ID: 1152817855

View in Genome Browser
Species Human (GRCh38)
Location 17:82418719-82418741
Sequence TCGCGGGACCGCGGCGGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152817845_1152817855 -3 Left 1152817845 17:82418699-82418721 CCTGGCTGCGCCCCCGGACCTCG 0: 1
1: 0
2: 0
3: 21
4: 247
Right 1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG 0: 1
1: 0
2: 1
3: 31
4: 229
1152817844_1152817855 2 Left 1152817844 17:82418694-82418716 CCGGGCCTGGCTGCGCCCCCGGA 0: 1
1: 0
2: 4
3: 37
4: 340
Right 1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG 0: 1
1: 0
2: 1
3: 31
4: 229
1152817841_1152817855 19 Left 1152817841 17:82418677-82418699 CCGCGAGGGCGGGGCGGCCGGGC 0: 1
1: 0
2: 0
3: 93
4: 2465
Right 1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG 0: 1
1: 0
2: 1
3: 31
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152817855 Original CRISPR TCGCGGGACCGCGGCGGCGC AGG Exonic