergenic
1104011378 12:124932790-124932812 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1104605276 12:130183561-130183583 GTGGAATCCCAGCTGCAGGTGGG - Intergenic
1104733050 12:131119470-131119492 CTTTTATCCCATCTGGAGCTTGG + Intronic
1104798141 12:131533915-131533937 CTTTTATCCCATCTGGAGCTTGG - Intergenic
1105370481 13:19797682-19797704 CTGTAATCCCAGCTACACTTGGG + Intergenic
1105386731 13:19937251-19937273 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1105979692 13:25505993-25506015 TTGTAATCCCAGCGTCAGCTTGG - Intronic
1106214648 13:27685300-27685322 CTGTAATCCCAGCACTATTTGGG - Intergenic
1106247078 13:27959856-27959878 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1107123648 13:36821085-36821107 CTGTATACCCAGCTGTACTTGGG + Intronic
1107444061 13:40454112-40454134 CTGTAATCCCAGCAGTTGGGAGG - Intergenic
1108446063 13:50510211-50510233 CTGTAACATCAGCTGTAGCTGGG + Intronic
1108571239 13:51753826-51753848 CTGTAATGCCAGCTGTTGGGAGG + Intronic
1108580682 13:51825864-51825886 CTGTAATCCCAGCAGTTAGTGGG - Intergenic
1108677700 13:52751484-52751506 CTGTAATCCCAGCACTTTCTGGG + Intergenic
1108773609 13:53735482-53735504 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1108977887 13:56472221-56472243 CTGTAATCCCAGCATGAGGTGGG + Intergenic
1110720815 13:78759315-78759337 CTGTAATCCCAGCTGCTGGGAGG + Intergenic
1110858310 13:80320869-80320891 CTGTAATCTCAGCAGCAGTTTGG - Intergenic
1111124614 13:83898218-83898240 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1111124962 13:83903289-83903311 CTGTAATCCCAGCTGCTGGGAGG - Intergenic
1113338323 13:109397977-109397999 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1113684585 13:112273722-112273744 CTGTAATCCCAGCTACACCCTGG + Intergenic
1114949443 14:27730361-27730383 ATGTAATCACAGCAGCAGCTGGG + Intergenic
1115232495 14:31176673-31176695 CTGTAATCCCAGCAGCACTTTGG + Intronic
1115433306 14:33346107-33346129 CTGTAATCCCAGCTGAGGGGAGG + Intronic
1115492239 14:33968624-33968646 CTGTAATCCCAGCAGTTTCTGGG - Intronic
1116117747 14:40678840-40678862 CTGTAATCCCAGCAGTTGGGAGG + Intergenic
1116159384 14:41249488-41249510 CTGTAATCCCAGCTGCTACTTGG + Intergenic
1117057507 14:51928150-51928172 CTGTAATCCCAGCTATTGAGAGG - Intronic
1118193769 14:63605580-63605602 CTGTAATCCCAGCTGCTTCGGGG - Intronic
1118203764 14:63702447-63702469 CTGTAATCCCAGCAGCACTTTGG + Intronic
1118758470 14:68862916-68862938 CTGTAGTCCCAGCTGCTACTTGG - Intergenic
1119205333 14:72789791-72789813 CTGTAATCCCAGCAGCACTTTGG - Intronic
1119253226 14:73175381-73175403 CTGTAATCCCAGCCCTTGCGAGG - Intronic
1119279622 14:73394199-73394221 CTGTAATCCCAGCACGAGGTGGG - Intronic
1119282716 14:73423517-73423539 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1119457543 14:74769407-74769429 CTGTAATCCCAGCTACTCCTGGG - Intronic
1119482797 14:74969567-74969589 CTGTAATCCCAGCTATATTCAGG - Intergenic
1119517696 14:75261308-75261330 CTGTAATCCCAGCAGCACTTTGG - Intronic
1119892969 14:78196899-78196921 CTATATTCCCAGCTTGAGCTAGG - Intergenic
1120583052 14:86278036-86278058 CTGTAATCCCAGCTATTGCAGGG + Intergenic
1121341100 14:93105645-93105667 CTGTAATCCCAGCTACTACTCGG - Intronic
1121397330 14:93637578-93637600 CTGTAATCCCAGCTACTCCTCGG - Intronic
1121437248 14:93927902-93927924 CAGCAATGCCACCTGTAGCTGGG + Intronic
1122165617 14:99821394-99821416 CTATAATCCCAGCTGTTGAGAGG + Intronic
1122260533 14:100517719-100517741 CTGTAGTCCCAGCTGCTCCTGGG + Intronic
1122557178 14:102587372-102587394 CTGTAATCCCAGCTATGGGGTGG - Intergenic
1123808048 15:23895590-23895612 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1124571142 15:30865122-30865144 CTGTAGTCCCAGGTGCAGATTGG + Intergenic
1125492248 15:40157100-40157122 CTGTTCTCCCTGCTTTAGCTTGG + Intergenic
1125627781 15:41122866-41122888 CTGTAATCCCAGCAGCTACTTGG - Intergenic
1125639958 15:41222291-41222313 CTGTAATCCCAGCTGTTCAGAGG + Intronic
1126711493 15:51461795-51461817 CTGTAATCCTAGCACTAGGTGGG - Intronic
1127023349 15:54775709-54775731 CTGCAACCCCAGCTGCTGCTGGG - Intergenic
1127435216 15:58950567-58950589 CTGTAGTCCCAGCTATCGGTGGG - Intronic
1127485126 15:59411788-59411810 CTGTAGTCCCAGCTGAGTCTGGG + Intronic
1127518027 15:59715084-59715106 CTGTAATCCCAGCACTTGGTGGG + Intergenic
1127563913 15:60167918-60167940 CTGTAATCCCAGCTATTTCGGGG + Intergenic
1128044216 15:64603392-64603414 CTGTAATCCCAGCTACTTCTGGG - Intronic
1128135159 15:65257506-65257528 CTGTAATCCCAGCTACAGGGAGG + Intronic
1128373352 15:67057443-67057465 CTGTAATCCCAGCTACTACTCGG - Intergenic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128463724 15:67891059-67891081 CTGTAATCCCAGCTGAAGCAGGG - Intergenic
1128878974 15:71225663-71225685 CTGTAGTCCCAGCTATAGGCTGG - Intronic
1129647749 15:77453103-77453125 CTGTAATCCCAGCTACTACTTGG + Intronic
1130342899 15:83014108-83014130 CTGGAAACCTAGGTGTAGCTGGG + Intergenic
1130531981 15:84754299-84754321 TTGTAATCCCAGCAGTACTTTGG + Intronic
1130659257 15:85817371-85817393 CTGTAATCCCAGCTATTGAGAGG - Intergenic
1130846171 15:87748242-87748264 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1131096695 15:89659937-89659959 CTGTAATCCCAGCTGTTCGGGGG + Intergenic
1131157805 15:90085509-90085531 CTGTCCTCCCAGTTGCAGCTGGG - Intronic
1131181972 15:90246526-90246548 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1131824889 15:96312313-96312335 CTGGAATTCCAGCTGTGGATGGG + Intergenic
1132494709 16:256694-256716 CTGTAATCCCAGCTACTACTTGG - Intronic
1132509658 16:332452-332474 CTGTAGTCCCAGCTCTAGGGAGG + Intronic
1132848390 16:2011706-2011728 CTGTAATCCCAGCTTGAAATTGG + Intronic
1132877196 16:2145234-2145256 CTGTAATCCCAGCAGCACTTTGG - Intronic
1133735607 16:8612944-8612966 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1134141743 16:11725998-11726020 CTGTAGTCCCAGCTCTACTTGGG - Intronic
1134281265 16:12819118-12819140 CTGTAATCCCAGCTGCTGCTAGG + Intergenic
1134608866 16:15592227-15592249 CTGTAATCCCAGCTGTTCGGAGG + Intronic
1134867816 16:17624282-17624304 CTGTAATCCCAGCTATTCCGGGG + Intergenic
1134895738 16:17885285-17885307 CTGTAATCCCAGCTGCTGGGAGG + Intergenic
1135058099 16:19247487-19247509 CTGTAATCCCAGCAGCACCTTGG - Intronic
1135218060 16:20589909-20589931 CTGTAATCCCAGCTACTGGTGGG + Intergenic
1135336200 16:21603259-21603281 CTGTAATCCCAGCTATGGAGAGG - Intronic
1135360558 16:21809970-21809992 CTGTAATCCCAGCTGTTTGGGGG - Intergenic
1135378226 16:21969409-21969431 CTGTAATCCCAGCTATCGGGGGG + Intronic
1135541777 16:23335567-23335589 CTGTAATCCCAGCTATTGGGAGG - Intronic
1135720339 16:24812172-24812194 CTGTAATCCCAGCTATACTCAGG - Intronic
1135766980 16:25186234-25186256 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1135945762 16:26863576-26863598 CTGTAATCACATCTGTAATTTGG + Intergenic
1136132625 16:28233338-28233360 CTGTAATCCCAGCTACAGGGTGG + Intergenic
1136371068 16:29836450-29836472 CTGTAATCCCAGCTGTACTCAGG + Intronic
1136371436 16:29839060-29839082 CTGTAATCCCAGCTACTGCTCGG + Intronic
1136416396 16:30106829-30106851 CTGTAATCCCAGCTCTACTTGGG - Intronic
1136571453 16:31099811-31099833 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1137430040 16:48411279-48411301 CTGTAATCCCAGCTACAGGGAGG + Intronic
1137454938 16:48610761-48610783 CTGTAATCCCAGCAGTCTGTGGG + Intronic
1137665670 16:50247485-50247507 CTGTAATCCCAGCTGCTACTCGG - Intronic
1137993311 16:53181955-53181977 CTGTAATCCCAGCTATCGGGAGG + Intronic
1138241519 16:55431186-55431208 CTGTAATCCCAGCTATTGGAAGG - Intronic
1138388815 16:56655118-56655140 CTGTAATCCCAGCATTTGATAGG - Intronic
1138437032 16:57007605-57007627 CTGTAATCCCAGCTATTGGGAGG + Intronic
1138489588 16:57368631-57368653 CTGTAGTCCCAGCTATATTTGGG + Intergenic
1138668251 16:58591494-58591516 CTGTAATCCCAGCAGTTTGTGGG + Intronic
1139407359 16:66729696-66729718 CTGTAATCCCAGCAGTTGGGAGG - Intronic
1139482869 16:67240401-67240423 CTGTAATCCCAGCTACTGCTGGG + Intronic
1139607327 16:68028842-68028864 CTTGAATCCCAGCTGTGCCTCGG - Intronic
1139628172 16:68208605-68208627 CTGTAATCCCAGCTATTTGTGGG + Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1139769690 16:69264051-69264073 CTGTAATCCCAGCTTTTGGGAGG - Intronic
1140026057 16:71291355-71291377 CTGTAGTCCCAGCTCTAGGGAGG + Intergenic
1140090722 16:71836310-71836332 CTGTAATCCCAGCACTTTCTTGG - Intergenic
1140109605 16:71992120-71992142 CTGTAATCCTAGGTGTGGCTTGG - Intronic
1140354451 16:74293414-74293436 CTGTAATCCCAGCACCAGCCTGG + Intergenic
1140465956 16:75182894-75182916 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1140675005 16:77319563-77319585 CTGTAATCCCAGCTATTAGTGGG - Intronic
1140764499 16:78144641-78144663 CTGTAATCCCAGCTATTGGGAGG - Intronic
1140913908 16:79477976-79477998 CTGTAATCCCAGCCGTTGGGAGG - Intergenic
1141352589 16:83311949-83311971 CTGTAATCCCAGCTCTCGGGAGG + Intronic
1141417968 16:83891463-83891485 CTGTAATCCCAGCAGCTACTTGG + Intergenic
1141458196 16:84158851-84158873 CTGTAATCCCAGCTATTCATGGG - Intronic
1141683870 16:85559115-85559137 CTGTAATCCCAGCCCAAGGTGGG - Intergenic
1141768907 16:86076884-86076906 CTGTAGTCCCAGCTATACTTGGG - Intergenic
1141982107 16:87557044-87557066 GAGTGATCCCAGCTGTGGCTGGG - Intergenic
1142470191 17:158920-158942 CTGTAATCCCAGCTATTGGGAGG + Intronic
1142581156 17:943697-943719 CTGTAATCCCAGCTACGACTCGG + Intronic
1142637139 17:1264845-1264867 CTGTAATCCCAGCACTTGATGGG + Intergenic
1142640334 17:1281636-1281658 CTGTGATGCCTGCTGTACCTGGG + Intronic
1142776588 17:2144831-2144853 CTGGAATCCCAGCTTTAGGCAGG + Intronic
1142837698 17:2600853-2600875 CTGTAATTCCAGCTATTACTAGG - Intronic
1142934102 17:3312744-3312766 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1143086770 17:4421885-4421907 CTGTAATCCCAGCTACTTCTGGG + Intergenic
1143132155 17:4685668-4685690 CTGTAGTCCCAGCTATTGGTGGG + Intronic
1143233468 17:5377781-5377803 CTGTAATCCCAGCATTTGCAAGG - Intronic
1143404996 17:6671429-6671451 CTGAGATCCCAGAAGTAGCTGGG + Intergenic
1143531671 17:7508685-7508707 CTGTAATCCCAGCTGCTAGTTGG + Intronic
1143943251 17:10565342-10565364 CTGTAATCCCAGCACGATCTCGG - Intergenic
1144090329 17:11850523-11850545 CTGTAATCCCAGCTGTAATTTGG + Intronic
1144118989 17:12131368-12131390 CTGTAATCCCAGCAGTACTCAGG - Intronic
1144220783 17:13097967-13097989 CTGTAATCCCAGCTATCGAGAGG - Intergenic
1144348484 17:14371533-14371555 CTGTAATCCCAGCTGTCAGGAGG - Intergenic
1144657571 17:17047053-17047075 CTGTAATCCCAGCTACTCCTTGG + Intronic
1145882587 17:28363358-28363380 CTCTAATCCCAGCTGAAGCCTGG + Exonic
1145893753 17:28438740-28438762 CTATAATCCCAGCAGTACTTTGG - Intergenic
1145947824 17:28791164-28791186 CTGTAATCCCAGCTTTTGGGAGG - Intronic
1146034959 17:29398326-29398348 CTGTAATCCCAGCTGTTGGGAGG - Intronic
1146070117 17:29672827-29672849 CTGTAATCCCAGCTACTACTCGG - Intronic
1146218217 17:30995877-30995899 CTGTAATCCCAGCTACTACTAGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146711357 17:35044492-35044514 CTGTAATCCCAGCTGCACGGAGG + Intronic
1146802455 17:35837412-35837434 CTGTAATCCCAGCACTTGGTGGG - Intronic
1147028182 17:37607832-37607854 CTGTAATCCCAGCTGCTCCGAGG + Intronic
1147504519 17:41002315-41002337 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1147534629 17:41311608-41311630 CTGTAATTCCAGCTGCACTTGGG + Intergenic
1147755805 17:42766947-42766969 CTGTAATCCCAGCACTACTTTGG + Intergenic
1147803010 17:43108085-43108107 CTGTAATCCCAGCACTTGCGGGG + Intronic
1147833055 17:43310622-43310644 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1147889843 17:43709636-43709658 CTGTAATCCCAGCTACTACTCGG - Intergenic
1148118969 17:45196515-45196537 CTGTAATCCCAGCTCTTGGGAGG - Intergenic
1148272231 17:46270782-46270804 CTGTAATCCCAGCTATTGGGGGG + Intergenic
1148711877 17:49687843-49687865 CTGTAGTCCCAGCTTTACTTGGG + Intergenic
1148734477 17:49857607-49857629 CTGTAATCCCAGCACTTGGTAGG + Intergenic
1148885464 17:50768960-50768982 CTGTAATCCCAGCTATTTATAGG - Intergenic
1149436017 17:56634054-56634076 CTGTTTCCCCATCTGTAGCTTGG + Intergenic
1149462519 17:56841915-56841937 CTGTAGTCCCAGCTCTAGTGAGG - Intronic
1149971543 17:61223277-61223299 CTGTAATCCCAGCTATTGGGGGG - Intronic
1149984844 17:61339507-61339529 CTGTAATCCCAGCAGTTGGGAGG + Intronic
1150109221 17:62483622-62483644 CTGTAATCCCAGCTATCTATAGG - Intronic
1150236162 17:63594518-63594540 CTGTGATCCCAGCTGAGGCATGG + Intergenic
1150696231 17:67408075-67408097 CTGTAATCCCAGCTGCTGGGAGG - Intronic
1150787874 17:68177280-68177302 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1151317550 17:73332716-73332738 CTGTAATCCCAGCTCTCGGGAGG + Intergenic
1151440481 17:74125698-74125720 CTGTAGTCCCAGCTGTGCTTGGG - Intergenic
1151646288 17:75434370-75434392 TTGTAATACCAGCTGAACCTAGG - Intergenic
1151671214 17:75572701-75572723 CTGTAATCCCAGCTCTACTCGGG + Intronic
1151688515 17:75664788-75664810 CTGTAATCCCAGCTATATGGGGG + Intronic
1151708116 17:75782738-75782760 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1152135190 17:78499561-78499583 CTGGAATCCCAGGTGTAGATGGG - Intronic
1152796877 17:82312329-82312351 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1152813829 17:82395286-82395308 CTGTAATCCCAGCACTTGCAAGG - Intronic
1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG + Intronic
1152831322 17:82498528-82498550 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1153495366 18:5692846-5692868 CTGTAATCCCAGCTATTGGGGGG + Intergenic
1153803443 18:8691510-8691532 CTGTAATCCCAGCTTTTGGGAGG + Intergenic
1153840882 18:9006692-9006714 CTGTAATCCCAGCTGCTACTGGG - Intergenic
1153867672 18:9287849-9287871 ATGAAATTCCAGCTGTGGCTGGG - Intergenic
1154218626 18:12433545-12433567 CTGTAGTCCCAGCTGTCGGGAGG - Intergenic
1154265866 18:12878407-12878429 CTGTAATCCCAGCAGCACTTTGG + Intronic
1154319071 18:13330217-13330239 CTGTAATCCCAGCAGCACTTTGG - Intronic
1154367492 18:13725026-13725048 CTGTAATCCCAGCCGTTGGGAGG - Intronic
1155338061 18:24785266-24785288 CTGTCATCCCAGCCCTGGCTCGG + Intergenic
1156552431 18:38031702-38031724 CTGTAGTCCCAGCTGCTACTTGG - Intergenic
1158674007 18:59502056-59502078 CTGTAATCCCAGCACTTGGTGGG - Intronic
1159050775 18:63419289-63419311 CTGTAATCCCAGCTGCTACATGG + Intronic
1159229692 18:65590521-65590543 CTGAAATCTGAGCCGTAGCTAGG + Intergenic
1159283377 18:66316769-66316791 CTGTAATCACTGTTGAAGCTTGG + Intergenic
1159362023 18:67417635-67417657 CTGTAATCCCAGCTTTTGGGAGG - Intergenic
1159527594 18:69612991-69613013 CTGTAGTCCCAGCTTCAGGTGGG - Intronic
1160202072 18:76804290-76804312 CTGTAATCCCAGCTGAGGGGAGG + Intronic
1161025623 19:2035374-2035396 CTGAAATCCCAGCTGTATCCAGG - Intergenic
1161050772 19:2163194-2163216 CTGTAATCCCAGCTACTGCGGGG - Intronic
1161325716 19:3662981-3663003 CTGTAATCCCAGCTCTTGGGAGG - Intronic
1161537234 19:4827496-4827518 CTGTAATCCCAGCAGCACTTTGG + Intronic
1161689896 19:5725776-5725798 CTGTAATCCCAGCTATCGGGAGG + Intronic
1161691938 19:5740642-5740664 CTGTAATCCCAGCTATCGGGAGG + Intronic
1161787816 19:6338997-6339019 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1161812866 19:6480725-6480747 CTGTAATCCCAGCTACAGGGAGG - Intronic
1161853160 19:6749200-6749222 CTGTAATCCCAGCATTATTTTGG - Intronic
1161903816 19:7139948-7139970 CTATAATCCCAGCTGCTCCTCGG - Intronic
1162115824 19:8428839-8428861 CTGTAATCCCAGCTTGAACCCGG + Intronic
1162338896 19:10079533-10079555 CTGTAATCCCAGCTACTACTTGG + Intergenic
1162404166 19:10463521-10463543 CTGTAATCCCAGCTATAGTGGGG - Intronic
1162437044 19:10667375-10667397 CTGTAGTCCCAGCTATAGGGAGG - Intronic
1162473478 19:10886314-10886336 CTGTAATCCCAGCTACAGGCTGG - Intronic
1163448771 19:17363287-17363309 CTGTTATCCCAGCTGCTTCTTGG - Intronic
1163524655 19:17813325-17813347 CTGTAGTCCCAGCTATACTTGGG + Intergenic
1163531748 19:17854052-17854074 CCGTGATCCAAGCTGTGGCTTGG + Intergenic
1163957769 19:20660135-20660157 CTGTAATCCCAGCTACTGGTGGG + Intronic
1164158502 19:22611063-22611085 CTGTGATCCCAGGTGAAGTTGGG + Intergenic
1164391973 19:27831943-27831965 CTGTAATCCCAGCTCTAAGGAGG - Intergenic
1164550685 19:29209713-29209735 CTGTAATCCCAGGTAGTGCTAGG - Intronic
1164641763 19:29831492-29831514 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1164666735 19:30044120-30044142 CTGTAATCCCAGCTACTACTCGG - Intergenic
1165019505 19:32912078-32912100 CTGTAATCCCAGCTATGAGTGGG + Intronic
1165053150 19:33155967-33155989 CTGTAATCCCAGCACTACTTTGG + Intronic
1165082533 19:33317277-33317299 CTGTAATCCCAGCTATGGGGTGG - Intergenic
1165458968 19:35933005-35933027 CTGTAATCCCAGGTTGAGGTGGG + Intergenic
1165616081 19:37202135-37202157 CTGTAATCCCAGCTACTGGTAGG - Intronic
1165649368 19:37472159-37472181 CTGTAATCCCAGCCTTTGGTAGG - Intronic
1165679406 19:37761094-37761116 CTGTAATCCCAGCCTGAGCCTGG + Intronic
1165747755 19:38240429-38240451 CTGTAATCCCAGCTACTACTTGG + Intergenic
1165834640 19:38746677-38746699 CTGTAATCCCAGCAGCACTTTGG + Intronic
1165932020 19:39365429-39365451 CTGTAATCCCAGCTACTGGTGGG + Intronic
1165961381 19:39537441-39537463 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1166114510 19:40645279-40645301 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1166278085 19:41769066-41769088 CTGTAATCCCAGCTGTGCAGGGG - Intronic
1166452976 19:42917483-42917505 CTGTAATCCCAGCTTTCGGGAGG - Intronic
1166740509 19:45112092-45112114 CTGTAATCCCAGCTGGGATTTGG - Intronic
1167115150 19:47484824-47484846 CTGTAATCCCAGCTGCTGGGAGG - Intergenic
1167161684 19:47771844-47771866 CTGTAATCCCAGCACTTGGTGGG + Intergenic
1167199897 19:48057610-48057632 CTGTAATCCCAGCTGCTAGTGGG - Intronic
1167207292 19:48111233-48111255 CTGTAATCCCAGCTACTACTCGG + Intergenic
1167291335 19:48626691-48626713 CTGTAATCCCAGCTACAGGAGGG + Intronic
1167496438 19:49821692-49821714 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1167736867 19:51300043-51300065 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1167841929 19:52129153-52129175 CTGTAATCCCAGCTATTGGGAGG + Intronic
1168139166 19:54373670-54373692 CTGTAATCCCAGCTCGAACCAGG + Intergenic
1168396042 19:56049566-56049588 CTGTAATCCCAGCAGCACTTTGG - Intronic
1168496550 19:56856285-56856307 CTGTAATCCCAGCTACTACTCGG + Intergenic
1168541590 19:57216227-57216249 CTGTAATCCCAGCTGCTGGGGGG + Exonic
1168626325 19:57921077-57921099 CTGTAATCCCAGCATTTGGTAGG - Intergenic
925098483 2:1226431-1226453 CTGTATTCCCAGTTGGTGCTGGG - Intronic
926193230 2:10743585-10743607 CTGTAATCCCAGCACTAGGGAGG + Intronic
926497218 2:13605178-13605200 CTGTAATCCCAGCTCTTGAAAGG - Intergenic
926837861 2:17044426-17044448 CACTATTACCAGCTGTAGCTGGG + Intergenic
926886638 2:17604421-17604443 CTGTACTGCCAGCTCTGGCTGGG - Intronic
926902915 2:17775876-17775898 CTGTAATCCCAGCAGCATTTTGG + Intronic
927150688 2:20194004-20194026 CTGTAATCCCAGCTACTACTCGG + Intergenic
927431390 2:23029268-23029290 CTGTAATCCCAGCAGCACTTTGG - Intergenic
927704785 2:25290442-25290464 CTGTAATCCCAGCTACTGGTTGG - Intronic
927758986 2:25733635-25733657 CTGTAATACCAACTTTAGTTAGG + Intergenic
927778786 2:25922970-25922992 CTGTAATCCCAGCTACAGGCAGG - Intergenic
927902218 2:26828730-26828752 CTGTAATCCCAGCTAGTACTCGG + Intergenic
928343262 2:30464965-30464987 CTGTAATCCCAGCTCTTTGTGGG - Intronic
928387612 2:30883603-30883625 CTGTTATGCCACCTGTGGCTTGG - Intergenic
928498383 2:31859825-31859847 CTGTAATCCCAGCTTAAGGGAGG + Intergenic
928560596 2:32480762-32480784 CTGTAATCCCAGCTATTCCAGGG - Intronic
928686682 2:33757285-33757307 CTGTAATCCCAGCTCTCGGGAGG - Intergenic
928930755 2:36621194-36621216 CTGGAATCCCAGCTCAGGCTTGG + Intronic
929204455 2:39275227-39275249 CTGTAATCCCAGCACTGGGTGGG + Intronic
930158936 2:48133161-48133183 CTGTAGTCCCAGCTGTACTCGGG + Intergenic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
930701689 2:54464171-54464193 CTGAAATCTCACATGTAGCTTGG + Intronic
931314294 2:61112748-61112770 CTGTAATCCCAGCAGTTGGGAGG - Intronic
931315832 2:61130232-61130254 CTGTAATCCCAGTTGTTGCCTGG - Intronic
931403471 2:61953268-61953290 CTGTAATCCCAGCAGCACGTTGG - Intronic
931414171 2:62065050-62065072 CTGTAATCCCACAAGTAGCTGGG - Intronic
931986861 2:67750635-67750657 CTGTACTCCCAGCTGAGGCAGGG + Intergenic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
932729648 2:74209671-74209693 CTGTAATCCCAGCAGGAGGGAGG - Intronic
933737188 2:85504601-85504623 CTGTAATCCCAGCTTTTGGTAGG - Intergenic
933881160 2:86671236-86671258 CTGTAATCCCAGCTATTGGGAGG + Intronic
934155270 2:89193471-89193493 CTGTAATCCCAGCACTAGGCGGG - Intergenic
934475427 2:94590303-94590325 CTGTAATCCCAGCTGGGGTGGGG - Intronic
935115573 2:100133048-100133070 CTGTAATCCCAGCTGTTGGGAGG - Intronic
935402221 2:102671981-102672003 CTGTAATCCCAGCTGCTACTTGG + Intronic
935498695 2:103811794-103811816 CTGTAATCCCAGCTCTCTTTAGG + Intergenic
936830377 2:116637806-116637828 CTATAATCCCAGCTATAGGCTGG + Intergenic
937523530 2:122739700-122739722 CTGTATTCCCTGGTATAGCTGGG - Intergenic
938012886 2:127842794-127842816 CTGTAATCCCAGCTCTCGGGAGG + Intergenic
938212144 2:129477350-129477372 CTGTAATCCCAGCTATAGGGAGG + Intergenic
938367531 2:130746587-130746609 CTGTAATCCTAGCTTTTGTTTGG - Intergenic
939661290 2:144893689-144893711 CTGTAATACCAGATGTGGATAGG - Intergenic
939911709 2:147991304-147991326 CTGTAATCCCAGCAGCACTTTGG - Intronic
940119218 2:150244669-150244691 CTGTAGTCCCAGCTGTCGGGAGG + Intergenic
940247219 2:151632552-151632574 CTGTAATTCCAGCTGCAGGGAGG + Intronic
940305469 2:152221214-152221236 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
940844903 2:158629854-158629876 CTGTAATCCCAGCTGAGGCTGGG - Intronic
941160861 2:162032552-162032574 CTGTAATCCCAGCTGTACTCAGG + Intronic
941262348 2:163313693-163313715 ATGTACTACCAGCTGTGGCTTGG - Intergenic
941336357 2:164248694-164248716 TTGTAATCTTAGCTGTACCTGGG - Intergenic
941448341 2:165628807-165628829 CTGTAATCCCAGCTTTTGGGAGG + Intronic
941936968 2:170989762-170989784 CTGTAGTCCCAGCTTGAGCCCGG + Intergenic
942035132 2:172003353-172003375 CTGGAATCCCAGGTCTAGCTCGG + Intronic
942105800 2:172632143-172632165 CTGTAATCCCAGCTATAGGGAGG + Intergenic
942516189 2:176755705-176755727 CAGTAAGCACAGCTGTAGATAGG - Intergenic
943332123 2:186572286-186572308 CTGTAGTCCCAGCTGCTACTTGG + Intergenic
943608417 2:190003739-190003761 CTGTAATCCCAGCTACTGCTCGG + Intronic
944826558 2:203488999-203489021 CTGTAATCCCAGCTACACTTGGG + Intronic
944838229 2:203600683-203600705 CTGTAGTCCCAGCACTTGCTGGG + Intergenic
945254168 2:207790216-207790238 CTGTAATCCCAGCTGTTGGGAGG - Intergenic
945272338 2:207953705-207953727 CTGTAATCCCTGCTTTTCCTGGG + Intronic
946137795 2:217662378-217662400 CTGTAATCCCAGCTACTACTTGG + Intronic
946323600 2:218969759-218969781 CTGTAATCCCAGCTTTTGGGAGG - Intergenic
946387061 2:219389705-219389727 CTGTAATCCCAGCAGCTACTTGG + Intronic
946425268 2:219591649-219591671 CTGTAATCCCAGCACTTGTTGGG - Intergenic
946728344 2:222684279-222684301 CTGTAATCCCAGCTATATTCGGG + Intronic
946925544 2:224623275-224623297 CTGTAATCCCAGCTATCGGGAGG - Intergenic
947414267 2:229877405-229877427 CTGTAATCCCAGCTACTACTTGG + Intronic
947514464 2:230789975-230789997 CTGTAATCCCAGCACAAGTTGGG + Intronic
947649608 2:231774712-231774734 CTGTAATCCCAGCTATTATTAGG - Intronic
947767430 2:232646702-232646724 CTGTAATCCCAGCACTTTCTGGG - Intronic
1169162207 20:3390485-3390507 CTGTAATCCCAGCTACAGGGAGG - Intronic
1169246435 20:4028640-4028662 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1169650505 20:7861434-7861456 TTGTAGTCCCAGCTGCTGCTTGG + Intergenic
1170646378 20:18199533-18199555 CTGTAATCCCAGCTCCTCCTTGG + Intergenic
1170977961 20:21184270-21184292 CTGTAATCCCAGCTCTACTTGGG - Intronic
1172201252 20:33127648-33127670 CTGTAATCCCAGCACTAGGTGGG - Intergenic
1172255422 20:33513482-33513504 CTGTAATCCCAGCTGTAATTGGG - Intronic
1172564258 20:35916587-35916609 CTGTAATCCCAGCTATGGGGAGG - Intronic
1172576327 20:36011560-36011582 CTGTAATCCCAGCTGAATCCAGG + Intronic
1173593206 20:44241346-44241368 CTGTAATCCCAGCTATTCGTAGG + Intergenic
1173797412 20:45871737-45871759 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1173901233 20:46590906-46590928 CTGTAATCCCAGCTGTTTGGGGG + Intronic
1174004028 20:47396020-47396042 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1174021609 20:47534791-47534813 CTGTAGTCCCAGCTGTTGGGTGG + Intronic
1174162470 20:48561413-48561435 CTGTAATCCCAGCTGCCGGGAGG + Intergenic
1174235020 20:49082639-49082661 CTGTAGTCCCAGCTATCGCGAGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174915010 20:54644755-54644777 CTGTAATCCCAGCTGAGTCAGGG + Intronic
1175095851 20:56541030-56541052 CTGTAATCCCAGCTATTCCGGGG - Intergenic
1175103510 20:56596981-56597003 CTGTAATCCCAGCTGCTACTCGG + Intergenic
1175433011 20:58920365-58920387 CTGTAGTCCCAGCTATAGGGAGG + Intergenic
1175622146 20:60457092-60457114 CTGTAATCCCAGCTGTAATTGGG - Intergenic
1176295189 21:5068253-5068275 CTGTCATCCCAGCTGGAGTGCGG + Intergenic
1177041140 21:16113047-16113069 CTGTAATGTCAGCTGTGGGTTGG - Intergenic
1177049116 21:16209552-16209574 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1177474585 21:21603092-21603114 CTGTAATCCCAGCTACTACTCGG + Intergenic
1177687112 21:24451331-24451353 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1178280025 21:31274088-31274110 CTGTAATCCCAGCTCTACTTGGG + Intronic
1178579678 21:33827887-33827909 ATGTAAGCCCAGTTGGAGCTGGG - Intronic
1178878001 21:36427492-36427514 CTGGAATCCCATCTTTACCTGGG + Intergenic
1179240917 21:39591321-39591343 CTGTAGTCCCAGCTGAGCCTGGG + Intronic
1179321302 21:40293697-40293719 CTGTAATCCCAGCTACTACTTGG + Intronic
1179861860 21:44193875-44193897 CTGTCATCCCAGCTGGAGTGCGG - Intergenic
1181001995 22:19992154-19992176 CTGTTTTCCCAGCTGTCGGTGGG - Intronic
1181014860 22:20062994-20063016 CTGTAATCCCAGCTGACGGCTGG + Intronic
1181151128 22:20884208-20884230 CTGTAATCCCAGCTATCGGGTGG + Intronic
1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG + Intergenic
1181881647 22:25985236-25985258 CTGTAATCCCAGCTGTTTGGGGG + Intronic
1181904061 22:26179130-26179152 CTGTAATCCCAGCAGTTGGGAGG + Intronic
1182315919 22:29447153-29447175 CTGTAATCCCAGCACTTTCTGGG - Intergenic
1182498154 22:30725383-30725405 CTGTAATCCCAGCTACTACTCGG + Intronic
1182510112 22:30813598-30813620 CTGTTATCCCTGCAGCAGCTGGG - Intronic
1182628857 22:31668983-31669005 CTGTAATCTCAGCTATAGGGAGG + Intergenic
1183065661 22:35361004-35361026 CTGAAATCCCAGCTATTTCTTGG - Intergenic
1183137793 22:35906561-35906583 CTGTAATCCCAGCACTTTCTGGG + Intronic
1183336401 22:37249773-37249795 CTGTAATCCCAGCACTACCTGGG - Intergenic
1183372959 22:37445532-37445554 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1183452333 22:37903889-37903911 CTGTAATCCCAGCAGGAGAATGG - Intergenic
1183494744 22:38136464-38136486 CTGTAATCCCAGCTACTACTCGG + Intronic
1183943052 22:41307230-41307252 CTATAATCCCAGCAGTAGGGAGG - Intronic
1184001708 22:41679294-41679316 CTGTAATCCCAGCAGCACTTTGG + Intronic
1184002304 22:41684024-41684046 CTGTAATCCCAGCTACTGGTGGG - Intronic
1184210831 22:43034751-43034773 CTGTAATCCCAGCTACTTCTTGG + Intergenic
1184224564 22:43121852-43121874 CTGTAATCCCAGCTTGAACCTGG - Intronic
1184488964 22:44798368-44798390 CTGTAATCCCAGCAGCATTTTGG - Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
1185249245 22:49791130-49791152 CTGGAATCCCAGCTGTGGCGTGG + Intronic
1185253796 22:49820476-49820498 CTGTATTCCCAGCTGAGGCTGGG + Intronic
949690655 3:6633743-6633765 CTGCAAACACAGCTGTAACTAGG + Intergenic
950102524 3:10366739-10366761 CTGAAAGCTCAGCTGTGGCTCGG + Intronic
950257240 3:11515529-11515551 CTGTAATCCCACCTGTAATCAGG - Intronic
950395608 3:12731675-12731697 CTGTAATCCCAGCAGCACTTTGG - Intergenic
950411123 3:12838282-12838304 CTGTAATCCCAGCTCTTGGGAGG + Intronic
950664388 3:14486394-14486416 CTGTAAACCCAGCTATTGCAGGG - Exonic
951456971 3:22903714-22903736 CTGTAATCCCAGCTACAGGCCGG + Intergenic
951981564 3:28572821-28572843 CTGTAATCCCAGCTGCTTCGGGG - Intergenic
952840230 3:37640050-37640072 CTGGAAGCCCTGCTGTAGCCAGG - Intronic
953716095 3:45318280-45318302 CTGTAATCCCAGCAATAATTTGG + Intergenic
953879131 3:46682573-46682595 CTGTTTTCCCAGCTGTGGCATGG + Intronic
953944956 3:47138392-47138414 CTGTAATCCCAGCTATACATGGG - Intronic
954160783 3:48720246-48720268 CTGTAGTCCCAGGTGTAGCGTGG + Intronic
954225309 3:49177350-49177372 CAGTAAACCCAGCTGTAGAGAGG - Intergenic
954670010 3:52285708-52285730 CTGTAATCCCAGCTACTGGTGGG - Intronic
954737471 3:52718211-52718233 CTGTAATCCCAGCACTCTCTGGG + Intronic
954781768 3:53067221-53067243 CTGTAGTCCCAGCTACAACTTGG + Intronic
955011882 3:55025507-55025529 CTGTGATCCCAGCTGCTACTCGG + Intronic
955341157 3:58126252-58126274 CTGTAATCCCAGCTACTACTTGG + Intronic
955372048 3:58360537-58360559 CTGTAATCCCAGCTCCAGGCTGG + Intronic
956976038 3:74580977-74580999 CTGTAATCCCAGCAGCACTTTGG - Intergenic
958145599 3:89620583-89620605 CTGTATTCACAGGTGTAGCAAGG - Intergenic
958193183 3:90209433-90209455 CTGTAGTCCCAGCTACAACTCGG + Intergenic
958416484 3:93880377-93880399 CTGTAGTCCCAGCTACAACTCGG + Intronic
959699536 3:109285740-109285762 CTGTAGTCCCAGCTGCTCCTAGG - Intergenic
959701620 3:109304145-109304167 CTGTAATCCCAGCTGAGACTCGG + Intronic
959984605 3:112558859-112558881 CTGTAATCCCAGCTACAGGCAGG - Intronic
960144486 3:114186248-114186270 CTGTAATCCCAGCTGAGATTGGG - Intronic
960533048 3:118786921-118786943 CTGTAATCCCAGCTATCGGGAGG - Intergenic
960774781 3:121237307-121237329 CAGCAACCCCAGCAGTAGCTGGG + Intronic
961357112 3:126346189-126346211 CTGTGTGCCCAGCTGCAGCTGGG - Intronic
961534134 3:127559123-127559145 CTGTAATCCCAGCTACTACTTGG + Intergenic
961865949 3:129953655-129953677 CTGTAATCCCAGCCTGAGATAGG - Intergenic
962235681 3:133705150-133705172 CTGTAATCCCAGCTACAGGGAGG + Intergenic
962505870 3:136045804-136045826 CTGTAATTCAAGCTGTAACCTGG - Intronic
962817104 3:139011085-139011107 CTGTAGTCCCAGCAGTACCCAGG - Intronic
963623961 3:147647585-147647607 CTGTAAGCCCAGCTGAGGCTGGG - Intergenic
963935454 3:151047518-151047540 CTGTAATCCCCGCTGCTACTCGG + Intergenic
964014893 3:151932916-151932938 CTGTAATCCCTGCTATAGGGAGG + Intergenic
964069210 3:152611510-152611532 CTGTAGTCCCAGCTACAGGTGGG - Intergenic
964718847 3:159751803-159751825 CTGTAATCCCAGCACTTCCTGGG - Intronic
965798829 3:172469714-172469736 CTGTAATCCCAGCTGAGGCAGGG + Intergenic
966011089 3:175078282-175078304 CTGTAATCCCAGCAATATTTGGG - Intronic
966082942 3:176027804-176027826 CTGTAATCCCAGCTATTCATGGG - Intergenic
966187813 3:177244025-177244047 CTGTAATCCCAGCTCTGTCTAGG + Intergenic
966358402 3:179107149-179107171 CTGTAATCCCAGCTACTGCGTGG + Intergenic
966363924 3:179161573-179161595 CTGTAATCCCAGCTATCGGGAGG + Intronic
966364888 3:179174346-179174368 CTGTAATCCCAGCTCTCGGGAGG + Intronic
966518180 3:180843432-180843454 CTGTAATCCCAGCAGCACTTTGG - Intronic
966811168 3:183846231-183846253 CTGTAATCCCAGCAGTACTTTGG + Intronic
967061009 3:185872691-185872713 CTGTAATCCCAGCTACTCCTCGG - Intergenic
967919085 3:194601258-194601280 CTGTAATCCCAGCTACTACTGGG - Intronic
968033476 3:195524397-195524419 CTGTAATCCCAGCTACTACTGGG + Intronic
968109510 3:196032853-196032875 CTGTAATCCCAGCACTAGGGAGG + Intronic
968190973 3:196666871-196666893 CTGTAATCCCAGCTACTGCGGGG + Intronic
968543624 4:1183011-1183033 CTGTAATCCCAGCTGAGGTCAGG + Intronic
968781144 4:2582390-2582412 CTGTAATCCCAGCACTTGTTGGG - Intronic
968792875 4:2680440-2680462 CTGTAATCCCAGCTATTGGGGGG - Intronic
968875806 4:3267382-3267404 CTGTAATCCCAGCTACTCCTCGG + Intronic
969375109 4:6758082-6758104 CTGTAATCCCAGCACAAGGTGGG + Intergenic
969928252 4:10605567-10605589 CTGTAATCCCAGCAGCACTTTGG + Intronic
970577375 4:17440676-17440698 CTGTAATCCCAGCTACAGGGAGG + Intergenic
970768929 4:19586246-19586268 CTGTAATCCCAGCTACTCCTGGG - Intergenic
971192129 4:24437760-24437782 CTGTAATCCCACTTGAACCTGGG - Intergenic
971221845 4:24716106-24716128 CTGTAATCCCAGCTGATTCCAGG - Intergenic
971319271 4:25592211-25592233 CTGTAATCCCAGGTAGAGATGGG + Intergenic
971322589 4:25617259-25617281 CTGTAATCCCAGCTATTGGGAGG + Intergenic
971490359 4:27205785-27205807 CTGTAATCCCAGCTTCAGTGAGG + Intergenic
971676804 4:29641708-29641730 CTGTAATCCCAGCTCTCTGTGGG - Intergenic
972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG + Intergenic
972537705 4:40013101-40013123 CTGTAATCCCAGCTATGGAGAGG - Intergenic
973023404 4:45233782-45233804 CTGTAATCCCAGCTATTCCGGGG - Intergenic
974388041 4:61228812-61228834 CTGTAATCCCAGCTCTAGGGAGG - Intronic
974654146 4:64797996-64798018 CTGTAATCCCAGCTATTGGGTGG - Intergenic
974759881 4:66261300-66261322 CTGTAATCCCAGCTACTCCTGGG - Intergenic
975078781 4:70249152-70249174 ATGCAAACCCAGCTGTAGTTAGG + Exonic
975344452 4:73277900-73277922 CTGTAATCCCAGCTACTACTCGG - Intergenic
975599765 4:76086996-76087018 CTGTCAGCCCAGCTGCAGCCGGG - Intronic
975783003 4:77859228-77859250 CTGTAATCCCAGCATTTGGTAGG - Intergenic
975978003 4:80121148-80121170 CTGTAGTCCCAGCTGCTACTCGG + Intronic
975990464 4:80254515-80254537 CTGTAACCTCTGCAGTAGCTGGG + Intergenic
976025611 4:80684523-80684545 CTGTAATCCCAGCAGCACTTTGG - Intronic
977183438 4:93905887-93905909 CTGTAATCCCAGATATTGGTAGG - Intergenic
977806641 4:101307271-101307293 CTGTAATCACAAGTGGAGCTAGG - Intronic
978172888 4:105695049-105695071 CTGTAGTCCCAGCTGTTTGTGGG - Intronic
978420976 4:108532572-108532594 CTGTAATCCCAGCTGTCAGGAGG + Intergenic
979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG + Intronic
979674145 4:123392810-123392832 CTGTAATCCCAGCAGTTGGGAGG - Intergenic
980079219 4:128326304-128326326 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
980266281 4:130521315-130521337 CTGTAATTCCAGCTATGACTCGG - Intergenic
980539662 4:134177296-134177318 CTGTAGTCCCAGCTGTTGGGAGG - Intergenic
980573252 4:134651165-134651187 CTGTAATCCCAGCTATAGGGAGG - Intergenic
980931751 4:139188810-139188832 CTGTAATCCCAGCTGTTCTGTGG + Intergenic
981080956 4:140638566-140638588 CTGTAATCCCAGCTGTACCTGGG + Intronic
981103749 4:140857679-140857701 CTGTAATCCCAGCTCCTCCTCGG + Intergenic
981207619 4:142062473-142062495 CTGTAATCCCAGCAGCACTTTGG + Intronic
981267417 4:142803045-142803067 CTGTAATCCCAGCTACAGGGCGG + Intronic
981634079 4:146855034-146855056 CTGTAATCCCAGCAGCACTTTGG + Intronic
982019871 4:151192064-151192086 CTGTAGTCCCAGCTGTGGGGAGG - Intronic
982174656 4:152694353-152694375 CTGTAATCCCAGCTACTACTTGG + Intronic
982303040 4:153899551-153899573 CTGTAATCCCAACAGTAGCTGGG + Intergenic
982879809 4:160699517-160699539 CTGTAATCCCAGCTTGAACCCGG + Intergenic
983213729 4:164983075-164983097 CTGTAATCCCAGCACTTGCAGGG - Intergenic
983308613 4:166026264-166026286 CTGTAATCCCAGCTATTCCGGGG + Intronic
984083929 4:175284871-175284893 CTGTAATCCCAGCTACCACTTGG - Intergenic
984247889 4:177297259-177297281 CTGTAATCCCAGCTATTCCAAGG + Intergenic
984284265 4:177709197-177709219 CTGTAATCCCAGCTATTGGGAGG + Intergenic
984870582 4:184321538-184321560 CTGTAATCCCAGCTGACTATGGG - Intergenic
985015526 4:185629815-185629837 CTGTAATCCCAGCAGTTGGGAGG - Intronic
986210045 5:5663484-5663506 ATGTAATCCCAGCTACTGCTTGG - Intergenic
986813300 5:11382474-11382496 CTGTAATCCCAGCTATCGGGAGG + Intronic
987456651 5:18155442-18155464 CTGTGATCTCATCTGAAGCTCGG - Intergenic
987777172 5:22383086-22383108 CTGTAATCCCAGCCTTTGCGAGG - Intronic
988315892 5:29627786-29627808 CTGTAATCCCAGCTCTCGGGAGG - Intergenic
988363672 5:30268229-30268251 CTGTATTCCCAGATCTTGCTCGG - Intergenic
988737006 5:34032672-34032694 CTGTAATTCCAGCTATAGGGAGG + Intronic
988845875 5:35127189-35127211 CTGGAAGACCTGCTGTAGCTTGG + Intronic
989054166 5:37350679-37350701 CTGTAATCCCAGCTATTGGGAGG + Intronic
989063162 5:37430815-37430837 CTGTAATCCCAGCAGTTGGGAGG - Intronic
989587319 5:43085598-43085620 CTGTACTCCCAGCTACAGGTAGG + Intronic
989597710 5:43172003-43172025 CTGTAATCCCAGCAGCACTTTGG - Intronic
990099451 5:52163289-52163311 CTGTAATCCCAGCTACTGGTGGG + Intergenic
991058519 5:62345422-62345444 CTGTAATCCCAGCTGCTACTTGG + Intronic
991333197 5:65515458-65515480 CTGTAATCCCAGCACTTGTTGGG - Intergenic
991676244 5:69092340-69092362 CTGTAATCCCAGCAGTTGGGAGG - Intergenic
991702976 5:69333102-69333124 CTGTAATCCCAGCTTTTGGGAGG + Intergenic
991729703 5:69573304-69573326 CTGTAATCCCAGCACTAGGGAGG - Intronic
991806135 5:70428444-70428466 CTGTAATCCCAGCACTAGGGAGG - Intergenic
991865254 5:71054570-71054592 CTGTAATCCCAGCACTAGGGAGG + Intronic
992044335 5:72870283-72870305 CTGTAATTCCAGCTATACTTGGG - Intronic
992046889 5:72901951-72901973 CTGTAATCCCAGCTCTCGGGAGG + Intronic
992200726 5:74381160-74381182 CTGTAATCCCAGCTCTCGGGAGG + Intergenic
992326051 5:75661272-75661294 CTGTAATCCCAGCTACAGCGGGG + Intronic
992437247 5:76766505-76766527 CTGTAATCCCAGCTACTACTCGG + Intergenic
992603075 5:78424606-78424628 CTGTAATCCCAGCTCGAGGCAGG + Intronic
992782131 5:80137514-80137536 CTGTAGTCCCAGCTGCTACTCGG + Intronic
993907536 5:93640186-93640208 CTGTAATCCCAGCAGCACTTTGG + Intronic
994376189 5:99017420-99017442 CTGTAATCCCAGCTATTACAGGG - Intergenic
994943992 5:106361582-106361604 CTGTAATCCCAGCTATCGGGAGG - Intergenic
995257168 5:110060077-110060099 CTCTAATCACAGCTGTAACAAGG + Intergenic
995838882 5:116424490-116424512 CTGTAATCCCAGCAGCACTTTGG + Intergenic
996032498 5:118721569-118721591 CTGTAATCCCAGCTACTCCTTGG + Intergenic
996176015 5:120358854-120358876 CTGTAATCCCAGCACTTTCTGGG - Intergenic
997837272 5:137205584-137205606 CTGCAATCACAGCAGCAGCTGGG - Intronic
998117119 5:139546603-139546625 CTGTAATCCCAGCTACACATGGG - Intronic
998360807 5:141585077-141585099 CTGTAATCCCAGCTACTGCCAGG - Intronic
999162219 5:149511204-149511226 CTGTAGTCCCAGCTACAGGTAGG + Intronic
999177965 5:149645284-149645306 CTGTAATCCCAGCGGAGGCGAGG - Intergenic
999291032 5:150426529-150426551 CTGTAATCCCAGCTACAGGCTGG - Intergenic
1000032374 5:157414533-157414555 CTGTAATCCCAGCTATCCCAGGG + Intronic
1000064336 5:157682202-157682224 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1000090076 5:157922570-157922592 CTGTAATCCCAGCTATTCCGGGG + Intergenic
1000597446 5:163232213-163232235 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1000953812 5:167518062-167518084 CTGTAATCCCAGCTATCACGAGG + Intronic
1001083661 5:168685070-168685092 CTGTAATCCCAGCTATTGGGAGG - Intronic
1001408260 5:171492158-171492180 CTGTAATCCCAGCTACTACTAGG - Intergenic
1001466323 5:171969824-171969846 CTGTAATCCCAGCTCTACTCGGG - Intronic
1001550870 5:172601578-172601600 CTATAATCCCAGCTGAGGCAGGG - Intergenic
1001766159 5:174248872-174248894 CTGTAATCCCAGCAGTTTGTGGG + Intergenic
1001919895 5:175591465-175591487 CTGTAATCCCAGCCGCTCCTGGG + Intergenic
1001923009 5:175615515-175615537 CTATAAACACGGCTGTAGCTGGG - Intergenic
1002084135 5:176760461-176760483 CTGTAATCCCAGCACTACTTTGG - Intergenic
1002694624 5:181076637-181076659 CTGTAATCCCAGCAGTTGGGAGG - Intergenic
1002823433 6:750733-750755 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1002977590 6:2098179-2098201 CTGTAATCCCAGCTACAGGGAGG - Intronic
1003569196 6:7245271-7245293 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1004212687 6:13666927-13666949 TTGTAATACCAGTTGTGGCTGGG + Intronic
1004354696 6:14920892-14920914 CTGTAATCCCAGCTCTCGAGAGG + Intergenic
1004359399 6:14957621-14957643 CTGTAATCCCAGCACTTTCTAGG + Intergenic
1004451034 6:15746732-15746754 CTGTAATCCCAGCTACTACTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005373206 6:25156089-25156111 CTGTAGTACCAGCTACAGCTTGG + Intergenic
1005561868 6:27048692-27048714 CTGTAATCCCAGCTTTTGAGAGG - Intergenic
1005748099 6:28858166-28858188 CTGTAATCCCAGCACTTGGTAGG + Intergenic
1006399105 6:33805742-33805764 CTGTAATCCCAGCTTTTGGGAGG + Intergenic
1006762476 6:36475321-36475343 CTATAATCCCAGCTGCTACTTGG + Intronic
1006966266 6:37989027-37989049 CTGTAATCCCAGCTACTACTGGG - Intronic
1006999474 6:38295924-38295946 CTGTAATCCCAGCTATTGGGAGG + Intronic
1007080407 6:39097996-39098018 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1007089088 6:39170752-39170774 CTGTAACCCCACCTGGAGCTTGG - Intergenic
1007441361 6:41863878-41863900 CTATAATCCCAGCTGTTCCAAGG - Intronic
1007460208 6:42012477-42012499 CTGTAATCCCAGCTCTCGGGAGG + Intronic
1007474656 6:42111232-42111254 CTGTAGTCCCAGCTACAGATGGG - Intronic
1007533825 6:42566508-42566530 CTGTAATCCCAGCTGTAATTCGG - Intronic
1007650335 6:43415973-43415995 TTGAAATCCCAGCAGCAGCTGGG - Intergenic
1007759089 6:44121815-44121837 CTGTAGTCCCAGCTACAGCCCGG + Intronic
1008006956 6:46420802-46420824 CTGTAATCCCAGCTGTTTGGGGG - Intronic
1008564653 6:52755334-52755356 CTGTAATCTCAGCTATAGAGAGG - Intronic
1008568972 6:52796663-52796685 CTGTAATCCCAGCTATTGGGAGG - Intronic
1008604725 6:53129394-53129416 CTGTAATCCCAGCTATTGAGAGG - Intronic
1008611426 6:53187849-53187871 CTGTAATCCCAGCTACAGGCAGG + Intergenic
1008680644 6:53868345-53868367 CTGTAATCCCAGCTACTTCTCGG - Intronic
1008837749 6:55857858-55857880 CTGTAATCCCAGCTCTTGGGAGG - Intronic
1009965548 6:70574196-70574218 CTGTAATCCCAGCTATTGGGAGG + Intronic
1010032683 6:71287780-71287802 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1011313989 6:86011043-86011065 CTGTAATCCCAGCTATAGCGGGG + Intergenic
1011345795 6:86368700-86368722 CAGTGGTCCCAGCTGTACCTGGG - Intergenic
1011473575 6:87731451-87731473 CTGTAATCCCAGCAGTAGTTTGG - Intergenic
1011618965 6:89224212-89224234 CTGTAATCCCAGCTACTACTTGG - Intronic
1011672194 6:89694125-89694147 CTGTCATCCCAGCTGCAGACTGG - Exonic
1011772528 6:90690821-90690843 CTGTAATCCCAGCTGTCTGCAGG + Intergenic
1012088938 6:94866785-94866807 CTGTAATCCCAGCTACACTTGGG + Intergenic
1012163415 6:95917218-95917240 CTGTAATCTCAGCTGAGGCAGGG - Intergenic
1012261204 6:97089654-97089676 CTGTAATCCCAGCTGAGGCCTGG + Intronic
1013057439 6:106597464-106597486 CTGTAATCCCAGCTATGGAGAGG - Intronic
1013175667 6:107674693-107674715 CTGTAATCCTAGCTGTCGGGAGG + Intergenic
1014340513 6:120200472-120200494 CTGTAATCTCATCTGGAGTTTGG - Intergenic
1014530552 6:122553895-122553917 CTGTCAGGCCAGCTGGAGCTTGG + Intronic
1014726879 6:124981903-124981925 CTGTAGTCCCAGCTGCTCCTGGG + Intronic
1014932035 6:127346338-127346360 CTGTAGTCCCAGCTAAACCTGGG + Intergenic
1015521870 6:134139677-134139699 CTGTAATCCCAGCTACATCAGGG + Intergenic
1015582587 6:134741923-134741945 CTGTAATCCCAGCTATCGTGAGG + Intergenic
1015607184 6:134970253-134970275 CTGTAATCCCAGCTGCTGTAAGG - Intronic
1015613845 6:135054593-135054615 CTAGGATCCCAGCTGTAGCCGGG + Intronic
1015701214 6:136037904-136037926 CTGTCGTTCCAGCTGTAGCCTGG + Intronic
1016359784 6:143254913-143254935 CTGTAGTCCCAGCTGTCGGGAGG + Intronic
1016409829 6:143771347-143771369 CTGTAGTCCCAGCTTGAGCCTGG - Intronic
1016499151 6:144699313-144699335 CTGTAATTCCAGCTGTATTCAGG + Intronic
1017181429 6:151556331-151556353 CTGTAATCCCAGCTATTGGGAGG + Intronic
1017696143 6:157018336-157018358 CTGTAGTCCCAGCTGTTGGGAGG - Intronic
1017705592 6:157119738-157119760 CTGTAATCCCAGCTGTTAATGGG - Intronic
1017976776 6:159365207-159365229 CTGTCATCCCAGCTGCATCTGGG - Intergenic
1018025066 6:159799328-159799350 CTGTAATCCCAGCTGTTCAGAGG + Intergenic
1018178985 6:161203691-161203713 CTGTAATCCCAGCACCAGCCGGG - Intronic
1018261128 6:161972014-161972036 CTGTAATCCCAGCACTTGGTGGG + Intronic
1018289168 6:162272873-162272895 CTGTAATCCCAGCTACAGGCTGG + Intronic
1018419854 6:163631667-163631689 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1018476693 6:164149606-164149628 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1018825538 6:167405744-167405766 CTGTGATTCCATCAGTAGCTTGG - Intergenic
1019040741 6:169102273-169102295 CAGAAATACCAGCTGTGGCTGGG + Intergenic
1019688732 7:2397693-2397715 CTGTAATCCCAGCTATGGGGAGG - Intergenic
1019758070 7:2788030-2788052 CTGTAATCCCAGCTGCTCGTGGG + Intronic
1019900004 7:4012832-4012854 CTGTAATCCCAGCTGAGGATTGG - Intronic
1020031912 7:4939286-4939308 CTGTAATCCCAGCACTAGGAAGG + Intronic
1020197536 7:6053485-6053507 CTGTAATCCCAGCTGTAATTTGG - Intronic
1020200398 7:6075361-6075383 CTGGAATCCCAGCAGTACTTTGG - Intergenic
1020844148 7:13261525-13261547 CTGTAATCCCAGCTACAGGCTGG - Intergenic
1021239653 7:18184273-18184295 CTGTAATTCCAGCTCTACTTGGG + Intronic
1021734917 7:23633730-23633752 CTGTAATCCCAGCACTTGGTAGG + Intronic
1022000929 7:26225397-26225419 CTGTAATCCCAGCTATTGAGAGG + Intergenic
1022687554 7:32610666-32610688 CTGTAATCCCAGCTAGAGGCAGG + Intergenic
1022727426 7:32993700-32993722 CTGTAATCTCAGCTGAGGCAGGG + Intronic
1022771107 7:33473580-33473602 CTGTAATCCCAGCAGCACTTTGG - Intronic
1022800005 7:33767707-33767729 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1022954882 7:35371866-35371888 TTGTAAGCCCAGCTGTACTTTGG + Intergenic
1023279524 7:38555291-38555313 CTGTAGTCCCAGCTGTGGGTAGG + Intronic
1023427165 7:40050099-40050121 CTGTAATCCCAGCTATCGGTAGG - Intronic
1023809233 7:43898877-43898899 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1023839652 7:44089234-44089256 CTGTAATCCCAGCTACTGGTTGG - Intergenic
1024203466 7:47130516-47130538 CTGTAATCCCAGCTATAATGGGG - Intergenic
1024330489 7:48150073-48150095 CTCTAATCCCAGCTACAGATGGG - Intergenic
1024399821 7:48911288-48911310 CTCTGATCCCAGCAGGAGCTTGG - Intergenic
1024968115 7:55043482-55043504 CTGTAATCCCAGCTACTACTTGG - Intronic
1025046157 7:55693949-55693971 CTGTAATCTCAGCTGAGGCAGGG - Intergenic
1025098300 7:56114846-56114868 CTGTAACTCCAACTGTAACTTGG - Exonic
1025262679 7:57430327-57430349 CTGTAATCCCAGCTACTGCGGGG - Intergenic
1025982101 7:66414984-66415006 CTGTAACTCCAACTGTAACTTGG + Intronic
1025990822 7:66495284-66495306 CTGTAACTCCAACTGTAACTTGG + Intergenic
1026001282 7:66560579-66560601 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1026049441 7:66932635-66932657 CTGTAATCCCAGCTATTGGGAGG - Intronic
1026218981 7:68375083-68375105 CTGTAATCCCAGCTACTCCTAGG + Intergenic
1026317494 7:69239836-69239858 CTGTAATCCCAGCAGGCGTTTGG - Intergenic
1026659043 7:72282929-72282951 CTGTAATCCCAGCTCTACTTGGG + Intronic
1026768946 7:73181158-73181180 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1026984966 7:74549027-74549049 CTGTAATCCCAGCTGGCATTTGG + Intronic
1027009815 7:74734542-74734564 CTGTAATCCCAGCTACAGGGAGG - Intronic
1027078227 7:75211496-75211518 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1027149919 7:75725941-75725963 CTGTAATCCCAGCTACAGGGAGG - Intronic
1027195438 7:76026936-76026958 CTGTAATCCCAGCTACAGGCTGG + Intronic
1029053772 7:97718115-97718137 CTGTAATCCCAGCTAAAGGGAGG + Intergenic
1029127500 7:98304774-98304796 CTGTAATCCCAGCTGAGGTCAGG - Intronic
1029132617 7:98344053-98344075 CTGTAGTCCCAGCTATAGGGAGG + Intronic
1029199505 7:98829174-98829196 CTGTAATCCCAGCTCTTTTTCGG + Intergenic
1029369871 7:100142456-100142478 CTGTAATCCCAGCAGGTGGTAGG + Intergenic
1030035344 7:105403984-105404006 CTGTAATCCCAGCTATTTTTGGG - Intergenic
1030048513 7:105518644-105518666 CTGTAATCCCAGTTGAGGCAGGG - Intronic
1030051448 7:105541256-105541278 TTGTAATCCCAGCTCTAGAGAGG - Intronic
1030373133 7:108723452-108723474 CTGCACTCACAGCTGTAGTTGGG - Intergenic
1030533207 7:110735751-110735773 CTGTAGTCCCAGCTTGAGCCTGG + Intronic
1030876592 7:114820564-114820586 CTGTAATCCCAGCTACTGCGGGG + Intergenic
1032038237 7:128536140-128536162 CTGTAATCCCAGCTATCTATAGG - Intergenic
1032963786 7:137071855-137071877 CTGTAATCCCAGCTATGGGGAGG + Intergenic
1033239737 7:139667865-139667887 CTGTAATCCCAGCAGCACTTTGG + Intronic
1033286321 7:140043651-140043673 CTGTAATCCCAGCTACTCCTCGG - Intronic
1033335304 7:140447237-140447259 CTGTAATCCCAGCTCTTGGGAGG - Intergenic
1033340259 7:140486436-140486458 CTGTAATCCCAGCTGCTCCCAGG - Intergenic
1033724305 7:144096330-144096352 CTGTAATCCCAGCTCTACTTGGG + Intergenic
1034355502 7:150448059-150448081 CTGTAATCCCAGCACTTCCTGGG - Intergenic
1034447034 7:151119008-151119030 CTGGAATACCAGCTGCAGCCAGG - Intronic
1034722670 7:153309058-153309080 CTGCAATCCCAGCTGTATATGGG + Intergenic
1035713157 8:1733873-1733895 CTGTAATCCCAGCACAAGGTGGG + Intergenic
1036764199 8:11536661-11536683 CTGTAATCCCAGCACTTGCGAGG - Intronic
1036943567 8:13073418-13073440 CTGTAATCCCAGGTGACACTCGG + Intergenic
1036974569 8:13396618-13396640 CTCTAATGCCAGCTCTACCTTGG - Intronic
1037314438 8:17587751-17587773 CTGTAATCCCAGCTACCACTCGG - Intronic
1037568783 8:20141144-20141166 CTGTAATCCCAGCTACCCCTTGG + Intergenic
1037856596 8:22375610-22375632 CTGTAATCCCAGCTATTATTAGG - Intronic
1037894065 8:22640300-22640322 CTGTAGTCCCAGCTGTACGTGGG - Intronic
1038257987 8:25968682-25968704 CTGTAATCCCAGCTGCTGGGAGG - Intronic
1038736070 8:30170761-30170783 CTGTAATCCCAGCTATTGGGAGG - Intronic
1038793546 8:30690417-30690439 CTGTAATCCCAGCACTTGCAAGG - Intronic
1038822396 8:30964768-30964790 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1039059428 8:33561801-33561823 CTGTAATCCCAGCACTTTCTTGG - Intronic
1039193678 8:35005919-35005941 CTTTAATTTAAGCTGTAGCTGGG + Intergenic
1039502341 8:38027994-38028016 TTGTAATCCCAGCTAGGGCTGGG + Intergenic
1039502342 8:38028001-38028023 TTGTAATCCCAGCCCTAGCTGGG - Intergenic
1039517790 8:38147830-38147852 CTGTCAGCCCACCTGTGGCTGGG - Intronic
1039529081 8:38243751-38243773 CTGTAGTCCCAGCAGTACTTGGG - Intronic
1041909419 8:63072488-63072510 CTGTAATCCCAGCTGAGGTCAGG - Intronic
1042132249 8:65599010-65599032 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1042355792 8:67826016-67826038 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1042496289 8:69458148-69458170 CTGTAATCCCAGCTCTAGGGAGG - Intergenic
1042603963 8:70527806-70527828 CTGTAATCCCAGCTACTGGTAGG - Intergenic
1043271395 8:78338635-78338657 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1043449782 8:80354806-80354828 CTGTAATCCCAGCTATTAGTAGG - Intergenic
1043458624 8:80437334-80437356 CTGTAATCCCAGCCCAAGGTGGG - Intergenic
1044497068 8:92899240-92899262 CTGTAATCCCAGGTGTGATTTGG - Intronic
1044668515 8:94655213-94655235 CTGTAATTCCAGCAGTTACTTGG - Intronic
1044727110 8:95202944-95202966 CTGTACTCCCGCCTGTACCTGGG - Intergenic
1044856375 8:96480254-96480276 CTGGAATACCAGATGCAGCTGGG - Intergenic
1045096100 8:98800185-98800207 TTGTAAGACCATCTGTAGCTTGG - Intronic
1045698583 8:104839442-104839464 CTGTAATCCCAGCTACAGAGTGG - Intronic
1046638531 8:116699930-116699952 CTGTAATCCCAGCTCTCGGAAGG - Intronic
1046925505 8:119782883-119782905 CTGTAATCCCAGCTGTGTTGGGG + Intronic
1046952777 8:120033942-120033964 CTGTAATCCCAGCTCCACCGGGG + Intronic
1047245207 8:123136705-123136727 CTGTAATCCCAGCTTTTGGGAGG - Intronic
1047356540 8:124127560-124127582 GTAGAATCCCAGCTGTAGTTGGG + Intergenic
1047718071 8:127613966-127613988 CTGTAATCCCAGCTACAGGGTGG + Intergenic
1047906247 8:129476270-129476292 CTGTCATCCCATCTGTACCTGGG - Intergenic
1047976005 8:130131504-130131526 CTGTAATCCCAGCACTTTCTGGG + Intronic
1048150642 8:131890230-131890252 CTGTACTCCCACCTGTACTTGGG - Intergenic
1048745387 8:137609279-137609301 CTGTAATCCCAGCTACAGGCAGG - Intergenic
1048838818 8:138546846-138546868 CTGTAATCCCAGCTACTCCTTGG - Intergenic
1048932098 8:139323394-139323416 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1049033689 8:140057986-140058008 CTGGAATGCCAGCCGTTGCTGGG - Intronic
1049516979 8:143065047-143065069 CTGTAATCCCTGCTCCACCTCGG - Intergenic
1049638586 8:143703523-143703545 CTGTAATCCCAGCTGTAATTGGG - Intronic
1049696899 8:143988586-143988608 CTGTAATCCCAGCTATTGGGGGG - Intronic
1050104519 9:2151609-2151631 CTGTAATCCCAGCTATTGGGAGG + Intronic
1050376194 9:4975897-4975919 CAGTAATCACAGCTGCAGCCAGG - Intergenic
1050383458 9:5057702-5057724 CTGTAATCCCAGCTATCGGGAGG - Intronic
1050449145 9:5761369-5761391 CTGTAATCCCAGCATTTGGTGGG - Intronic
1050639718 9:7654465-7654487 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1051257551 9:15230722-15230744 CTGTAATCCCAGCAGGACTTTGG + Intronic
1051654040 9:19361118-19361140 CTGTAATCCCAGCAGTTGGGAGG - Intronic
1051663506 9:19446711-19446733 CTGTAACCTGAGCTCTAGCTAGG + Intronic
1052756492 9:32547955-32547977 CTGTAATCCCAGCTACTACTGGG - Intronic
1052818792 9:33122885-33122907 CTGTAATCCCAGCATTAGGGAGG + Intronic
1052934956 9:34085377-34085399 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1053218911 9:36295099-36295121 CTGTAATCCCAGCTAAACTTGGG + Intronic
1053315195 9:37045162-37045184 CTGTAATCCCAGCAGTTGGGAGG + Intergenic
1053392185 9:37743940-37743962 CTGTAATCCCAGGCCTAGGTAGG + Intronic
1053394737 9:37763016-37763038 CTGTAGTCCCAGCTATATTTGGG + Intronic
1053435392 9:38070223-38070245 CTGTAATCCCAGCAGCTACTCGG + Intergenic
1053682639 9:40495759-40495781 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1053929859 9:43107523-43107545 CTGTAGTCCCAGCTGTACTCGGG - Intergenic
1054281075 9:63129170-63129192 CTGTAATCCCAGCTGGGGTGGGG - Intergenic
1054295738 9:63331273-63331295 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1054393757 9:64635768-64635790 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1054428405 9:65140981-65141003 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1054501974 9:65880564-65880586 CTGTAATCCCAGCTGGGGTGGGG - Intronic
1054729494 9:68686371-68686393 CTGTAATCCCAGCTACTACTTGG + Intergenic
1054787043 9:69220026-69220048 CTGTAATCCCAGCTATCGGGAGG + Intronic
1054999346 9:71430687-71430709 CTGTAATCCCAGCTGCTGGGAGG + Intronic
1055088673 9:72340189-72340211 CTGTAATCCCAGCATTTGGTAGG - Intergenic
1055368278 9:75569656-75569678 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1055607421 9:77985185-77985207 CTGTAGTCCCAGCTATAGGCTGG + Intronic
1055703796 9:78975540-78975562 CTGTAATCCCAGCTACTCCTTGG - Intergenic
1055949109 9:81714249-81714271 CTGTAATCCCAGCTGTTCAGAGG - Intergenic
1056221449 9:84454047-84454069 CTGTAATCCCAGCTATTTGTGGG - Intergenic
1057135702 9:92686354-92686376 CTGTAGTCCCAGCTCTAGGGAGG - Intergenic
1057238418 9:93386334-93386356 CTGTAATCCCAGCTACTACTCGG + Intergenic
1058315590 9:103561386-103561408 CTGTAGTCCCAGCTGCTCCTCGG - Intergenic
1058405071 9:104663562-104663584 CTGTAATCCCAGCTCCTGCTGGG + Intergenic
1058677309 9:107411335-107411357 CTGTAATCCCAGCTACTACTCGG - Intergenic
1059061889 9:111041654-111041676 CTGTAGTCCCAGCTGTTGGGAGG + Intergenic
1059451467 9:114373616-114373638 CTGTAATCCCAGCAGCACTTTGG + Intronic
1059484701 9:114617691-114617713 CTGTAATCCCAGCTGTTCAGGGG - Intronic
1060582279 9:124760187-124760209 CTGTAATCCCAGCTGCTCCAGGG + Intronic
1060642308 9:125249321-125249343 CTGTAATCCCAGCTACAGGTTGG - Intergenic
1060902856 9:127276246-127276268 CTGTAATCCCAGCCTTGCCTTGG - Intronic
1060961990 9:127687561-127687583 CTGTAATCCCAGCACTTGGTAGG - Intronic
1060989864 9:127842349-127842371 CTGTAATCCCAGCTGTACTTGGG - Intronic
1061471268 9:130827770-130827792 CTGTAATCCCAGCTATTGGGAGG + Intronic
1061518861 9:131105487-131105509 CTGTAATCCCAGCTATACTTGGG - Intronic
1061526533 9:131169383-131169405 CTGTAATCCCAGCTGTTTTGAGG + Intronic
1062223746 9:135436796-135436818 CTGTAATCCCAGCTACTACTAGG + Intergenic
1062283202 9:135761123-135761145 CTGTAATCCCAGCTATTTCTGGG - Intronic
1203758821 EBV:989-1011 TTGTAATCGCAGCTCTAACTTGG + Intergenic
1185656082 X:1686995-1687017 CTGTAATCCCAGCTCTTTATAGG + Intergenic
1185703636 X:2250232-2250254 CTGTAATCCCAGCAGAACTTTGG + Intronic
1187159254 X:16749176-16749198 CTGTAATCCCAGCTATTCATAGG - Intronic
1187351548 X:18522916-18522938 CTGTAATCCCAGCTGCATGGGGG - Intronic
1187475641 X:19608428-19608450 CTGTAATCCCAGCTGCTGGGAGG - Intronic
1187888726 X:23913634-23913656 CTGTAATCCCAGCGTGAGCTGGG + Intronic
1187952390 X:24483964-24483986 CTGTAATCCCAGTGGTAGGCCGG - Intronic
1188645616 X:32563215-32563237 CTGTAGTCCCAGCTGCTACTTGG + Intronic
1189117727 X:38360041-38360063 CTGTAATCCCAGCTACTCCTTGG - Intronic
1189339382 X:40193054-40193076 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1189820694 X:44867868-44867890 CTGTAATCCCAGCTACTACTTGG - Intergenic
1190060151 X:47205603-47205625 CTGTAATCCCAGCTCTTTGTGGG + Intronic
1190087033 X:47404285-47404307 CTGTAATCCCAGCTACAGGGAGG - Intronic
1190299723 X:49050093-49050115 CTGTAATCCCAGCTATTCGTGGG - Intergenic
1190864819 X:54375621-54375643 CTGTAATCCCAGCTGCTCCGGGG - Intergenic
1192447560 X:71222359-71222381 CTGTAATCCCAGCTGCTGGGTGG - Intronic
1192467149 X:71365589-71365611 CTGTAGTCCCAGCTGTTGGGGGG - Intergenic
1193539378 X:82753141-82753163 CTGTAATCCCAGCTTTGGGGAGG - Intergenic
1194355989 X:92884576-92884598 CTGTAATCCCAGCACTAGGGAGG - Intergenic
1194650260 X:96505882-96505904 CTGTAATCCCAGCTCTTGGGAGG - Intergenic
1194688280 X:96951586-96951608 CTGTAATCCCAGCTACTCCTTGG - Intronic
1194875390 X:99180777-99180799 CTGTAATCCCAGCCCTTGGTGGG - Intergenic
1195529376 X:105934929-105934951 CTGTAATCCCAGCTCTTGGGAGG - Intronic
1195628079 X:107024299-107024321 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1195656508 X:107336526-107336548 CTGCAAGCCCAGCTGAAGTTAGG + Intergenic
1196496570 X:116330335-116330357 CTGTAATCCCAGCTTGAACCTGG + Intergenic
1196747101 X:119081005-119081027 CTGTAATCCCAGCTTTTGGGAGG + Exonic
1196972693 X:121126677-121126699 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1197193534 X:123675516-123675538 CTGTAGTCCCAGCTGTACTTAGG + Intronic
1197464365 X:126784676-126784698 CTGTACCCCCAACTGTATCTAGG + Intergenic
1198179764 X:134194919-134194941 TTGTAATCCCAGCTGCTACTCGG + Intergenic
1198450294 X:136760460-136760482 CTGTAATCCAGGCTGTTTCTGGG - Intronic
1199578981 X:149342738-149342760 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1200664335 Y:6001553-6001575 CTGTAATCCCAGCACTAGGGAGG - Intergenic
1200780434 Y:7210712-7210734 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1201523127 Y:14899282-14899304 CTGTACTCCCTCCTGTAGTTGGG + Intergenic