ID: 1152816278

View in Genome Browser
Species Human (GRCh38)
Location 17:82410018-82410040
Sequence CAGGAGAGATGGGGAGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 715
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 652}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152816278_1152816289 -4 Left 1152816278 17:82410018-82410040 CCCACTGCTCCCCATCTCTCCTG 0: 1
1: 0
2: 3
3: 59
4: 652
Right 1152816289 17:82410037-82410059 CCTGGAACCCCAGGCAGGTGGGG 0: 1
1: 0
2: 2
3: 39
4: 461
1152816278_1152816290 -3 Left 1152816278 17:82410018-82410040 CCCACTGCTCCCCATCTCTCCTG 0: 1
1: 0
2: 3
3: 59
4: 652
Right 1152816290 17:82410038-82410060 CTGGAACCCCAGGCAGGTGGGGG 0: 1
1: 0
2: 2
3: 62
4: 489
1152816278_1152816286 -6 Left 1152816278 17:82410018-82410040 CCCACTGCTCCCCATCTCTCCTG 0: 1
1: 0
2: 3
3: 59
4: 652
Right 1152816286 17:82410035-82410057 CTCCTGGAACCCCAGGCAGGTGG 0: 1
1: 0
2: 3
3: 64
4: 924
1152816278_1152816294 22 Left 1152816278 17:82410018-82410040 CCCACTGCTCCCCATCTCTCCTG 0: 1
1: 0
2: 3
3: 59
4: 652
Right 1152816294 17:82410063-82410085 GCTTTGAGATTCACCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 142
1152816278_1152816295 29 Left 1152816278 17:82410018-82410040 CCCACTGCTCCCCATCTCTCCTG 0: 1
1: 0
2: 3
3: 59
4: 652
Right 1152816295 17:82410070-82410092 GATTCACCAGCTCAGGAGATAGG 0: 1
1: 0
2: 1
3: 28
4: 448
1152816278_1152816285 -9 Left 1152816278 17:82410018-82410040 CCCACTGCTCCCCATCTCTCCTG 0: 1
1: 0
2: 3
3: 59
4: 652
Right 1152816285 17:82410032-82410054 TCTCTCCTGGAACCCCAGGCAGG 0: 1
1: 0
2: 2
3: 56
4: 528
1152816278_1152816287 -5 Left 1152816278 17:82410018-82410040 CCCACTGCTCCCCATCTCTCCTG 0: 1
1: 0
2: 3
3: 59
4: 652
Right 1152816287 17:82410036-82410058 TCCTGGAACCCCAGGCAGGTGGG 0: 1
1: 1
2: 0
3: 29
4: 333
1152816278_1152816296 30 Left 1152816278 17:82410018-82410040 CCCACTGCTCCCCATCTCTCCTG 0: 1
1: 0
2: 3
3: 59
4: 652
Right 1152816296 17:82410071-82410093 ATTCACCAGCTCAGGAGATAGGG 0: 1
1: 0
2: 0
3: 19
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152816278 Original CRISPR CAGGAGAGATGGGGAGCAGT GGG (reversed) Intronic
900136993 1:1121879-1121901 CAGGAGACGTGGGGACCAGCGGG + Intergenic
900314103 1:2048575-2048597 CAGGAGTGATGGGAACCACTGGG + Intergenic
900509160 1:3050230-3050252 CAAGAGAGATGGGCAGGACTGGG + Intergenic
900701300 1:4050028-4050050 CAGGAGAGATGGGGGAAAGAGGG + Intergenic
900971208 1:5993207-5993229 GAGGAGAGATGGGGAGGACCGGG - Intronic
901231406 1:7643489-7643511 CAGGAAAAATGGGGAGCATATGG - Intronic
901635346 1:10667856-10667878 CAGCCGAGATGGGGAGAAGGTGG - Intronic
901919469 1:12525952-12525974 CAGGAGAGGTGGGGATCAGACGG + Intergenic
902063497 1:13665095-13665117 GAGGGGAAATGGGGAGCACTGGG - Intergenic
902185703 1:14723631-14723653 CAGGAGAGAGAGGGAGCAAATGG - Intronic
902652720 1:17846999-17847021 CGGGAGAGGTGGTGAGAAGTGGG - Intergenic
902705268 1:18199952-18199974 CAGGAGGGATGGGTAGGAGCGGG + Intronic
903007329 1:20307350-20307372 CATGAGAGATGGGGACCATGAGG - Intronic
903305055 1:22407570-22407592 CAGGAGAGAAAAGGAGGAGTGGG + Intergenic
903806026 1:26006137-26006159 CAGGAGTGGTGAGGGGCAGTGGG + Intergenic
904310700 1:29627741-29627763 GAGGAGACATGGGGAGAAGATGG + Intergenic
904341591 1:29838392-29838414 AAGGACAGCTGGGGGGCAGTGGG - Intergenic
904565386 1:31425424-31425446 CAGGAGGCATGGGGGGCTGTGGG + Intronic
904909186 1:33921458-33921480 CAGGACTGTTGGGGACCAGTGGG - Intronic
905282562 1:36858568-36858590 CAGGAGAGGTGGGTCCCAGTGGG + Intronic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905391595 1:37639271-37639293 CATGAGAGATTGGGAGCAGAAGG - Intergenic
905456466 1:38091568-38091590 GAGGAGAGGAGGGGTGCAGTGGG + Intergenic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
905942538 1:41875335-41875357 CAGGATGGATGGGGAGCTGGAGG - Intronic
906390131 1:45407958-45407980 CAGGAGAGATGTTGGGAAGTGGG - Intronic
907118607 1:51990266-51990288 GAGGAGAGATGGGGGGCAACTGG - Intronic
907275606 1:53315111-53315133 CAGGAGGGGTGGGGTGCAGAAGG - Intronic
907309432 1:53530848-53530870 AGGGACAGATGGGGAGAAGTCGG - Intronic
907421839 1:54352989-54353011 CAGGAGAGACAGGAGGCAGTAGG + Intronic
907839509 1:58142760-58142782 CAGGAAAGATGGAGAGAGGTAGG - Intronic
907950912 1:59182755-59182777 AGGGAGAGATTGGGAGCAGATGG + Intergenic
908029685 1:59986377-59986399 CAGGAGAGAAGGGAAGAGGTGGG + Intergenic
908120640 1:60983179-60983201 AGGGAGAAATGGGGAGGAGTGGG + Intronic
908221507 1:62011423-62011445 AAAAAGAGATGGGGAGCAGCTGG + Intronic
908856286 1:68433361-68433383 TAGGAAAGATGGGGAGAATTGGG + Intronic
909502035 1:76345433-76345455 CAAGAGAGAAGAGAAGCAGTGGG + Intronic
910110976 1:83683106-83683128 CAGGAGAGTTTGGGACCAGGTGG + Intergenic
910576410 1:88769811-88769833 AAGAAGAAATGGGGAGAAGTTGG + Intronic
911100582 1:94092823-94092845 AAGGAGAAATGGGGAGCAAAGGG + Intronic
911680066 1:100705015-100705037 AAGGAGAGATGAGGTGGAGTTGG - Intergenic
912305909 1:108566853-108566875 ACGGAGAGATGGGGAACTGTTGG + Intronic
912700420 1:111874256-111874278 CATGCAAGAGGGGGAGCAGTGGG - Intronic
913142453 1:115954992-115955014 CAGGAGAGGGGAAGAGCAGTGGG + Intergenic
913532405 1:119742423-119742445 CAGGAGTGGAGGGGAGCAGAGGG - Intronic
913692754 1:121295014-121295036 CAGAAGAGATGAGGCTCAGTTGG + Intronic
914750881 1:150534189-150534211 CTGGAGAGGTGGGGTGCAGGAGG + Intergenic
915025542 1:152826233-152826255 CAGGAGAGATGGGAAGCACCTGG + Intergenic
915473682 1:156140032-156140054 GAGGAGAGAAGGGGTGCAGATGG - Exonic
915526008 1:156476717-156476739 CAGGAGGGATGGGGATTAGATGG - Intronic
915694783 1:157728854-157728876 CTGGAGAGATGTGGAGAAATAGG + Intergenic
916166236 1:161969563-161969585 CAGGAGAGCTGTGGACCTGTTGG - Intergenic
916215033 1:162386838-162386860 CCTGACTGATGGGGAGCAGTTGG + Intergenic
916682140 1:167114439-167114461 CTGGTGAGATGGGGTGGAGTGGG + Intronic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917073179 1:171175012-171175034 GAGGGGAGATGGGGAGGAGAGGG + Intergenic
918242795 1:182635015-182635037 CAGAAGAGAAGGGGAGCTATGGG - Intergenic
918418987 1:184342832-184342854 CAACAGAGATGGAGGGCAGTGGG - Intergenic
918485670 1:185026278-185026300 CAGGAGAGACAGAGAGCAGGGGG + Intergenic
918860943 1:189825792-189825814 CAGCAGACATGGGGAGAACTCGG - Intergenic
919058055 1:192595389-192595411 CAGGAGGGGTAGGGAGGAGTAGG + Intergenic
919083852 1:192897045-192897067 AAGGGGAGATGGGGAGAGGTTGG + Intergenic
919988457 1:202692094-202692116 TAGGAGAGCTGGGCTGCAGTGGG - Intronic
920106298 1:203555901-203555923 CAGGAGAGACGGAGAGGAGGGGG + Intergenic
920535471 1:206734010-206734032 CAGCACAGATGAGGAGCAGCTGG + Exonic
920968017 1:210717382-210717404 CCTGAGAGTTGGGGAGCAGCAGG - Intronic
921469268 1:215529214-215529236 CAGTAGAGGTTGGGAGCAGGGGG - Intergenic
922222322 1:223618145-223618167 CAGGGAACATGGGGAGCAGGAGG + Intronic
923249070 1:232162578-232162600 CAAGAGTGATGGGAAGCAGTAGG + Intergenic
923815529 1:237373620-237373642 CATGGGGGTTGGGGAGCAGTAGG + Intronic
923900594 1:238322165-238322187 CAGAAGCCATGGGGAGCTGTCGG + Intergenic
1062813931 10:485401-485423 CCCGAGAGAAGGGGAGCAGAGGG - Intronic
1063300026 10:4842861-4842883 CAGGAGAAAGGGGAGGCAGTTGG + Intronic
1063337278 10:5228183-5228205 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1063847332 10:10145229-10145251 ATGCAGACATGGGGAGCAGTAGG - Intergenic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1064822333 10:19351255-19351277 CAGGACAGGTTAGGAGCAGTAGG - Intronic
1064942057 10:20746154-20746176 CAGAAAAGATGGGAAGCAGCTGG + Intergenic
1065073748 10:22055027-22055049 GCTGAGAGATGGGGAGAAGTAGG - Intergenic
1065126421 10:22578515-22578537 CAGGAAAGATGGGACGGAGTAGG - Intronic
1065327350 10:24560646-24560668 CAGCTGGGATGGGGAGCTGTTGG + Intergenic
1066380450 10:34896676-34896698 CAGGACAGAGGGGGAGCTGGAGG + Intergenic
1067217189 10:44312974-44312996 GAGGAGTGCTGGGGAGCAGGAGG + Intergenic
1067267103 10:44755989-44756011 GAGGAGAGATTGGGGGCAGTGGG - Intergenic
1067753876 10:48989454-48989476 CATGACAGGTGGGGATCAGTGGG - Intergenic
1067848572 10:49740901-49740923 CAGGGGAGCTGGGCAGCAGGAGG + Intronic
1068305120 10:55198820-55198842 CAGGAGAGAGGGAGAGCAAAGGG - Intronic
1068358588 10:55945236-55945258 CAGCAGAGAGGGGAAGCAGCTGG - Intergenic
1068971425 10:62962340-62962362 CAGGGGAAATGAGGACCAGTGGG + Intergenic
1069706263 10:70460575-70460597 CAGAAGAGATGGGGAGGAGCAGG - Intergenic
1069713870 10:70508404-70508426 CATGGGAGTTGGGGAGCAGCAGG + Intronic
1070651411 10:78239800-78239822 GAGGAGAGAAGGGGTGCAGATGG + Intergenic
1071718500 10:88120174-88120196 CAGGAACGAGGGGGAGCAGAAGG + Intergenic
1072021119 10:91402787-91402809 CAGGAAAAATGGGGAGATGTTGG + Intergenic
1072187927 10:93060250-93060272 CGGGAGAGGTGGGGAGCTGTCGG + Intergenic
1072215838 10:93286393-93286415 CACGAGAGAGGGAGTGCAGTGGG + Intergenic
1072424047 10:95314370-95314392 CATGAGAATTGGGGAGCAGATGG - Exonic
1072462147 10:95629538-95629560 CTGGAGAGTTGTGGAGTAGTAGG - Intronic
1072483479 10:95831614-95831636 CAAGTCAGATGGGGAACAGTGGG - Intronic
1073025327 10:100483233-100483255 CAGAAGAGAGGTGCAGCAGTGGG - Exonic
1073712656 10:106062330-106062352 GGGGAGAGATGGGTAGAAGTTGG - Intergenic
1073756958 10:106591004-106591026 CACGAGAGATGGGGAGGACAAGG + Intronic
1073939725 10:108682246-108682268 CAGGAGAGAGGAGGAGGAGGTGG + Intergenic
1074112861 10:110434652-110434674 CCTGACAGATGGGGAGGAGTGGG + Intergenic
1074729189 10:116350305-116350327 GATGAGAGATGATGAGCAGTTGG + Intronic
1074772757 10:116744063-116744085 CAGGAGGGCGGGGGAGCTGTGGG - Intergenic
1076053331 10:127352202-127352224 CGGGAGAGGTGGGGAGCATCGGG + Intronic
1076242351 10:128917793-128917815 CAGGAGTGCTGGGGAGGAGACGG + Intergenic
1076481676 10:130789035-130789057 CAGGGGAGCAGGGGAGCAGGAGG + Intergenic
1076595595 10:131623057-131623079 GGGGAGAGATGGGGAGAGGTGGG + Intergenic
1077089888 11:773591-773613 CAGGACAGCTGGGGATCAGGAGG + Exonic
1077723041 11:4646427-4646449 AAGGAGACATGGGGAGGGGTAGG + Intronic
1077801400 11:5542247-5542269 CATGAGGGATGGGGAGGGGTAGG - Intronic
1078148444 11:8738590-8738612 CAGCAGGGATGGGGAGGAGGGGG - Intronic
1078523982 11:12086670-12086692 TTGGAGAGATGGGAAGCAGGAGG - Intergenic
1079981998 11:27160931-27160953 CAGTAGAGATATGGAGCAGCTGG - Intergenic
1080231857 11:30025457-30025479 AAGGAGAGATGGGGTGTATTAGG - Intergenic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1080557368 11:33429919-33429941 CAGAAGAGATGGTGAGGGGTAGG - Intergenic
1080603422 11:33843189-33843211 CAGGAGATCTGGTGAGCACTGGG + Intergenic
1080657124 11:34266848-34266870 GAGGAGAGATGGGGGCCAGTGGG + Intronic
1080842702 11:35999471-35999493 CAGGAGAGATGAGGAGGGGCAGG - Intronic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081160713 11:39744482-39744504 CAGGAGAGAGAGAGAGCAGGGGG - Intergenic
1081329445 11:41786447-41786469 CCAAAGAGATGGAGAGCAGTAGG - Intergenic
1083902372 11:65649879-65649901 CAGGAGAGCAGGGGAGGGGTTGG + Intronic
1084181728 11:67450267-67450289 CACGGGAGGTGGGGAGCAGGTGG + Intergenic
1084472795 11:69373020-69373042 CAGGGGAGAGGGTGGGCAGTGGG + Intergenic
1084480146 11:69415322-69415344 CAGCAGAGGTGGGGGGCAGGAGG + Intergenic
1084653581 11:70502709-70502731 CAGGACAGCTGGGGGGCAGTGGG - Intronic
1084739301 11:71128683-71128705 AGAGAGAGATGGGGAGGAGTAGG - Intronic
1085014962 11:73167909-73167931 TAGGAGAGAGGGAGAGAAGTGGG + Intergenic
1085017357 11:73183535-73183557 GAGGAGAGATGGGTAGGAGACGG - Intergenic
1085731372 11:79001969-79001991 CAGGGGAGATGGGGAGCTATGGG - Intronic
1085742775 11:79091046-79091068 CAGGAGAAAGGGGAAGGAGTAGG + Intronic
1086014456 11:82149749-82149771 AAAGATAGATGGGGAACAGTTGG - Intergenic
1087183374 11:95160654-95160676 CAGCAGAGATGAGGAGCGGTAGG - Intergenic
1087703987 11:101468188-101468210 CAGGTGAGAAGGGCTGCAGTGGG - Intronic
1088362367 11:109004400-109004422 AAGAAGAGAGGGGGAGCAGGTGG - Intergenic
1089138689 11:116269676-116269698 CATGAGAGATGGGGACTAGCTGG + Intergenic
1089270194 11:117296705-117296727 CAGGAGAGACAGGGTGAAGTGGG - Intronic
1089690278 11:120182852-120182874 CAGGAAAGATGAGGAGGAGGAGG + Intronic
1091728755 12:2864507-2864529 CACGAGAGATCAGGAGCAGGGGG + Intronic
1092087783 12:5777971-5777993 CAGAGGAGATGGGGAACAGCTGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1093676888 12:21952085-21952107 CAGGGGAGGCGGGGAGAAGTTGG + Intergenic
1093687235 12:22070696-22070718 CAGGGAAAATGGGGAGCAATGGG + Intronic
1093966777 12:25336037-25336059 CCTGAGTGATGGGGAGAAGTTGG - Intergenic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094088627 12:26622794-26622816 CATGACAGATGGGGAGGAGTGGG + Intronic
1094174086 12:27524128-27524150 GAGGAGAGAAGGGCGGCAGTGGG + Intronic
1094270165 12:28605358-28605380 GAGGAGAGAAGGGGAGGAGAAGG - Intergenic
1094495673 12:30987875-30987897 GAGGACAGAAGGGGAACAGTAGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095729924 12:45495163-45495185 CAGGAGAGAGAGGCTGCAGTAGG + Intergenic
1096079045 12:48821807-48821829 CAGGAGAGATGAGGAACAGTCGG + Intronic
1096156026 12:49342092-49342114 CAGGAGGGAGGGGGAGCAAGAGG - Intergenic
1096462715 12:51831291-51831313 CAGCAGTCATGGGGAGCACTGGG + Intergenic
1096547213 12:52348296-52348318 CGGGAGAGCTGTGGAACAGTAGG + Intergenic
1096557350 12:52411542-52411564 CTGCAGAGATCGGGAGCAGGTGG + Intergenic
1096714341 12:53482373-53482395 CAGGAGAGATGGGGTGGGGGGGG + Intronic
1097938531 12:65279008-65279030 CAGCCGAGAAGGGGAGCAGAAGG + Intronic
1098473850 12:70876943-70876965 CAGGAGATAAGAGTAGCAGTTGG + Intronic
1099044614 12:77700340-77700362 AAGGAGAGTTTGTGAGCAGTTGG + Intergenic
1099183569 12:79494186-79494208 CTGGAGAGATGTGGAGAAATAGG - Intergenic
1099352822 12:81593920-81593942 CAGAACAGAAGGTGAGCAGTGGG + Intronic
1099630332 12:85134327-85134349 CACAAGAGATGGGGAGCATTGGG - Intronic
1099666136 12:85631676-85631698 CATGGGATATGAGGAGCAGTTGG - Intergenic
1099810481 12:87576031-87576053 AAGGAGAGATGTGGAGCAAAAGG + Intergenic
1100233028 12:92629360-92629382 CTGGAGAGACTGTGAGCAGTAGG - Intergenic
1101373489 12:104151464-104151486 CAGGGGAGGTGGGGTGGAGTGGG - Intergenic
1101580384 12:106037364-106037386 CAGGAGGGGTGGGGAGGAGAGGG - Intergenic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1101766580 12:107706031-107706053 CTGGAGAGATGTGGAGAAATAGG - Intronic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1102473663 12:113174940-113174962 CAGGAGACATGGGGGAAAGTGGG + Intronic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103341163 12:120221876-120221898 CAGGAGAGACAGGGAGCTGGTGG - Intronic
1103763944 12:123269090-123269112 AAGGGGAGGTGAGGAGCAGTGGG - Intronic
1104034841 12:125091163-125091185 AGGGAGGGATGGGGAGCAGAGGG + Intronic
1104730378 12:131102475-131102497 GAGCAGAGATGGGCAGCACTGGG + Intronic
1105656345 13:22443967-22443989 TGGGAGAAATGGGGAGAAGTTGG - Intergenic
1106052662 13:26206199-26206221 CAGCAGGGACGGGGGGCAGTGGG - Intronic
1106118460 13:26837675-26837697 CAGGAGAGAAAGAGAGCAGAAGG + Intergenic
1106847079 13:33748211-33748233 CAAGAGAGGTGGAGTGCAGTAGG - Intergenic
1106867045 13:33976427-33976449 GAGCAGAGATGAGGAGAAGTTGG + Intergenic
1107038704 13:35926838-35926860 CAGGTGAGAAGGGCAGGAGTTGG + Intronic
1107221302 13:37984486-37984508 CAGGAGAGATCGAGAGCAAATGG + Intergenic
1107808964 13:44180985-44181007 CAGGAGAGTTGGGTATCACTTGG + Intergenic
1108056228 13:46488136-46488158 CAGGAGAAAGAGGGAGCAGGAGG + Intergenic
1108305124 13:49123853-49123875 CTGGAGAGATGTGGAGAAATAGG + Intronic
1108760827 13:53562243-53562265 GAGGAGAGATGGGGAGAGGAAGG - Intergenic
1108950247 13:56083649-56083671 CAGGAGAGAAGGGCAGGAGAAGG - Intergenic
1111336312 13:86828818-86828840 CAGGAGAAATGTGGAGATGTTGG - Intergenic
1112186673 13:97134487-97134509 GGGGAGAGGTGGGGAGCAGAAGG - Intergenic
1112441328 13:99426838-99426860 CAGGAGAGATGAGGGGAAGGTGG + Intergenic
1112563999 13:100536873-100536895 CAGGTGTGAGGGGAAGCAGTGGG + Intronic
1112672670 13:101659090-101659112 CTGGAGAGCTGGAGTGCAGTGGG + Intronic
1112708425 13:102099109-102099131 GAGAAGGGATGGGGAGCAGGAGG - Intronic
1113018973 13:105860479-105860501 CATGAGACATGAGAAGCAGTTGG + Intergenic
1113060309 13:106315204-106315226 CAGGAGAGAAAGGGGGCAGAGGG - Intergenic
1113422181 13:110179332-110179354 CCGGGGAGAAGGGGAGCATTGGG - Exonic
1113496850 13:110737714-110737736 CAGGAGAGAGAGTGAGCAATGGG - Intergenic
1113840066 13:113354165-113354187 GAGGAGAGCTTGGGTGCAGTGGG - Intronic
1114551644 14:23535917-23535939 TAGGAAAGATGGGGAGGAGCAGG - Intronic
1115001112 14:28420731-28420753 CAAAAGAGATGGTGAGAAGTGGG - Intergenic
1115022041 14:28693717-28693739 CAGCAGAGAAAGGGAGCAGAAGG - Intergenic
1115027781 14:28764421-28764443 GAGGAGAAATTGGGAGGAGTAGG + Intergenic
1115141746 14:30179614-30179636 GAGGAGAGATGGAGAGAACTAGG + Intronic
1115920736 14:38370335-38370357 AGGGAGAAATGGGGAGAAGTTGG + Intergenic
1116396450 14:44452859-44452881 CAGGAGAGAGGAGAAGCAGCTGG - Intergenic
1117925870 14:60778639-60778661 CAGGAAAGATGTGTAGCAGTGGG + Intronic
1118412208 14:65492917-65492939 GAGGAGAGAAGGGAAGCAGGTGG - Intronic
1119150623 14:72356308-72356330 CAGGAGAGAGAGAGAGCAGGGGG - Intronic
1119182128 14:72612346-72612368 CAGAGGAGGTGGGGAGCAGGTGG - Intergenic
1119286230 14:73457807-73457829 CTGGAGAGATGAGGAGCAGCAGG - Intronic
1119416366 14:74472718-74472740 CAGGAGAAATGAGGATGAGTAGG + Intergenic
1120128194 14:80772426-80772448 CAGGATGGATGGGGAGCTGGAGG - Intronic
1120295925 14:82640755-82640777 GAGGGGAGATGGGGAAAAGTAGG + Intergenic
1120734488 14:88037847-88037869 CAGGAAAGATGAGGAGGAGGAGG - Intergenic
1121655104 14:95589096-95589118 CAGGGTAAATGGGGAGCAGGAGG - Intergenic
1121956491 14:98218179-98218201 CAGGAGAGAAGGGGAGAAAGAGG - Intergenic
1122159909 14:99775421-99775443 CTGGGGAAATGTGGAGCAGTGGG + Intronic
1122403765 14:101484238-101484260 CAGGAGGGAGGGAGAGAAGTTGG + Intergenic
1122413765 14:101538906-101538928 CAGGAGGGGAGTGGAGCAGTAGG - Intergenic
1123500242 15:20875518-20875540 AAGGAGAGATGGGCAGATGTTGG - Intergenic
1123500668 15:20878247-20878269 CAGGAGAGGTGCAGAGCAGGCGG + Intergenic
1123557488 15:21449212-21449234 AAGGAGAGATGGGCAGATGTTGG - Intergenic
1123557913 15:21451940-21451962 CAGGAGAGGTGCAGAGCAGGCGG + Intergenic
1123593715 15:21886474-21886496 AAGGAGAGATGGGCAGATGTTGG - Intergenic
1123594142 15:21889221-21889243 CAGGAGAGGTGCAGAGCAGGCGG + Intergenic
1124117832 15:26864287-26864309 AAGGAGAGACGGGGAGATGTGGG - Intronic
1124227015 15:27903322-27903344 CAGGAGAGGAGGGCAGCTGTGGG - Intronic
1124411535 15:29441503-29441525 AACGAGAGCTGGGGAGCAGCGGG - Intronic
1125397949 15:39270414-39270436 CTGGAGAGATGGGGAGGTCTGGG + Intergenic
1127497169 15:59524202-59524224 CACCAGAGGTGGGGGGCAGTTGG + Intergenic
1128148223 15:65344523-65344545 GGGGAGAGGTGGGGGGCAGTGGG + Intronic
1128259442 15:66222302-66222324 CAGTATAGTTGGGGAGCAGCTGG - Intronic
1128808742 15:70554752-70554774 CAGGAGAGATGGGCAACATAGGG + Intergenic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1130534171 15:84771259-84771281 CAGGAGAAAAGTGGAGCAGGAGG + Intronic
1131232605 15:90670579-90670601 CTGGAGGGGTGGGGAGCAGGGGG + Intergenic
1131539296 15:93262610-93262632 CAGGAGAGATGGGCTGGGGTTGG - Intergenic
1131938934 15:97539314-97539336 CAGGTGTGATGGGGAGCCATGGG + Intergenic
1132116063 15:99137322-99137344 CAGGAGGGATGCGAAGCAGCAGG + Exonic
1132224895 15:100132787-100132809 CAGGAGAGATGGGGAGGTGTTGG - Intronic
1202965838 15_KI270727v1_random:176385-176407 AAGGAGAGATGGGCAGATGTTGG - Intergenic
1202966264 15_KI270727v1_random:179112-179134 CAGGAGAGGTGCAGAGCAGGCGG + Intergenic
1132688128 16:1170792-1170814 CAGGAAAGAAGGGGTGCAGTGGG - Intronic
1132693990 16:1194056-1194078 CAGGGGTGAGGGGGAGCCGTGGG + Intronic
1132847523 16:2007270-2007292 CAGGGCGGAGGGGGAGCAGTAGG + Intronic
1132989151 16:2784303-2784325 CAGGCCAGATGGGCAGCAATTGG + Exonic
1133537070 16:6712708-6712730 GAGGGGAGGTGGGGAGAAGTGGG - Intronic
1133567856 16:7011843-7011865 CATGAGAAATGGGAAGGAGTGGG + Intronic
1136103645 16:28013342-28013364 GAGGAGAGCTGGCGAGCAGAGGG + Intronic
1136547273 16:30962518-30962540 GTTGAGTGATGGGGAGCAGTGGG + Intronic
1136609138 16:31355740-31355762 AAGGAGAGAAGGGGATGAGTTGG + Intronic
1137522269 16:49204458-49204480 CAGGAGAGATGGTGTGAAGAGGG + Intergenic
1137572287 16:49574744-49574766 CAGGAGAGAGGGAAAGCAGGAGG - Intronic
1138352140 16:56351779-56351801 CAGGAGTGGTGGGGAGCAGGGGG + Intronic
1139051092 16:63125324-63125346 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1139953193 16:70681689-70681711 CAGGAGGGGAGGGGAGCAGGGGG - Intronic
1140104432 16:71946804-71946826 CATGAGAGAGGGGGAGGAGGAGG + Intronic
1141676361 16:85519834-85519856 CAGGAAGGAAGGGGAGCACTTGG - Intergenic
1142741067 17:1932319-1932341 CAGGAGAGGAGGGGTGCGGTTGG + Intergenic
1142803536 17:2359811-2359833 CAGGACAGAGGGGCAGCAGGTGG - Intronic
1143039481 17:4023074-4023096 CAGGAAAGGTGGGGCGCAGCCGG - Intronic
1143352167 17:6296999-6297021 TAGTAGAGATGGGGAGGAGGTGG - Intergenic
1143564814 17:7715091-7715113 CAGGGGAGATGGGGATGGGTGGG + Intergenic
1144036011 17:11366653-11366675 CAGGACAGATGGAGAAGAGTGGG + Intronic
1145001010 17:19304630-19304652 CAGGAGTGCTGGGATGCAGTTGG - Intronic
1146127698 17:30241688-30241710 CAGAAGAGACTGGGAACAGTAGG + Intergenic
1147309566 17:39587075-39587097 CAGGAGAGAGGGAAGGCAGTGGG + Intergenic
1147327332 17:39675745-39675767 CAGGAGAGAATGGGAGGAGAAGG + Intronic
1149026654 17:52035222-52035244 CAGCAGAGAGGAGGAGCAGCTGG + Intronic
1149106703 17:52976033-52976055 CAGTGAAGATGTGGAGCAGTAGG - Intergenic
1149251942 17:54780161-54780183 CAGGGAAGGTGGGGGGCAGTGGG + Intergenic
1150096708 17:62382566-62382588 AAGGAGATATGGGGAGATGTTGG - Intronic
1151186870 17:72371209-72371231 CTGGAGAGAAGGGGAGAAGGGGG - Intergenic
1151195013 17:72425165-72425187 CAGGAAAGATGAGAAGCATTGGG - Intergenic
1151356644 17:73562558-73562580 CAGGAGAGGCGGGGAGAAGAAGG + Intronic
1151744137 17:76002434-76002456 GAGGAGAGAGGGGCAGCAGGAGG + Intronic
1152322988 17:79618862-79618884 TGGGAGAGACGGGGAGCAGGAGG + Intergenic
1152472501 17:80498292-80498314 CAGGATTGCTGGGGAGCTGTAGG + Intergenic
1152528193 17:80901772-80901794 CAGGAAAGATGGGGAGGCGCTGG - Intronic
1152816278 17:82410018-82410040 CAGGAGAGATGGGGAGCAGTGGG - Intronic
1154500681 18:14995887-14995909 GAGGAGAGAAGGGGAGCTCTTGG + Intergenic
1155393982 18:25367255-25367277 CAGGAAAGATGGGTGGCATTGGG - Intergenic
1155505183 18:26526241-26526263 CTGGAGATTTGGGGAGCAGCAGG + Intronic
1155687629 18:28574814-28574836 CAGGAGAGATGATGAGGTGTGGG + Intergenic
1155760355 18:29557860-29557882 CAGGAGAGAAAGGGAGCAACAGG + Intergenic
1156231628 18:35158750-35158772 TAGGAGGGGTGGGGAGCAGGAGG + Intergenic
1156457875 18:37304873-37304895 CAGAAGGGAGGGGGAGCAGGTGG + Intronic
1158147933 18:54336682-54336704 CAGGAGAGAGAGGGAGCAAAGGG - Intronic
1158185368 18:54765324-54765346 CAGGAGTGAGGGTGAGCACTGGG - Intronic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1158988764 18:62847270-62847292 AAGGAGAGATGGGGAGAGGGAGG + Intronic
1159973752 18:74685350-74685372 CAGGATAGATGGTGAGCAGCTGG - Intronic
1160388842 18:78515082-78515104 CAGGAAAGATGTGGAGGAGGTGG + Intergenic
1160827063 19:1085519-1085541 CAGGAGAGATGGGGAGAGACAGG - Intronic
1160827074 19:1085566-1085588 CAGGAGAGATGGGGAGAGACAGG - Intronic
1161058799 19:2203938-2203960 GAGGACAGGTGGGGAGCAGTTGG - Intronic
1161239347 19:3213380-3213402 CAGGAGAGAGAGGGAGGAGGGGG + Intergenic
1161486580 19:4539031-4539053 CCGCAGAGATGGGAAGAAGTGGG - Intronic
1161721138 19:5903408-5903430 CAGCAGGGTTGGGGAGCACTGGG - Intronic
1162347514 19:10128531-10128553 CAGGAGAGGCCGGGCGCAGTGGG - Intergenic
1162575247 19:11495410-11495432 GAGGAGAAATGGGGAACAGGAGG + Intronic
1162794817 19:13081595-13081617 CAGGAGAGGAGGGGAGCTGCCGG - Intronic
1162915180 19:13870914-13870936 CAGGGGAGCTGGGGATAAGTGGG - Intronic
1162991440 19:14305203-14305225 CAGAAGAGATGGGGAGGAACTGG - Intergenic
1163831307 19:19548351-19548373 CAGCAGGGATGGGGAGGAGCTGG - Intergenic
1163836136 19:19575461-19575483 CAGGAGAGATTAGGAGGAGAGGG - Intronic
1163854268 19:19687343-19687365 CAGGAGGGAGGGAAAGCAGTAGG - Intergenic
1164468035 19:28504915-28504937 CAGCTGAGATGAGGAGCTGTTGG - Intergenic
1164677436 19:30111317-30111339 AAGGAGAGATGAGGTGAAGTGGG + Intergenic
1164686765 19:30171996-30172018 CAGGAGAGTCTGGGAGCTGTGGG + Intergenic
1165050641 19:33139325-33139347 CAGGAGGGCTGGGGAGGAGCAGG + Intronic
1165456423 19:35913861-35913883 CAGCAGAAATGTGGAGCAGTTGG + Intergenic
1165650845 19:37487978-37488000 CTGGAAAGATGTGGAGCAATAGG + Exonic
1165862666 19:38917450-38917472 CCAGAGAGAGGGGGAGCAGCAGG + Intronic
1166200456 19:41234114-41234136 CATGAGACCTGGGGAGGAGTGGG - Intronic
1166340609 19:42134648-42134670 CATGGGAGCTAGGGAGCAGTGGG + Intronic
1166568135 19:43777584-43777606 CAGAAGAGAGGGGTGGCAGTGGG - Intronic
1166592880 19:44016773-44016795 CAGGAGAGAATGAGAGCAGGAGG - Intergenic
1166656879 19:44618661-44618683 CTGGAGTGATGGGGATGAGTGGG + Intronic
1166690105 19:44817377-44817399 CAGGAGGAATGGGGAAGAGTGGG + Intronic
1166914120 19:46182959-46182981 TGGGAGAGATGGGGAGAAGTGGG - Intergenic
1166914194 19:46183461-46183483 CAGGAGAGACTGGGAGGGGTAGG - Intergenic
1167017084 19:46848225-46848247 CAGGTGTGATGGGGGGCAGGGGG + Intronic
1167112843 19:47472006-47472028 CCGGAGAGAGGGGGAGGAGGCGG + Exonic
1167163173 19:47780673-47780695 CAGGGGAGAGAGGGAGAAGTGGG - Intronic
1167250840 19:48397703-48397725 CAGCAGAGACGGGGAGAAGACGG - Intronic
1167250964 19:48398330-48398352 CGGGAGAGACGGGGAGGAGAGGG - Intronic
1167277876 19:48549938-48549960 CAGGAAGGTTGGGGAGCAGTAGG - Intergenic
1167609580 19:50500757-50500779 CAGGAGGGAGTGGGAGCAGGAGG + Intergenic
1167815402 19:51876472-51876494 CTGGAAAGGCGGGGAGCAGTGGG + Intronic
1167898668 19:52601829-52601851 GAGGAGACCTGGGGAGCAGCAGG - Intronic
1168277072 19:55284319-55284341 CCGGAGAGGTGGGGGGCAGCCGG + Exonic
1168295198 19:55374694-55374716 CAGGAGAGATGGGTAACACGGGG + Intergenic
1168464960 19:56594919-56594941 GAGGAGGGATGGGGAGGAGCGGG - Intergenic
1168636031 19:57997918-57997940 CAGGTGAGATGGGAAGCAGAAGG - Intronic
925271774 2:2614939-2614961 AAGGAGACAAGGGGAGCAGATGG + Intergenic
925812707 2:7716762-7716784 AAGGACTGATGGGGAGCAGGGGG + Intergenic
926314264 2:11697800-11697822 CTGGTGAGATGGGGAGGAGGGGG - Intronic
926368383 2:12154891-12154913 GAGGAAAGATGTGGAGCAGCAGG - Intergenic
926425899 2:12738469-12738491 GAGGAGGGATGGGGAGGAGTTGG - Intronic
926649911 2:15331998-15332020 CAGGAGAGATTTGAAGCAGGAGG + Intronic
926796684 2:16625368-16625390 CAGGAGAGATGGGGTGGGGGTGG + Intronic
926893305 2:17657690-17657712 CTGGAGAGATGGCCAGCAGCGGG + Intergenic
927334272 2:21903954-21903976 CTGGAGAGATGTGGAGAAATAGG - Intergenic
927453956 2:23233099-23233121 CAGGAGGGGTGGGGAGGAGTAGG + Intergenic
927969534 2:27296610-27296632 CAGGAGAAAAGGGGAGGAGCAGG + Intronic
928157293 2:28888269-28888291 CAGGAGAGATGGGGCACAGGTGG + Intergenic
928946318 2:36775076-36775098 GAGCAGAGATGGTAAGCAGTGGG - Intronic
930512246 2:52359529-52359551 CAGCAGAGAGGGGAAGCAGCAGG + Intergenic
932261232 2:70329375-70329397 CAGGTGAGCTGGGAAGCAGCAGG + Intergenic
933443915 2:82352855-82352877 TAGGAGGGTTGGGGAGTAGTGGG + Intergenic
933743337 2:85552138-85552160 CAGAAGAGATCTGGAGCACTGGG + Intronic
933811182 2:86033661-86033683 CTGGGGAGTTGGGGAGGAGTCGG - Exonic
934087901 2:88525509-88525531 CAGGGAAGATGGGGAGGAGTGGG + Intronic
934902029 2:98167116-98167138 CAGGAGAGATGGTGGCCAGCGGG + Intronic
935112082 2:100104012-100104034 GAGGAGGGAGGGGGCGCAGTCGG + Intronic
935498550 2:103810277-103810299 CAGGAAAGGTGGGGGGCAGGAGG + Intergenic
936010936 2:108924979-108925001 GAGGTGAGATGGGGAGCAGGTGG - Intronic
936122890 2:109761139-109761161 GAGGAGGGAGGGGGCGCAGTCGG - Intergenic
936221798 2:110610325-110610347 GAGGAGGGAGGGGGCGCAGTCGG + Intergenic
936260267 2:110953818-110953840 CAGGAGAGAGAGAGAGAAGTCGG + Intronic
936651244 2:114428911-114428933 CAGGATAGATGTGGAGAAGGTGG - Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937155462 2:119715780-119715802 CAGGAGACATGGGGTGCACCAGG - Intergenic
937933530 2:127223788-127223810 CAGGAGAGCGGGGGAGCTGCAGG - Intergenic
938296156 2:130181085-130181107 CAGGAGAGTTGGGAACAAGTGGG - Intronic
938378223 2:130822501-130822523 AGGGAGAGAGGGAGAGCAGTGGG + Intergenic
938499879 2:131826216-131826238 GAGGAGAGAAGGGGAGCTCTTGG + Intergenic
938793774 2:134701494-134701516 TAGGAGAGTTGGGGATGAGTGGG - Intronic
939222035 2:139314706-139314728 CAGGAGAGCTGTAGAGCACTTGG + Intergenic
939945319 2:148402518-148402540 CATGGAAGATGGGGAGAAGTAGG - Intronic
939963999 2:148592836-148592858 CCTGAGAGAGGGGAAGCAGTGGG - Intergenic
940656521 2:156493785-156493807 CAGGACAGATGGGTAGGACTTGG - Intronic
940686315 2:156855769-156855791 CAAGAGATATGGGGAGAAATGGG - Intergenic
941183083 2:162285153-162285175 CAGCAGAAGTGGGTAGCAGTTGG - Intronic
943474403 2:188336825-188336847 CAGGAGACAAGGTGAGAAGTTGG + Intronic
943661161 2:190561057-190561079 TAGGAGAGATATGGAGCAGTGGG + Intergenic
943844615 2:192629332-192629354 CAGGACAGATGTGGAGAAATTGG - Intergenic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945861925 2:215133563-215133585 CAGCAGAGATGGTTAGCAATAGG - Intronic
945945715 2:215993920-215993942 CTGGAGAGATGTGGAGAAATAGG + Intronic
946010174 2:216558136-216558158 CAGGAGAGAAGGGCAGTAGTGGG + Intronic
946384459 2:219374104-219374126 CAGAAAAGTTGGGGAGCAGGTGG - Exonic
946389118 2:219404930-219404952 AAGGAGAGCTTGGGAGAAGTTGG + Intergenic
946708802 2:222485769-222485791 CAGGAGAGCTGGTGAGGAGTTGG - Intronic
946748015 2:222864619-222864641 GGGGTGGGATGGGGAGCAGTGGG + Intronic
946750746 2:222893763-222893785 GAGGAGGGATGGGGAGAGGTGGG - Intronic
947837074 2:233183527-233183549 AAGGAGAGATGGGTGGAAGTCGG - Intronic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
948477280 2:238228113-238228135 CTGGTGAGATGGGGAACAGAAGG + Intronic
948506554 2:238431743-238431765 GAGGAGAGAGTGGGAGCAGCTGG + Intronic
949019081 2:241730906-241730928 CAGGAGAGAAAGGGAGCAAAGGG + Intergenic
949043286 2:241859074-241859096 CAGAGGAGATGGGGAGGAGGTGG + Intergenic
1169038311 20:2471275-2471297 CAGGAGAGATGAGGATGAGGTGG - Intronic
1169052931 20:2595781-2595803 CAGGAGAGGAGTGGAGCACTGGG + Intronic
1170367738 20:15616175-15616197 CAGGAGACAGAGGGCGCAGTGGG - Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170774871 20:19366500-19366522 AGGGATAGATGGGAAGCAGTGGG - Intronic
1172751847 20:37256818-37256840 AGGGGGAGGTGGGGAGCAGTGGG + Exonic
1172965520 20:38831571-38831593 CGGGAGTAATGGGGAGCATTGGG + Intronic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173387174 20:42599485-42599507 CCAGAGAGATGGGGTGCAATGGG + Intronic
1173907307 20:46638412-46638434 CAGGAGAGAAGCGGGGCCGTGGG + Intronic
1174061601 20:47836817-47836839 AAGCAGAGATGGGGACTAGTGGG - Intergenic
1174069922 20:47892508-47892530 AAGCAGAGATGGGGACTAGTGGG + Intergenic
1174292877 20:49521438-49521460 CAGGAGAGCTGGGCAGGAGCTGG - Intronic
1175277458 20:57781969-57781991 CAGGTGAGGTGGCGAGCAGCTGG + Intergenic
1175920838 20:62450027-62450049 CAGGATGGATGGGCAGCAGGTGG - Intergenic
1176023514 20:62974320-62974342 AAGGAAAGATGGGCAGCGGTTGG + Intergenic
1176277206 20:64279180-64279202 CAGGAGGGATGGGGTGGAGGTGG - Intronic
1177655098 21:24006542-24006564 CACGAGAGTTGGTAAGCAGTAGG - Intergenic
1177758255 21:25373569-25373591 GAGGAGGGGTGGGGAGCAGGAGG - Intergenic
1178375959 21:32067677-32067699 GAGGAGAGCTGGGGGGCAGAGGG + Intergenic
1178384599 21:32138875-32138897 CTGCTGAGATGGGGAGAAGTGGG + Intergenic
1178960006 21:37056852-37056874 CTGGGGTGATGGGAAGCAGTTGG + Intergenic
1179217701 21:39381295-39381317 CAGCAGAAATGAGGAGCTGTTGG + Intronic
1179365233 21:40752811-40752833 GAGGAGAGAAGGGGAGAAGAGGG + Intronic
1179408475 21:41144082-41144104 AAGGAGAGTTGGGGAGCCCTGGG - Intergenic
1179417278 21:41208745-41208767 AGGCAGAGATGGGGAGCAGAGGG - Intronic
1179973202 21:44847685-44847707 CAGGACAGATGGAGGGGAGTGGG - Intergenic
1180158976 21:45990596-45990618 CAGGAGGGACAGGGAGGAGTGGG + Intronic
1180845100 22:18976470-18976492 CAGGAGAGATGCAGAGCACTAGG - Intergenic
1181056369 22:20262274-20262296 CAGGAGAGATGCAGGGCACTAGG + Intronic
1181162822 22:20967891-20967913 GAGCACAGATGGGGAGCTGTCGG - Exonic
1181486502 22:23234887-23234909 CAGGAAAGTTGGGGAGTAGAGGG + Intronic
1181681701 22:24499946-24499968 CAAGGGAGCTGGCGAGCAGTGGG - Intronic
1182019039 22:27065505-27065527 CAGGAGAGATGGGGAAGGGAAGG - Intergenic
1182299465 22:29329629-29329651 CAGGAGACATGGGGTGCATGGGG + Intronic
1183200901 22:36385640-36385662 CCGGAGAGAAGGGCAGCATTCGG - Intronic
1183775020 22:39958326-39958348 GAGGAGAGATGGGGCGCTGTGGG - Intronic
1184320683 22:43740042-43740064 GAGCAGTCATGGGGAGCAGTGGG - Intronic
1184530324 22:45051454-45051476 CAGGAGGGATGGGTTGGAGTGGG - Intergenic
1184779310 22:46638403-46638425 CAGGAGGGAGGTGGGGCAGTAGG + Intronic
1184876852 22:47281776-47281798 CAGAAGAGGTGGGGAGGGGTGGG - Intergenic
1184921846 22:47610639-47610661 CAGTCGTGAGGGGGAGCAGTTGG - Intergenic
949159205 3:859994-860016 CTGGAGACCTGGGGAGCAGCGGG - Intergenic
949253057 3:2010559-2010581 CACAAGGGTTGGGGAGCAGTAGG - Intergenic
949429083 3:3953607-3953629 GAGGAGAAATGGGGAGATGTAGG - Intronic
949669351 3:6380606-6380628 CAGGAGAAATGGGGAACACATGG + Intergenic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950334419 3:12182190-12182212 CAAGGGAAATGGGGAGCAGGAGG + Intronic
950394810 3:12725990-12726012 GGGGAAAGAAGGGGAGCAGTGGG + Intergenic
950535844 3:13577696-13577718 CTGGAGAGAATGGGAGCAGGTGG + Intronic
950649053 3:14395951-14395973 CAGGGGAGATGGGGAGGGGAGGG + Intergenic
951041033 3:17989090-17989112 AAAGGGGGATGGGGAGCAGTTGG - Intronic
951991390 3:28679340-28679362 CAGGAGGAATGGGGAGAAGAGGG - Intergenic
952230454 3:31424228-31424250 GAGGGGATATGGGGGGCAGTTGG + Intergenic
952351842 3:32546793-32546815 CAGGAGAGATGGTGAGAAAATGG + Intronic
952414793 3:33080998-33081020 ATGGAGAGAGGGGGAGCAGTCGG + Intronic
952439762 3:33314308-33314330 CAGGGGAAATGGGGAGATGTTGG - Intronic
952900323 3:38108132-38108154 CCCGAGGGATGGGGAGCAGAGGG - Intronic
952918564 3:38267918-38267940 CAGGATGTCTGGGGAGCAGTGGG + Intronic
953401562 3:42625533-42625555 AAGGAGAGTTGAGGAGTAGTTGG + Intronic
954147548 3:48641774-48641796 CAGGAAAGATGGGGAGCTGGAGG + Intronic
954489799 3:50892759-50892781 CAGGAGGGAGGGTGAGGAGTGGG + Intronic
954670884 3:52290805-52290827 CAGGAGAAATGGGAAGCGGGTGG - Intronic
954936104 3:54328626-54328648 CAGGACAGATGAGGAGCCGGAGG - Intronic
955037779 3:55285713-55285735 CAGGATGGATGGGGAACATTTGG - Intergenic
955102745 3:55868060-55868082 CAGGAGAGAGGAGGAGGAGGAGG - Intronic
955624593 3:60904232-60904254 TAGGAGAGATAGGGAGAGGTAGG + Intronic
955986240 3:64576733-64576755 CTGGAGTGTTGGGGGGCAGTGGG - Intronic
955997671 3:64694097-64694119 CAGGACAGTTGGGGACCAGGAGG + Intergenic
956577423 3:70768606-70768628 TAGGATAGATGGGGAGAATTAGG - Intergenic
956878644 3:73488863-73488885 CAGCAGAGATGGGGAGGAGGGGG - Intronic
957648062 3:82960190-82960212 CAGGGGAGATGGGGTGTGGTGGG + Intergenic
958984956 3:100769764-100769786 CAGGAACCATGGGTAGCAGTGGG + Intronic
959007814 3:101040388-101040410 CAAGAGAGATGGGAAGCTATGGG - Intergenic
959106317 3:102069003-102069025 CAAGAGAGAGAGAGAGCAGTTGG + Intergenic
959151207 3:102610391-102610413 AAGGACAGGTGGGGATCAGTTGG - Intergenic
959769069 3:110071293-110071315 CAAGAGAGAGAGGGGGCAGTGGG - Intergenic
959966861 3:112365662-112365684 TAGGTGAGATGGGAAGCACTTGG - Intergenic
960170463 3:114454777-114454799 CAGGAGAGAGGAGGAGGGGTGGG - Intronic
960584824 3:119311057-119311079 CAGGCGTGATGGGGAGCTGGAGG - Intronic
960807122 3:121594712-121594734 CAAGAGAGCTGGGGAGAAGAGGG - Intronic
960933616 3:122880752-122880774 CAGGAAAGCTGGGCAGCACTGGG + Exonic
961350761 3:126300513-126300535 CAGGGGAGATGGGGAGCCATGGG - Intergenic
961671172 3:128532569-128532591 CAGGACAGGGGGTGAGCAGTAGG + Intergenic
962707224 3:138055908-138055930 CAGCAAAGATGGGGAGAAATAGG + Intergenic
965667897 3:171115569-171115591 CAGGAAGGCTGGGGAACAGTCGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967100576 3:186212120-186212142 CAGGAAACTCGGGGAGCAGTTGG - Intronic
967384627 3:188899327-188899349 CAGGTGTGTTGGGGAGAAGTGGG - Intergenic
967762658 3:193242396-193242418 GAGGAGAGAGGGGGAGAAGGTGG + Intronic
968520209 4:1031667-1031689 CCTGAGAGATGGGGACCAGTGGG + Intergenic
968871454 4:3244816-3244838 CAGGAGAGACGGGGGCCAGTCGG + Intronic
968920269 4:3518807-3518829 CAGGAGGGGTGGGGGGCAGGAGG + Intronic
968945547 4:3661703-3661725 CAGGAGTGATCTGGAGCTGTCGG + Intergenic
969363538 4:6680771-6680793 CAGGACAGATGGGATGCAGGTGG + Intergenic
969559713 4:7939424-7939446 GCGGGGAGCTGGGGAGCAGTGGG + Exonic
969715496 4:8866272-8866294 CGGGTGAGATGGGCAGCAGCCGG - Intronic
970230156 4:13901458-13901480 GAGGAGAGATGGGCAGGAGCTGG + Intergenic
970422104 4:15914902-15914924 CAGGAGGCAGGGGGAGCAGGAGG + Intergenic
972801082 4:42476324-42476346 CAGAAGAGGCGGGGTGCAGTGGG + Intronic
973290749 4:48468080-48468102 CTGGAGAGGTTGGGAGGAGTGGG - Intergenic
974178169 4:58351356-58351378 CAATAGAGATGGGGAGGAGGAGG + Intergenic
974492670 4:62587799-62587821 CAGGAGAGAGAGCGAGCTGTGGG + Intergenic
974576162 4:63726129-63726151 AAGGAGAGTTAGGGAGAAGTTGG - Intergenic
974930871 4:68359522-68359544 CAGGAGAGAAGGAGAACATTTGG - Intergenic
975110373 4:70616850-70616872 GAGGAGGGATGGAGAGTAGTAGG + Intergenic
975647271 4:76557464-76557486 CAGGGGAAATGGGGAGATGTTGG + Intronic
975994557 4:80299416-80299438 AAGGAAAGATGGGGAGAGGTAGG - Intronic
976697139 4:87928785-87928807 GAGGAGAGATGGGAAGAAGTTGG + Intergenic
976953077 4:90857736-90857758 CAGGAGAAATGGGGAAATGTAGG + Intronic
978650826 4:111002594-111002616 CAAGAGAGAAGGGGAGAAATGGG + Intergenic
978879527 4:113684942-113684964 AGGGAGAGATGAGGAGCAGCAGG - Intronic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979167711 4:117557609-117557631 CAGGTAAGAAGGGGAGCATTAGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980896966 4:138869080-138869102 GAGGAGAGAAGGGGAGAAGGAGG + Intergenic
981595169 4:146412742-146412764 GAGGAGAAATGGGGAGCAGTTGG + Intronic
982349116 4:154395462-154395484 CAGGAGATAGGAGGATCAGTGGG - Intronic
984193715 4:176633993-176634015 CAGGGGAGAGTGGGAGCCGTCGG - Intergenic
984592924 4:181636641-181636663 CAGCAGAGGTGGGGAGAAGTGGG - Intergenic
985626515 5:991687-991709 CAGGAGGGGTAGGGACCAGTGGG + Intergenic
985707084 5:1407629-1407651 CACGGGAGATGGGGAGAAGCCGG - Intronic
985900295 5:2783439-2783461 CAGAAGAGAAGGGGAGAAGACGG - Intergenic
986197472 5:5551305-5551327 CAGGAGAGAGAGGGAGAAGGGGG + Intergenic
988065451 5:26225459-26225481 CTGGAGAAATGGGGAGGAGCTGG - Intergenic
988065594 5:26226584-26226606 CTGGAGACCTGGGGAGGAGTGGG - Intergenic
988133725 5:27140658-27140680 CAGGAGAGAGAGCGAGCAATGGG + Intergenic
989061293 5:37414475-37414497 GAGGTGGGATGGGGAGCAGGGGG - Intronic
990382544 5:55231579-55231601 CAGGAGGGAAGGGGAGTAGCTGG + Exonic
990952982 5:61316610-61316632 CAGCAAAGATGGGGAGCAACTGG - Intergenic
991275260 5:64839823-64839845 CAGAAAAGATGGGGAAAAGTTGG + Intronic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
994567222 5:101465605-101465627 GTGGAGGGAGGGGGAGCAGTGGG - Intergenic
994617471 5:102123428-102123450 CAGGAGTGGTGGGGAGCAAATGG - Intergenic
994865112 5:105258515-105258537 CAAAAGAGATGAGGAGCAATTGG + Intergenic
995661126 5:114484492-114484514 CAGGAAAAATGGGGAGAAATAGG - Intronic
996314683 5:122148596-122148618 CAGCAGAGGTAGGGACCAGTTGG - Intronic
997481241 5:134186207-134186229 CAGGAGTGCAGGGGAGAAGTTGG + Intronic
998405271 5:141870683-141870705 CAGGGGAGATGGGCAGAAGAAGG - Intronic
998576570 5:143323770-143323792 CCGGAGGGATGGGGGGCAGGGGG + Intronic
998863655 5:146472562-146472584 GAAGAGAGATGGGGAACAGCCGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999065656 5:148683115-148683137 CAGGAGAGAGGGGGAGAATGAGG + Intergenic
999460997 5:151757732-151757754 CTGGAGAGATGGGGAGCCTAAGG + Intronic
999768593 5:154757786-154757808 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
999768601 5:154757802-154757824 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
999768609 5:154757818-154757840 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
999768617 5:154757834-154757856 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
1001132915 5:169079574-169079596 GAGGAGAGAAGGGGAGGAGGAGG + Intronic
1001253353 5:170165378-170165400 CAGGAGGGAGGGAGAGCAGGAGG - Intergenic
1001465906 5:171965973-171965995 CAGGAGAGAGGGTGAGAAGGGGG - Intronic
1001627126 5:173145036-173145058 CAGGAGAGCTGGCCAGCAGGGGG - Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001910558 5:175513943-175513965 TGGGAGGGGTGGGGAGCAGTAGG + Intronic
1001981399 5:176040344-176040366 CAGGGGAGAAGGGCAGCAGCTGG - Intergenic
1002236066 5:177803722-177803744 CAGGGGAGAAGGGCAGCAGCTGG + Intergenic
1002706974 5:181168018-181168040 CAGTAGAGGTGGGGAGTAGGGGG - Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1002925327 6:1602403-1602425 GAGGAGGGATGGGCAGCAGGAGG - Intergenic
1003167848 6:3696932-3696954 CAGGAGAGCAGGGAGGCAGTGGG + Intergenic
1003281503 6:4696126-4696148 GAGGGGAGATGGGGAGATGTTGG + Intergenic
1003989318 6:11470152-11470174 AGGGAGAAATGGGGAGCACTGGG + Intergenic
1004825114 6:19411516-19411538 CAGTAGTGGTGGGGAGCAGAGGG - Intergenic
1005942602 6:30571813-30571835 AGGGAGAGATGGGGAGAAATGGG + Intronic
1006456375 6:34134330-34134352 CAGGAAAGCTGGGCTGCAGTAGG - Intronic
1006511726 6:34525299-34525321 CTGGACAGATGGGGAGCCCTAGG + Intronic
1006948066 6:37798672-37798694 CAGGACAGATGGAAAGGAGTGGG - Intergenic
1007995756 6:46306115-46306137 CAGGGGATATGGTGAGGAGTAGG + Intronic
1008542909 6:52561236-52561258 AAGGTGGGATGGGGAGCAATGGG + Intronic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1008836689 6:55840957-55840979 CAGGAGAGGAGGTAAGCAGTGGG + Intronic
1011494229 6:87922836-87922858 GAGGAGAGATGGGGAGGACCAGG + Intergenic
1013580021 6:111524493-111524515 AAGCAGAGATGGGGAGGAGGTGG - Intergenic
1013922832 6:115429507-115429529 TGGGAGAAATGGGGAGAAGTTGG + Intergenic
1014887569 6:126800235-126800257 TAGGAGAAATGGGGAGATGTTGG + Intergenic
1014920143 6:127204792-127204814 CGGGAGAGAAGGGAGGCAGTAGG - Intergenic
1016087132 6:139927863-139927885 AAGGAGAGATGGGGAGGTGGGGG - Intergenic
1016308376 6:142707411-142707433 CAGGAGAGAAGGGTAGCAGGAGG + Intergenic
1016323435 6:142873184-142873206 CAGGAGAGCTGGAGAGCTCTTGG - Intronic
1016426477 6:143941483-143941505 CATGAGGGATGGGGGGCAGGGGG + Exonic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1017067080 6:150539086-150539108 AAGGAGAAATGGGAAGCAATGGG - Intergenic
1017133281 6:151126500-151126522 GAGGAGAGAAGGGGAGCTCTTGG + Intergenic
1018844714 6:167547524-167547546 GAGGAGAGATGGGGTGAAGAAGG - Intergenic
1018921315 6:168177812-168177834 CAGGTGAGAAGAGGAGCAATGGG - Intergenic
1018978797 6:168585638-168585660 CAGCTGAGCTGAGGAGCAGTGGG - Intronic
1019487813 7:1297313-1297335 CAGGAAAGATGGGGAACAGCTGG + Intergenic
1019666039 7:2252753-2252775 CAGGGGTGAGGGGGAGCAGGAGG - Exonic
1019674749 7:2304180-2304202 AAAGAGAGTTGGGGATCAGTGGG + Intronic
1020034055 7:4953151-4953173 CAGGTGAGATGGGGAACTGTAGG - Intronic
1021073648 7:16273911-16273933 CATGAGAGGTGGAGAGCTGTGGG + Intronic
1021451385 7:20785902-20785924 AGCGAGAGATGGGGTGCAGTGGG - Intronic
1022171836 7:27838865-27838887 CAGGTGACATGGGTGGCAGTTGG - Intronic
1022809625 7:33856154-33856176 CACTAGAGATAGGAAGCAGTGGG + Intergenic
1023256982 7:38322288-38322310 CAGGATAGATGGGGAGGTGAGGG + Intergenic
1023854467 7:44173822-44173844 CAGGAGATCTGGGGAGCTGGTGG + Intronic
1024215875 7:47247699-47247721 CAGCAGGGAAGGGGAGCCGTGGG - Intergenic
1024803895 7:53113697-53113719 CAGCAGAGTTGGGGGGCAGAAGG - Intergenic
1025198802 7:56949728-56949750 GAAGAGAAATGGGGAGGAGTGGG - Intergenic
1025673144 7:63627205-63627227 GAAGAGAAATGGGGAGGAGTGGG + Intergenic
1025727001 7:64073981-64074003 CAGGAGAGATCTAGAACAGTGGG - Intronic
1025978131 7:66385759-66385781 CAGGAGAGAGGGAGAGAATTAGG - Intronic
1026437747 7:70414569-70414591 CAGGAGAGACGTTTAGCAGTGGG + Intronic
1026490009 7:70855041-70855063 AGAGAGAGATGGGGAGCAGCTGG + Intergenic
1029812257 7:103061242-103061264 CAGGACAGGTGAGGAGCAGCAGG + Intronic
1029846715 7:103419338-103419360 CAGGCGAGGTGGGCAGAAGTAGG - Intronic
1030265118 7:107612823-107612845 CATGAAAGATGGGGAGAAGAGGG + Intronic
1031069549 7:117146532-117146554 CAGCAGAGAAGCGGAGGAGTCGG + Intronic
1031672778 7:124570734-124570756 CAGGAGAAATGGGGAGATGTTGG - Intergenic
1032443383 7:131959638-131959660 CAGGAGTGATGGTGGCCAGTGGG + Intergenic
1032679377 7:134166636-134166658 ATGGAGAGATGGGGAGCTCTGGG - Intronic
1033019046 7:137703204-137703226 CAGGAGAGAGAGGGAGAAGGGGG + Intronic
1033041711 7:137925190-137925212 AAGGAGAGAGGGGAAGCAGGAGG + Intronic
1033151106 7:138915688-138915710 CAGAAGAGGTAGGGAGGAGTGGG - Intronic
1033183185 7:139200760-139200782 TAGGAGATATGGGGAGATGTTGG - Intergenic
1034469276 7:151246972-151246994 CAGGAGGGAGAGGTAGCAGTTGG - Intronic
1034711793 7:153199057-153199079 CAAGAGAGGTGGGGAGCAAAGGG - Intergenic
1034857255 7:154563388-154563410 CAGGTGAGATGGGAAGCTGTGGG + Intronic
1035053782 7:156020109-156020131 CAGGAGAGGTGGGGAATGGTTGG + Intergenic
1035215189 7:157360776-157360798 CAGGAGAGATGCAGAACAGGTGG - Intronic
1035287308 7:157814559-157814581 GAGGAGAGACGGGGGGCAGGAGG + Intronic
1037543337 8:19893421-19893443 CCGGAGAGATGTGGAGAAATAGG + Intergenic
1037696542 8:21228769-21228791 CAGGAGGGCTGGGGTGGAGTGGG + Intergenic
1038046634 8:23771035-23771057 GATGGGAGATGGTGAGCAGTTGG + Intergenic
1038151353 8:24944026-24944048 TGGGGGAGGTGGGGAGCAGTAGG + Intergenic
1038726506 8:30086921-30086943 CAGGAGAGATCGGGGGCGGGTGG - Intergenic
1038869562 8:31479601-31479623 CAGGAGTGATGAAGGGCAGTTGG - Intergenic
1040014826 8:42691679-42691701 CCGGAGATATGGGGGGCACTGGG - Intergenic
1040692048 8:49950816-49950838 GAGGAGAGCTGGGGAGCATTTGG - Intronic
1041487187 8:58392189-58392211 CAGAGAAGATGGGGAGGAGTAGG - Intergenic
1041974981 8:63788225-63788247 CAGGAGGGCAGAGGAGCAGTTGG - Intergenic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042388470 8:68204576-68204598 CAGCAGAGATGGGTAACAGCTGG - Intronic
1042427105 8:68661198-68661220 TAGCAGACATGGGGAGCAGATGG + Intronic
1042482790 8:69322958-69322980 CTGGAGACCTGGGGAGGAGTGGG + Intergenic
1044164301 8:88962212-88962234 GAAGAGAGATGGGGAACAGCTGG + Intergenic
1044457353 8:92403785-92403807 CAGGAGAGGAGGGGAGAAGGGGG - Intergenic
1044757199 8:95476484-95476506 CAGGAGAAATAGGAAGCAGGTGG + Intergenic
1045911275 8:107413327-107413349 CAGGAAGGCTGGGGAGCAGAGGG - Intronic
1046179110 8:110619591-110619613 CAGGCAAGATGGGGAGCAACAGG - Intergenic
1046204573 8:110975847-110975869 GAGGAGAGATGGGCAGATGTAGG + Intergenic
1047489917 8:125365920-125365942 CAGGCAAGAGGGAGAGCAGTTGG - Intronic
1047513638 8:125534708-125534730 CAGGAGAGATGGTGCCCAGCAGG + Intergenic
1047634648 8:126747367-126747389 CAGGAGAAATGGGTAGATGTTGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1048303146 8:133265983-133266005 CAGGGCAGTTGGGGAGCAGGAGG + Intronic
1048440869 8:134458240-134458262 CAGGAGGAATGGGGAGAATTAGG + Intergenic
1048444147 8:134480780-134480802 CAGAAGAGGTGGGGAGTAGAAGG - Intronic
1049060306 8:140271512-140271534 CAGGAGAGATGGGGAAGGGGAGG + Intronic
1049393244 8:142382741-142382763 CAGGAGAGAAGGGGCCCGGTAGG + Intronic
1049401874 8:142431569-142431591 GAGGACAGAAGGGGAGCAGGAGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049629129 8:143642706-143642728 AGGGAGAGATGGGGAACAGCCGG + Intronic
1049849656 8:144823984-144824006 CGGGTGAGCTGGGGAGGAGTGGG - Intergenic
1050483562 9:6110826-6110848 GAGGAGAGAGGGGAGGCAGTGGG + Intergenic
1050782606 9:9356604-9356626 AAGTAGTGATGGGGAGAAGTAGG + Intronic
1050953045 9:11621449-11621471 CAGGAGAATTGGGGAGATGTTGG - Intergenic
1051369032 9:16342484-16342506 CAAGAGAGCTGGGGAGCTGGAGG - Intergenic
1051413563 9:16815377-16815399 CAGGAAGGATGGACAGCAGTAGG + Intronic
1052475907 9:28958717-28958739 AAGGAGAGAAGGGGAGAAGAAGG + Intergenic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053304553 9:36974929-36974951 CAGGGGCACTGGGGAGCAGTGGG - Intronic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055124400 9:72702592-72702614 CAAGAGAGATGGAGAGAATTTGG + Intronic
1056215804 9:84404907-84404929 CTACAGGGATGGGGAGCAGTCGG - Intergenic
1056968747 9:91185538-91185560 CAGAAGAGCTAGGGAGCTGTGGG - Intergenic
1057041051 9:91847607-91847629 GAGGAGAGCTGGGGTGCAGTTGG - Intronic
1057219505 9:93248351-93248373 CAGGACAGATGGGGACAAATGGG + Intronic
1057793219 9:98137704-98137726 CAGGAGGGTTGGGGAGGAGGTGG + Intronic
1058139523 9:101342558-101342580 AGGGAGAGATGGGGAGGAGGAGG + Intergenic
1058349776 9:104008390-104008412 CAGAAGGGACGGGGAGAAGTAGG - Intergenic
1058638451 9:107059442-107059464 CAGCAGAGATGCTGAACAGTAGG + Intergenic
1058868868 9:109185619-109185641 GAGGAGAGAAGGGGAGGAGGAGG + Intronic
1059746942 9:117211474-117211496 CAGGAGAGAGAGAGAGCAATGGG - Intronic
1059821850 9:117982476-117982498 CTAGAGAGATGGGAAGAAGTTGG - Intergenic
1060222400 9:121771701-121771723 CAGGAAAGACGGAGAGCAGTGGG - Intronic
1060424982 9:123496964-123496986 CAGGGGAGATAGGGAGTGGTGGG - Intronic
1060516963 9:124271959-124271981 CAGGAGACACGGGGAGCACAAGG - Intronic
1060927956 9:127468376-127468398 CAGGAGAGATGCACAGCAGAAGG + Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061264435 9:129497134-129497156 CAGGAGAGGAGGGGAGAAGGAGG + Intergenic
1061516086 9:131091391-131091413 AGGGAAAGATGGGGAGCAGAAGG - Intronic
1061884962 9:133586766-133586788 GGGGTGTGATGGGGAGCAGTGGG + Intergenic
1062190788 9:135246885-135246907 CAGGAGAGACCGGGAGGAGGAGG + Intergenic
1062348081 9:136124681-136124703 TCGGAAGGATGGGGAGCAGTGGG + Intergenic
1062486562 9:136779377-136779399 TAGGAGAGACGGGGAGGAGATGG - Intergenic
1185831098 X:3303767-3303789 CAGGAGACACGGAGAGGAGTAGG + Intergenic
1186238146 X:7535874-7535896 GAGGAGAGGTGGGAAGAAGTTGG - Intergenic
1187348820 X:18493005-18493027 CAGGTGAGGTGGGGAGGGGTGGG - Intronic
1187450892 X:19395288-19395310 AAGAAGGGATGGGCAGCAGTGGG - Intronic
1187550433 X:20297476-20297498 TGGGAGAGATGGGGAACTGTGGG + Intergenic
1188103919 X:26125263-26125285 CAGGAGAGAGAGAGAGCAATGGG + Intergenic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1189381843 X:40507661-40507683 GAGGTGAGATGGGGAGGAGAAGG + Intergenic
1190266251 X:48828884-48828906 AAGGAGAGATGGGGGGACGTGGG + Exonic
1190302526 X:49065010-49065032 CAGGTGAGAGGGGGAGAAGTGGG - Intronic
1191132578 X:57030633-57030655 CAGGGGGGATGGGAAGCTGTGGG - Intergenic
1191141610 X:57121163-57121185 CAGGAGACATGGGGTGGAGTTGG - Intronic
1191143251 X:57137130-57137152 CAGGAGACATGGGGTGGAGTTGG - Intronic
1191604927 X:63050953-63050975 CAGGAGACAGTGGGAGCAGGAGG + Intergenic
1191711127 X:64150991-64151013 CAGGAGAGAGAGAGAGAAGTGGG + Intergenic
1192182428 X:68924593-68924615 CAGGAGAGGAGGGGAGCAAGGGG - Intergenic
1192897929 X:75463793-75463815 CAGGAGGGATGTGGAGAAATAGG + Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1196370740 X:114977063-114977085 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1197289255 X:124635469-124635491 CTGGAGAGATGTGAAGCATTAGG - Intronic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1199062712 X:143377484-143377506 CAGGAGAGAGAGAGAGCAGAAGG + Intergenic
1199461867 X:148093934-148093956 CAGATGAGATGGGGAGCCCTAGG + Intergenic
1200226516 X:154420620-154420642 CAAGAGTGATGAGGAGCAGTAGG - Intronic
1200334857 X:155339807-155339829 AAGGAGAGATGGGAAGAGGTTGG - Intergenic
1200351609 X:155501414-155501436 AAGGAGAGATGGGAAGAGGTTGG + Intronic
1201144133 Y:11053521-11053543 AGAGAGAGATGGGGAGGAGTAGG - Intergenic
1201382047 Y:13391586-13391608 AAGGAGAAATGGTGAGCAGTGGG - Intronic