ID: 1152818054

View in Genome Browser
Species Human (GRCh38)
Location 17:82420432-82420454
Sequence CCTTGCTTCTCTCTAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 4, 2: 32, 3: 162, 4: 563}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152818054_1152818059 4 Left 1152818054 17:82420432-82420454 CCAGAAGCTAGAGAGAAGCAAGG 0: 1
1: 4
2: 32
3: 162
4: 563
Right 1152818059 17:82420459-82420481 GTCCTCCTCTTCAGCCTTCAGGG 0: 1
1: 0
2: 0
3: 41
4: 297
1152818054_1152818063 13 Left 1152818054 17:82420432-82420454 CCAGAAGCTAGAGAGAAGCAAGG 0: 1
1: 4
2: 32
3: 162
4: 563
Right 1152818063 17:82420468-82420490 TTCAGCCTTCAGGGAGAGCTGGG 0: 1
1: 0
2: 3
3: 39
4: 323
1152818054_1152818062 12 Left 1152818054 17:82420432-82420454 CCAGAAGCTAGAGAGAAGCAAGG 0: 1
1: 4
2: 32
3: 162
4: 563
Right 1152818062 17:82420467-82420489 CTTCAGCCTTCAGGGAGAGCTGG 0: 1
1: 0
2: 4
3: 31
4: 325
1152818054_1152818058 3 Left 1152818054 17:82420432-82420454 CCAGAAGCTAGAGAGAAGCAAGG 0: 1
1: 4
2: 32
3: 162
4: 563
Right 1152818058 17:82420458-82420480 GGTCCTCCTCTTCAGCCTTCAGG 0: 1
1: 0
2: 4
3: 26
4: 252
1152818054_1152818065 28 Left 1152818054 17:82420432-82420454 CCAGAAGCTAGAGAGAAGCAAGG 0: 1
1: 4
2: 32
3: 162
4: 563
Right 1152818065 17:82420483-82420505 GAGCTGGGTCTGCTGACACCTGG 0: 1
1: 0
2: 5
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152818054 Original CRISPR CCTTGCTTCTCTCTAGCTTC TGG (reversed) Intronic
900282015 1:1876059-1876081 CCTTTCTTCTTTCTGGCTTCTGG - Intronic
901007226 1:6178030-6178052 CCTGGCTTCTCTCCATGTTCTGG - Intronic
901429520 1:9204557-9204579 CCAGGCCTCTCTCCAGCTTCTGG + Intergenic
902489854 1:16773343-16773365 CCTTGCCGCTTTCTGGCTTCTGG + Intronic
903473657 1:23604956-23604978 CCTTGCCCCTTCCTAGCTTCTGG - Intronic
903493298 1:23745701-23745723 CCTTGTTCCTCTCAACCTTCTGG + Intronic
903755430 1:25657320-25657342 CCTTCCTTCTCCCCAGCCTCTGG - Intronic
904727580 1:32561437-32561459 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
904842734 1:33383873-33383895 CCTCGCCTCTTCCTAGCTTCTGG - Intronic
904892079 1:33787154-33787176 CCCTGCTTCTCCCTAGCTTCTGG - Intronic
905253096 1:36662367-36662389 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
905386684 1:37609319-37609341 CCCTCCTTCTTGCTAGCTTCTGG + Intergenic
907492421 1:54816603-54816625 CCTTGCCTCTTTGTAGCTTCTGG + Intronic
907580978 1:55572515-55572537 CCTGCCTTCTTCCTAGCTTCTGG + Intergenic
908338415 1:63150883-63150905 CCTCCCTTCTCTCCAGCTTTGGG + Intergenic
908382920 1:63613441-63613463 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
909248244 1:73317967-73317989 CCTTGCCTCTTGTTAGCTTCTGG + Intergenic
909248395 1:73320405-73320427 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
909461256 1:75917072-75917094 CCTTACCTCATTCTAGCTTCTGG - Intergenic
909696571 1:78474148-78474170 CCATGCTGCTCTCTAACTCCTGG - Intronic
910063835 1:83127456-83127478 CCTTACTACTCTCTTGCTTTAGG - Intergenic
910959615 1:92747841-92747863 CCTTGCCTCTTCCTAGCTTTGGG + Intronic
911319313 1:96393396-96393418 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
912259509 1:108096421-108096443 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
912582272 1:110731262-110731284 CCTGGCTTCTTCCTAGTTTCTGG - Intergenic
912748350 1:112264809-112264831 TGTTTCCTCTCTCTAGCTTCTGG - Intergenic
912926035 1:113913698-113913720 TTTTGGTTCTCTTTAGCTTCTGG + Exonic
913113109 1:115673472-115673494 CCTTGCCTCTTCCTAGTTTCTGG + Intronic
913176240 1:116275681-116275703 CCTTGCCTCTCACTAGCTTCTGG + Intergenic
913441959 1:118907696-118907718 TCTTGCTCCTCTTTAGCTTCAGG + Intronic
913664091 1:121031607-121031629 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
913715187 1:121526607-121526629 CCTTGCCTCTGCCTAGCATCTGG - Intergenic
914015484 1:143814886-143814908 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
914162300 1:145146122-145146144 CCTTGCCTCTTCCTAGTTTCTGG + Intergenic
914225512 1:145716690-145716712 CCTGGGTTCTCTCTCACTTCTGG + Intergenic
914229952 1:145756687-145756709 CCATGATTCTCTCTGGCTTCTGG + Intronic
914654101 1:149723427-149723449 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
914708886 1:150194841-150194863 CCTTGCTGCTTCTTAGCTTCTGG + Intergenic
915129410 1:153686575-153686597 CCAAGCTGCTCACTAGCTTCAGG - Intronic
915465599 1:156096126-156096148 CCTGGCTTTTCTCCACCTTCTGG + Intronic
915883087 1:159693901-159693923 CCTTCCTTCTTGCTAACTTCTGG - Intergenic
916767244 1:167873232-167873254 TATTCCTTCTCTCTAGCTTCAGG + Intronic
916963653 1:169913426-169913448 CCTTGTTTCTTCCTGGCTTCTGG - Intergenic
916963663 1:169913478-169913500 CCTTGTTTCTTCCTGGCTTCTGG - Intergenic
916963673 1:169913530-169913552 CCTTGCTTCTTCCTGGCTTCTGG - Intergenic
917334631 1:173914880-173914902 CCTTGCTGCTCATTGGCTTCTGG - Exonic
918014241 1:180617590-180617612 CCTTGCCTCTTCCTAGCATCTGG + Intergenic
918892396 1:190292442-190292464 CCATGCTTCTCTCGAACTCCTGG - Intronic
918954576 1:191189073-191189095 TCATGCCTCTCTCTAGTTTCTGG + Intergenic
920079978 1:203365969-203365991 TCTTGCTTCTTCCTAGCGTCCGG + Intergenic
920526846 1:206673503-206673525 CCTTTCTTCCCTCTCCCTTCAGG + Intronic
920659095 1:207899997-207900019 CCTCGTTTCCCTATAGCTTCTGG - Exonic
920839607 1:209543257-209543279 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
920944006 1:210511547-210511569 CCCTGCCTGTCCCTAGCTTCCGG - Intronic
921543363 1:216446197-216446219 TGTTGCTTCTCTCTAGCCTAAGG + Intergenic
921868055 1:220107795-220107817 ACTTGCCTCTTTCTAGCTTTTGG + Intronic
922323616 1:224509316-224509338 CCTTTCGTCTTTCTATCTTCAGG - Intronic
922475280 1:225902924-225902946 CCTTCCTCCTCTCTAGCCCCTGG - Intronic
922918100 1:229275334-229275356 CCTTGCCTCTCTCTAGCTTCTGG - Intronic
923530586 1:234809185-234809207 CCTTGCCGCTTTCTGGCTTCTGG - Intergenic
924456386 1:244222325-244222347 CCTTCCTCCTCTCTGGGTTCAGG - Intergenic
924684184 1:246270476-246270498 CCCTCCTTCTTTCTAGCCTCTGG + Intronic
924744846 1:246822367-246822389 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
924815637 1:247439381-247439403 TCATGCTTCTCTTTGGCTTCTGG + Intronic
1063003657 10:1947737-1947759 CCTTGCCTCTCCCAAGCTTCTGG + Intergenic
1063034975 10:2277527-2277549 CCTCTCTTCTGTCTAGCTTTTGG - Intergenic
1063834947 10:10002046-10002068 CCCTGCCTCTTCCTAGCTTCTGG + Intergenic
1064320035 10:14296413-14296435 CCTTGCCTCTCTCAAGCCTCTGG + Intronic
1064621687 10:17224043-17224065 CCTGGCTTTTCTCTAGCCACTGG + Intergenic
1064703663 10:18048129-18048151 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1064732090 10:18342416-18342438 CCAGGCTGGTCTCTAGCTTCTGG - Intronic
1065278693 10:24112996-24113018 CTGTGCTCCTCTCTTGCTTCTGG - Intronic
1065401509 10:25307582-25307604 CCAGGCTTGTCTCGAGCTTCTGG + Intronic
1066665955 10:37782774-37782796 TCTTGCCTCTTCCTAGCTTCTGG - Intronic
1067179752 10:43975799-43975821 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1067182178 10:43996564-43996586 TCGAGCTTCTCTCTAGTTTCTGG - Intergenic
1067396623 10:45925805-45925827 CCTGGCCTCTTCCTAGCTTCTGG + Intergenic
1067974477 10:51008477-51008499 CCTTGCCTCTTTCTAGCTTCTGG + Intronic
1068529876 10:58173718-58173740 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1068807305 10:61212095-61212117 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1069296358 10:66849682-66849704 CCTTGACCCTCCCTAGCTTCTGG - Intronic
1070696566 10:78568298-78568320 CCTTCCTCTTCTCTTGCTTCTGG + Intergenic
1071409268 10:85372591-85372613 CCTATCTTCTTTCTAGCTTTAGG + Intergenic
1071878192 10:89865519-89865541 CCCTGCTTCTCACTATCTTCTGG - Intergenic
1071969699 10:90891216-90891238 CCTTGCCTCTTTTTAGCTTTTGG + Intronic
1072294452 10:93995444-93995466 CCTTTCTGCTCTCTACCTTCTGG + Intronic
1072594695 10:96860447-96860469 CCTTGTTTCTTCCTAGCTTCCGG - Intronic
1072601701 10:96937251-96937273 CCTTGCCTCTTCCTAGTTTCTGG - Intronic
1073304371 10:102491532-102491554 CTTTGCTTCTCTTTACCATCAGG - Intronic
1073620078 10:105037478-105037500 CCTTGCCTTTTTCTAGCTTCTGG + Intronic
1074571332 10:114626943-114626965 CTATGCTTCTCCCTGGCTTCTGG - Intronic
1074726875 10:116319907-116319929 CCTTGCCTCTCCCCAGCTTCTGG - Intergenic
1075148927 10:119908627-119908649 CCTTCCCTCTTCCTAGCTTCTGG - Intronic
1075871848 10:125776911-125776933 CCTTGCTTGTCTCAAACTCCTGG - Intergenic
1076508345 10:130993764-130993786 CCTTGCCTCCCCCCAGCTTCTGG + Intergenic
1077546300 11:3171648-3171670 CCCTGCTTCTCCCCAGTTTCTGG + Intergenic
1078407155 11:11080344-11080366 CATTGCTTCTCTCTTCCTTAGGG - Intergenic
1078478699 11:11657327-11657349 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1078522687 11:12075967-12075989 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1078862059 11:15257768-15257790 CCAGGCCTCTCTCTAGCTTCTGG - Intergenic
1078889826 11:15544416-15544438 CCTAGCTTCTCACTAGCATGAGG - Intergenic
1079142305 11:17820051-17820073 CCTGGCTGCTCTCGAGCTCCTGG + Intronic
1079328422 11:19513902-19513924 CCTTGCATCTTCCTAGCTTCTGG - Intronic
1079334591 11:19559996-19560018 GCCTGCTTCGCTCTAGCTGCAGG + Intronic
1079353540 11:19712962-19712984 CCTTGCCTCTATCTAGCTCACGG + Intronic
1079669481 11:23149423-23149445 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1081196967 11:40173072-40173094 CCTTGTTTTCTTCTAGCTTCTGG - Intronic
1081452145 11:43181549-43181571 CCTTGCCTTTTTCTAGCTACTGG - Intergenic
1081501327 11:43669615-43669637 CCTTGCCTCTTCCTAACTTCTGG + Intronic
1081562504 11:44230675-44230697 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1081635424 11:44718377-44718399 CCTTGCCTCTTGCTGGCTTCTGG + Intergenic
1081638303 11:44735456-44735478 CTTTGCCTCTTCCTAGCTTCTGG + Intronic
1081717694 11:45262514-45262536 CCATGCTTGTCTCTATCTCCTGG - Intronic
1081845097 11:46235027-46235049 CCTTTCTGCTCTCCAACTTCTGG + Intergenic
1082930955 11:58604370-58604392 CCTTGCCTCTTCCTAGCTTTTGG - Intronic
1083407204 11:62465822-62465844 CTTTGCCTCTTTCTAGCTGCTGG - Intronic
1083746759 11:64741380-64741402 TCTCCCTTCTCTCTGGCTTCAGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084165824 11:67374253-67374275 CCTCGCTTAGCTCTAGCTTTTGG - Intronic
1084450249 11:69232591-69232613 CCAGGCCTCTCTCCAGCTTCTGG - Intergenic
1085404461 11:76253770-76253792 CCTTGTATCTTTCTAGCTTCTGG + Intergenic
1085676102 11:78520259-78520281 CCTTGCCTCTTCCTAGTTTCTGG + Intronic
1085880024 11:80455567-80455589 CCTTGTCTCTTTCTAGTTTCTGG + Intergenic
1086172539 11:83852051-83852073 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1086532571 11:87803188-87803210 CCCTGCTTCTTCCTAGCTGCTGG + Intergenic
1086672116 11:89560686-89560708 CCTTCTTTCTCTCTCTCTTCTGG + Intergenic
1086756462 11:90569665-90569687 CCTTGCTTTTTTCCAGCTTCTGG - Intergenic
1086903986 11:92398083-92398105 CCTTGTCTCTTGCTAGCTTCTGG + Intronic
1087100298 11:94357271-94357293 CCTGGGGTCTCTCTAGCTTTTGG + Intergenic
1087191279 11:95257208-95257230 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1087614745 11:100474953-100474975 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1087986495 11:104688181-104688203 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1088016767 11:105070489-105070511 ACTTCCTTCTCTCTGGCTTTGGG - Intronic
1088019317 11:105100398-105100420 ACTTCCTTCTCTCTGGCTTCAGG - Intronic
1088424311 11:109685448-109685470 TCTTGCTTCTCCCTAGCTTCTGG - Intergenic
1088585989 11:111360453-111360475 CCAAGCTTCTCTCTGCCTTCTGG - Intronic
1088605981 11:111532564-111532586 CTTTGCTTCTTTCTAGTTTCTGG - Intronic
1089967863 11:122668387-122668409 TTTTGCTCCTCTCTTGCTTCTGG + Intronic
1091150194 11:133321211-133321233 CCTAGTTACTCTCCAGCTTCTGG + Intronic
1091769862 12:3144504-3144526 CCTGGCCTCTTTCTAGCTTCTGG - Intronic
1092878129 12:12866219-12866241 CCTTGCGTCTTCCTGGCTTCTGG - Intergenic
1093033186 12:14308072-14308094 CCTTTCCTCTTTCTAGTTTCTGG - Intergenic
1093626662 12:21357384-21357406 CCATGCCTCTTTCTAGCTTCTGG - Intronic
1093772055 12:23029716-23029738 CCTTGCCTCTCCCTGGCATCTGG + Intergenic
1093827593 12:23713232-23713254 GCATGCCTCTCCCTAGCTTCTGG - Intronic
1095267201 12:40174365-40174387 CATTGCCTCTTCCTAGCTTCTGG + Intergenic
1095345681 12:41146642-41146664 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1095793139 12:46189071-46189093 CCTTGCCTTTCTCTTGCTCCAGG - Intronic
1096379254 12:51141688-51141710 CCAGGCTTGTCTCTAGCTCCTGG - Intronic
1096580186 12:52579987-52580009 CCTAGCTTTTCTCTGGCTTGGGG + Intergenic
1096871956 12:54598372-54598394 CCTTTCTGCGCTATAGCTTCAGG + Intergenic
1097560415 12:61198252-61198274 CCTTGCCTCTTGATAGCTTCTGG - Intergenic
1098169447 12:67731875-67731897 CCTTCCATCTTCCTAGCTTCTGG + Intergenic
1098204907 12:68098453-68098475 CCTTGCCTCTTCCTGGCTTCCGG + Intergenic
1098608492 12:72424183-72424205 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1098766756 12:74500019-74500041 CCTTGCCTCTTCCTAACTTCTGG + Intergenic
1099384888 12:82002405-82002427 CCTTGTTTCTCACAAGCATCAGG - Intergenic
1099584168 12:84494550-84494572 CTTTGCTTCTTCCAAGCTTCTGG - Intergenic
1099847402 12:88045231-88045253 TCTGCCTTCTCTCAAGCTTCAGG - Intronic
1100004462 12:89877269-89877291 CTTTGCTTCTCTATATCTTAGGG - Intergenic
1100418900 12:94409758-94409780 CCTTGCCTCTTTCTAGCTTCTGG + Intronic
1100825843 12:98473427-98473449 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
1100848879 12:98688685-98688707 CCATGCTTGTCTCCAGCTCCTGG + Intronic
1101241749 12:102846005-102846027 CCTTGTATCTCTGTAGCCTCTGG + Intronic
1101344592 12:103874757-103874779 CCTTGCCTCTCTCCAGCTTCTGG + Intergenic
1101364707 12:104061046-104061068 CCATGCCTCTTTCTAGCTTCTGG - Intronic
1101425610 12:104585820-104585842 CCTTGCCTCTTCCTGGCTTCTGG + Intronic
1101742329 12:107510300-107510322 CCTTGTTTGTCTCTGGCTGCAGG - Intronic
1102009688 12:109610646-109610668 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1102239335 12:111314133-111314155 TCTTGCATCTCTCTTGCTACTGG - Intronic
1103456691 12:121072882-121072904 CTTTGCTTCTTTCTAGCTTCAGG + Intergenic
1103507883 12:121453790-121453812 CCTTTCTTCTCTCCCGGTTCTGG - Intronic
1103558504 12:121779885-121779907 CCTGGCCTCTCTCCAGCTCCGGG + Exonic
1104910473 12:132237924-132237946 CCCTGCTGCCCTCCAGCTTCAGG + Intronic
1106212999 13:27668224-27668246 CTCTGCTTCTGGCTAGCTTCAGG + Intergenic
1106823130 13:33488718-33488740 CCTTTCTTCTCTCCAACTACTGG + Intergenic
1106955680 13:34936024-34936046 CCTTGCCTCTTCCTCGCTTCTGG + Intergenic
1107340163 13:39396912-39396934 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1107451880 13:40517179-40517201 TCTTGCCTGTCCCTAGCTTCTGG - Intergenic
1107711330 13:43153187-43153209 CCTTGACTCTTCCTAGCTTCTGG + Intergenic
1107793966 13:44031137-44031159 CCTTGCCTCTTCCTAGATTCTGG + Intergenic
1108041108 13:46339998-46340020 CCCTGCCTCTCTCCGGCTTCTGG + Intergenic
1108364691 13:49698154-49698176 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1108458660 13:50642971-50642993 CCTTGCTTCTTCTTAGTTTCTGG - Intronic
1108564281 13:51679788-51679810 CCTTGCTTTTTCCTAGCTTCTGG + Intronic
1108611335 13:52086917-52086939 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1109411133 13:61971005-61971027 CTTTGCCTCTCCTTAGCTTCTGG + Intergenic
1110347955 13:74470383-74470405 CCTTGCTTCTTTCTAGCTTCTGG + Intergenic
1111038730 13:82715259-82715281 CCATGCCTCTTCCTAGCTTCTGG + Intergenic
1111339743 13:86868297-86868319 ACTTTCTTCTCTCTTGCTTTCGG - Intergenic
1111501724 13:89130298-89130320 CATTTCTTCTCGCTAGCTACAGG - Intergenic
1111551143 13:89814437-89814459 CCTTACCTCTTTCTAGGTTCTGG - Intergenic
1111946286 13:94669029-94669051 CCAGGCTTCTCTCCTGCTTCTGG - Intergenic
1111967807 13:94878530-94878552 CCTTGCTTCTTTCTAGCTTCTGG - Intergenic
1112094765 13:96120188-96120210 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1112287417 13:98116561-98116583 TCATGCTTGTCTCTTGCTTCTGG - Intergenic
1112487939 13:99836429-99836451 CCTTACTGCACTGTAGCTTCTGG - Intronic
1112726479 13:102310590-102310612 CCTTGCCTCCCTCTATCTCCTGG - Intronic
1112987215 13:105466029-105466051 ACTTGCTTCACTCTACTTTCTGG - Intronic
1113032605 13:106010882-106010904 TCTTGCTTCTATCCAGCTTCTGG - Intergenic
1113150524 13:107258427-107258449 CATTACCTCTCTCTAGCTGCAGG - Intronic
1113360151 13:109623059-109623081 CCTTGCCTCTTGCTAGCTCCTGG - Intergenic
1113367852 13:109693411-109693433 CCCTGCCTCTCTCCAGCTTCTGG - Intergenic
1113442583 13:110340780-110340802 CCCAGCTTCTCGCTTGCTTCAGG + Intronic
1114454472 14:22846155-22846177 CCTTGCTTCTCTCTGTCCCCTGG + Exonic
1114602472 14:23967771-23967793 CCCTGCCTCTCTCTACCTTCTGG + Intronic
1114606841 14:24004897-24004919 CCCTGCCTCTCTCTACCTTCTGG + Intronic
1114612141 14:24049845-24049867 CCCTGCCTCTCTCTACCTTCTGG + Intergenic
1114863887 14:26563175-26563197 CCTTCCTTCTTTCTTTCTTCTGG - Intronic
1115004214 14:28461690-28461712 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1115039262 14:28901857-28901879 CCTTGCCTCTTTCTAGCCTCTGG - Intergenic
1115046283 14:28998734-28998756 TATTGCTTCTGTTTAGCTTCAGG + Intergenic
1115301979 14:31894753-31894775 CCCTTCTACTCTCTGGCTTCTGG + Intergenic
1115324663 14:32126336-32126358 CCTTGCCTCTTTCTTGCTTCTGG + Intronic
1115502837 14:34064614-34064636 CCTTGCTTCTTCCTAGCTTTTGG - Intronic
1115768245 14:36645779-36645801 CCTTCCTTCCTTGTAGCTTCAGG - Intergenic
1115962377 14:38850077-38850099 CCTTGCCTTTTCCTAGCTTCTGG - Intergenic
1116627764 14:47287956-47287978 CCTTGCCTCTTCCCAGCTTCTGG - Intronic
1117299836 14:54413975-54413997 CCATGCCTCTTCCTAGCTTCTGG + Intronic
1117352430 14:54894368-54894390 CCTTGCCTCTTCCCAGCTTCTGG - Intronic
1117580881 14:57150625-57150647 CCTTGCCCCTCCCTAGCTTCTGG + Intergenic
1117599616 14:57361963-57361985 CCTTGCCACTCTCTAGCTTCCGG - Intergenic
1117646010 14:57853723-57853745 CCATTCTTGTCTCTTGCTTCAGG - Intronic
1117744246 14:58851931-58851953 CCTTGCCTCTTACTAGTTTCTGG + Intergenic
1118530199 14:66695840-66695862 CCTTCCTCCTCTCTAACCTCTGG - Intronic
1118869243 14:69727474-69727496 CCTGGCCTCTTTCTAGCTTTTGG + Intronic
1118916616 14:70112774-70112796 CCTTGCTTCTTCCTAGCTTCTGG + Intronic
1118946152 14:70389305-70389327 CTTTCCTTCTCCCAAGCTTCTGG + Intronic
1119334219 14:73819026-73819048 CCTTGCCTCTTCCTAGCTGCTGG + Intergenic
1120009716 14:79399874-79399896 CCTTGCCTTTTCCTAGCTTCTGG + Intronic
1120030492 14:79635582-79635604 CCTTGCCTCTTCATAGCTTCTGG + Intronic
1120396580 14:83974538-83974560 CCTTACCTCTTCCTAGCTTCTGG - Intergenic
1120462838 14:84819165-84819187 CCTTGCCTCTTCTTAGCTTCTGG - Intergenic
1120800156 14:88678980-88679002 CCTTGTTTCTCTCTAGCTTCTGG + Intronic
1121222420 14:92296530-92296552 CCTTGCCTCTTCCAAGCTTCTGG - Intergenic
1121731246 14:96188687-96188709 CCAGGCCTCTCTGTAGCTTCTGG - Intergenic
1121740442 14:96248421-96248443 CCTTGCTTCTTCCTCCCTTCTGG - Intronic
1122083869 14:99286014-99286036 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1122227655 14:100289107-100289129 CCCTGCTTCTTCCAAGCTTCTGG - Intergenic
1122298236 14:100717452-100717474 CCACTCTTCTCTCTAGCTGCAGG + Intergenic
1122351968 14:101101543-101101565 CCAGGCTTCTCTCCAGCTTCTGG - Intergenic
1124111685 15:26795893-26795915 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1124462446 15:29904950-29904972 CCTTGCCTCTTCCTAGTTTCTGG - Intronic
1125697706 15:41652579-41652601 CCAGGCTGGTCTCTAGCTTCTGG + Intronic
1125967667 15:43887309-43887331 AGTTGCTTCTCTCTAGGTTCAGG + Intronic
1126487697 15:49200610-49200632 CCCTGCCTCTTTCTACCTTCTGG - Intronic
1126568965 15:50129386-50129408 CCATGCCTCTCTTCAGCTTCTGG + Intronic
1127287311 15:57543138-57543160 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
1127764593 15:62172757-62172779 TCTCGCCTCTTTCTAGCTTCTGG + Intergenic
1129050625 15:72778847-72778869 CCTTTCTTCTATCTAGATGCAGG - Intronic
1129057421 15:72830892-72830914 CCATGCGTCTCCCTGGCTTCTGG + Intergenic
1129622909 15:77165542-77165564 ACTTGCTTCTCCATTGCTTCTGG - Intronic
1129958842 15:79664845-79664867 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1130200321 15:81819961-81819983 CCTGGCCTCTTCCTAGCTTCTGG + Intergenic
1131497377 15:92924496-92924518 GCTGGCTTCTCTTTGGCTTCTGG - Exonic
1132286905 15:100670004-100670026 CCAGGCCTCTCTCTAGCTTCGGG + Intergenic
1132516553 16:368703-368725 CCTGGCTCCTCTCTAGCCGCTGG + Intronic
1133047381 16:3096325-3096347 CCTTCCTGTTCTCTAGCCTCAGG + Intronic
1133403844 16:5507821-5507843 CCTTGCGTCTTCCCAGCTTCTGG - Intergenic
1134077496 16:11302201-11302223 CCATGCCTCTCCCTAGCTTCTGG + Intronic
1134742966 16:16564401-16564423 CCTTGCATCTCTCACTCTTCTGG - Intergenic
1134837208 16:17371037-17371059 CCGTCCTTCTCTCTAACCTCAGG - Intronic
1134924594 16:18148059-18148081 CCTTGCATCTCTCACTCTTCTGG + Intergenic
1135050470 16:19188764-19188786 CCTTGCTCCTTCCTCGCTTCTGG + Intronic
1135396353 16:22134626-22134648 CCTTGCCCCTCCCTGGCTTCTGG + Intronic
1135454969 16:22589394-22589416 CCTGGCTTCTGTCTAGGTTTTGG + Intergenic
1135820763 16:25683486-25683508 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1138146262 16:54614900-54614922 GCTGGCATCTGTCTAGCTTCCGG - Intergenic
1138304861 16:55965303-55965325 CCTTGCCTCTTTCAAGCTTCTGG + Intergenic
1138505593 16:57476793-57476815 CCTACATTCTCTGTAGCTTCAGG + Intronic
1138613766 16:58148111-58148133 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
1138909049 16:61374521-61374543 TCTTGCCTCTTTCTATCTTCTGG + Intergenic
1139221933 16:65192079-65192101 CCTTGCTTCTCTGTAGTATTGGG + Intergenic
1140175761 16:72658101-72658123 CCTACCCTCTCCCTAGCTTCTGG + Intergenic
1140891946 16:79292366-79292388 CCTTGCCTCTAACTAGCTTCTGG - Intergenic
1140987325 16:80170698-80170720 CCTTACTTCCCTCTACCCTCAGG - Intergenic
1141025651 16:80544776-80544798 CCTTACCTCTTCCTAGCTTCTGG + Intronic
1141055666 16:80811429-80811451 CCTTGCCCCTTGCTAGCTTCTGG - Intergenic
1143760040 17:9095239-9095261 CCTTGCCTCTGTTTTGCTTCTGG + Intronic
1144159711 17:12545875-12545897 ACTTGCTTCTTTCTCGCTTCTGG + Intergenic
1144174205 17:12688757-12688779 CCTTCCTTCTTTCTTTCTTCAGG + Intronic
1144855136 17:18263339-18263361 CCCTGCTTCTCTCTCGGTTGTGG + Intronic
1146147684 17:30435841-30435863 CCTTGTTTCTCCCTAGTTTCTGG + Intronic
1147463773 17:40594329-40594351 CCTTGGTTATCTCTATCTTTAGG - Intergenic
1148667438 17:49385117-49385139 CCTTGGTCCTCTCTTCCTTCTGG - Intronic
1148957226 17:51363868-51363890 CCTTGCTTCTTCTTTGCTTCTGG + Intergenic
1149144720 17:53476504-53476526 CTTTGCTTCTTCCTAGCTACCGG + Intergenic
1150112540 17:62514786-62514808 CCATGCTTCTCTCAAACTCCTGG + Intronic
1150596803 17:66613583-66613605 CCTTGCCTCTTCCTGGCTTCTGG + Intronic
1150825022 17:68466619-68466641 CCAGGCTTCTCTCTATCTCCTGG + Intergenic
1151128275 17:71868282-71868304 CCATGCTGATCTCTAGCTCCTGG - Intergenic
1151232659 17:72695832-72695854 CCTTGCTGCTTTCCAGCTCCTGG - Intronic
1151350607 17:73529750-73529772 CCATGCCTGTCTCTAGCTTTTGG - Intronic
1152560284 17:81075260-81075282 CCTTGCTGCCCTCTCTCTTCCGG + Intronic
1152818054 17:82420432-82420454 CCTTGCTTCTCTCTAGCTTCTGG - Intronic
1155072248 18:22326842-22326864 CCTCGCCTCTCCCTAGGTTCTGG - Intergenic
1155483831 18:26318982-26319004 CCAGGCTGGTCTCTAGCTTCTGG - Intronic
1156163982 18:34395641-34395663 CCTTGCCTCTTCCTATCTTCTGG - Intergenic
1156455819 18:37293310-37293332 CCTTGCCCCTTCCTAGCTTCTGG + Intronic
1156741762 18:40339385-40339407 CCTTGCCTATTTCTAGCTTATGG + Intergenic
1156917082 18:42474339-42474361 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
1157425932 18:47584301-47584323 CCTTTCTCCTCTTTGGCTTCAGG - Intergenic
1158048677 18:53188776-53188798 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1158077961 18:53553191-53553213 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1158467206 18:57701486-57701508 TAGTGGTTCTCTCTAGCTTCTGG + Intronic
1158795522 18:60841186-60841208 CCATGTTTCTCCCTAGTTTCTGG - Intergenic
1158868498 18:61661227-61661249 CCTTGCCTCTTCCTACCTTCTGG - Intergenic
1158900727 18:61959348-61959370 CGTAGCTTCTCTCTAACTTAGGG - Intergenic
1158915999 18:62130085-62130107 CCTTGCCTCTACCTAGCTTCTGG - Intronic
1158973322 18:62688335-62688357 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1159041308 18:63325469-63325491 TCTTGCCTCTCCCTAGCTTCTGG + Intergenic
1159128091 18:64248200-64248222 TCTTGCCTCTTTCTAGCATCTGG + Intergenic
1160415392 18:78706384-78706406 CCTGGGCTCTCTCTGGCTTCCGG - Intergenic
1160602499 18:80024586-80024608 CCTTGCTTCCCTCAGCCTTCCGG + Intronic
1161999892 19:7737307-7737329 CCCTGCGTTTCTCTAGATTCTGG - Intergenic
1162005998 19:7779706-7779728 CCCTGCCTCTCCCTAGATTCTGG + Intergenic
1162148443 19:8628258-8628280 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
1162622113 19:11851855-11851877 CCAGGCTTGTCTCTAGCTCCTGG + Intronic
1163055471 19:14714441-14714463 CCTTGCCCCTCCCTGGCTTCTGG - Intronic
1163638409 19:18448542-18448564 CCTTGCCTCTCACTTCCTTCTGG - Intronic
1163739720 19:19003966-19003988 CCTTGCTACCCTGTGGCTTCTGG - Intronic
1165298545 19:34949910-34949932 CCTTGTTTCTCTCTTTCCTCTGG - Intergenic
1165741331 19:38206876-38206898 CCTTGCCTCTCTCTATCCTCAGG - Exonic
1166783535 19:45354438-45354460 CCTTGCTTCTCTGCTGCTTTTGG - Intronic
1166987200 19:46668076-46668098 CCTTGCCTCTTCCCAGCTTCTGG + Intergenic
925006296 2:445317-445339 CTCTGCATCTCTCTAGCGTCTGG + Intergenic
925529707 2:4845723-4845745 CCTTGCCCCTTGCTAGCTTCTGG - Intergenic
925749018 2:7070795-7070817 CTTGGCTTCTCCCTAGCTTCTGG - Intergenic
925809353 2:7683702-7683724 CTTTACTTCTCTCCAGCTGCTGG - Intergenic
926028253 2:9563567-9563589 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
926587648 2:14706101-14706123 TCATGGTTCTCTCCAGCTTCTGG + Intergenic
926705618 2:15835397-15835419 CCTTGCCTCTCCCCAGCTTCTGG + Intergenic
926722196 2:15969086-15969108 CCCTGCCTCTTTCTAGCTTTGGG + Intergenic
926772974 2:16394315-16394337 CCTTGCCCCTCTCTGGGTTCTGG + Intergenic
926958711 2:18331332-18331354 CCCTGCTTCTGTCTAACTGCAGG - Intronic
927098851 2:19771318-19771340 CCATGCCTCTCCCCAGCTTCTGG + Intergenic
927399670 2:22696484-22696506 CCTTGCCTCTTCCTAGATTCTGG - Intergenic
928653245 2:33423596-33423618 CCTTGCCTCTTTCTAACTTATGG + Intergenic
928906954 2:36378341-36378363 ACATGTTTCTCTCTAGCTGCGGG + Intronic
929551825 2:42898471-42898493 CCTGGCTGGTCTCGAGCTTCTGG + Intergenic
929558626 2:42941720-42941742 CCTTGCTTCTCTCTTGATTTTGG + Intergenic
929937567 2:46305040-46305062 GCTTGCTTCTCTCTTGATTAAGG - Intronic
930067545 2:47339340-47339362 CCTTGCCTCTTTCTTACTTCTGG - Intergenic
930274042 2:49290786-49290808 CCTTGCCTCTTACTAGCATCTGG - Intergenic
930633902 2:53784571-53784593 CCTTGCCTCTTCCTAGCTTGTGG + Intronic
930826381 2:55700433-55700455 CCTTCCTTCTCTCTCTCTTTTGG + Intergenic
931470657 2:62535334-62535356 CCATCCTTTGCTCTAGCTTCTGG - Intergenic
931902670 2:66806862-66806884 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
933233437 2:79836631-79836653 CCTTGCTTCTTCCTAGCTCCTGG + Intronic
933314519 2:80700168-80700190 CTTTGATTCTTTCTAGTTTCAGG + Intergenic
933403445 2:81827903-81827925 CCTGGCTTCTAACTTGCTTCAGG + Intergenic
935300158 2:101686807-101686829 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
935655591 2:105420219-105420241 CCATGCCTCTCCCTAGCTGCTGG + Intronic
935671675 2:105561657-105561679 CCTTCCTACTCTCCAGCATCAGG - Intergenic
935673314 2:105573554-105573576 CGTTGCCCCTCTCTAGCTCCTGG - Intergenic
936519718 2:113204101-113204123 GCTTGCATCTTTCTAGCTTCTGG + Intronic
936861639 2:117027119-117027141 CCTTCCTTTTCTGTACCTTCTGG - Intergenic
936878016 2:117215602-117215624 CCTTACTTTTCTCTGGCCTCAGG + Intergenic
938297471 2:130187396-130187418 CCCAGCTGGTCTCTAGCTTCTGG + Intronic
938418855 2:131127265-131127287 TCTTGCCTCTTCCTAGCTTCTGG + Intronic
938624399 2:133092372-133092394 CTTTGCTCCTTCCTAGCTTCTGG - Intronic
938949285 2:136242444-136242466 CCTACCTTCTCTTTAGCTTTCGG + Intergenic
939042087 2:137201995-137202017 ACTTGATTCTCTATAGATTCTGG + Intronic
939283858 2:140102389-140102411 CCTGGCCTCTTTCTATCTTCTGG - Intergenic
939475541 2:142681633-142681655 TCTTTCCTCTTTCTAGCTTCTGG - Intergenic
940074975 2:149731621-149731643 CCTTGCTTCTTCCTAGCTTCTGG + Intergenic
940179343 2:150914547-150914569 CCTTGCCTCTCTCTGGCTTCTGG + Intergenic
940779141 2:157914800-157914822 CCTTGCCTCTTCTTAGCTTCTGG + Intronic
940791868 2:158037567-158037589 CCATGCCTCTCTTTAGCTTCTGG + Intronic
941043053 2:160644856-160644878 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
942385484 2:175438545-175438567 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
942456068 2:176139320-176139342 CATGGCTTCTCCCCAGCTTCCGG - Intergenic
943920020 2:193694475-193694497 CCTTCCTTCTGTCTAGTTTTTGG - Intergenic
944694414 2:202188216-202188238 CTTTCCTTCTCTCTCGCTTTTGG - Exonic
945459049 2:210083159-210083181 CTTTGCCTCTTCCTAGCTTCTGG - Intronic
945620335 2:212127848-212127870 CCTTGCCACTCTCTAGCTTCTGG - Intronic
946032196 2:216714160-216714182 CTTTGATTTTCTCTAGCATCTGG + Intergenic
946173945 2:217911335-217911357 CCTTGCTTTGCTCTAACTGCTGG - Intronic
946184306 2:217970139-217970161 CCTTGCCTCTTTCCAGCTTCTGG - Intronic
946493322 2:220171063-220171085 CCTTGCCTCTTCCTAGCCTCTGG - Intergenic
946753166 2:222914193-222914215 CCTTCCTTCTCTCTACTTACAGG - Intronic
947803254 2:232945591-232945613 CCCCGCCTCTCTCTGGCTTCTGG - Intronic
947953623 2:234169329-234169351 CCTGGCCTCTTTCCAGCTTCTGG + Intergenic
948206276 2:236164311-236164333 CCCGGCTTCTCTCGCGCTTCGGG + Intergenic
948390206 2:237606461-237606483 CCTGGCCTCTCTCTGGCCTCTGG - Intergenic
948398069 2:237662110-237662132 CCAGGCGTCTCTCCAGCTTCTGG + Intronic
948719606 2:239890573-239890595 CCCTGCTCCTCTCTTGCTCCTGG + Intergenic
1169396368 20:5234001-5234023 CCTCCCCTCTCTCTAGCTTCTGG - Intergenic
1169490851 20:6070395-6070417 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1169568496 20:6881669-6881691 CCTTCCTTCTCTGCAGCTTAAGG + Intergenic
1169792986 20:9431148-9431170 CCTTGCCTCTTTCTGGCTTCTGG + Intronic
1171208776 20:23301306-23301328 CCATGCATCTCCCTGGCTTCTGG - Intergenic
1171986746 20:31666086-31666108 CCTTCCTTCTCTCTCCCTGCAGG - Exonic
1172307054 20:33888311-33888333 CCTTGCCTCTGCCTAGCTCCTGG + Intergenic
1172671036 20:36634578-36634600 CCTTGCTTCTCTCTAGATGGAGG + Exonic
1173459690 20:43233247-43233269 CCTTGCTTCTTCCTGACTTCTGG - Intergenic
1174455952 20:50648998-50649020 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1175162964 20:57022385-57022407 TCTCCCTTCTCTCCAGCTTCAGG + Intergenic
1175194518 20:57233635-57233657 CCTTGCCTCTCCCTAACATCTGG + Intronic
1175349968 20:58310275-58310297 CCTTGCCTCTCTATTGCATCTGG + Intronic
1175523509 20:59618188-59618210 TCCTGCTTCTCTCTTGCCTCTGG - Intronic
1175564501 20:59962392-59962414 CCTGGCCTCTCCCCAGCTTCTGG + Intronic
1176231933 20:64037241-64037263 CCTTCCTCCTCTATAGCTTCTGG + Intronic
1176301500 21:5101146-5101168 CCTTGCTGCCCTCCTGCTTCGGG - Intergenic
1176665463 21:9682986-9683008 CCTTCCTCGTCTCCAGCTTCTGG + Intergenic
1177208909 21:18045505-18045527 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1177543961 21:22532875-22532897 CCCTGCCTTTTTCTAGCTTCTGG - Intergenic
1178114363 21:29402065-29402087 CCTTGCCTCTTCCTAACTTCTGG - Intronic
1178211286 21:30535841-30535863 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
1178352233 21:31880444-31880466 CCTTGCCTCTTACTAGCTTCCGG + Intronic
1178750593 21:35299078-35299100 CCTTGCCTCTTCCTAGCTCCTGG - Intronic
1178818194 21:35950782-35950804 CCATGCCTCTTTCTAGCTTCTGG + Intronic
1179855531 21:44160753-44160775 CCTTGCTGCCCTCCTGCTTCGGG + Intergenic
1182471333 22:30550125-30550147 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1183276333 22:36900508-36900530 CCCTGCTTCTCTCTAGACTATGG - Intergenic
1183530621 22:38351487-38351509 CCTTGCTGCTCTCTGGACTCTGG + Intronic
1183667442 22:39253866-39253888 CCTTTCCTCTCTCCAGCTGCAGG - Intergenic
1185094288 22:48797847-48797869 CCAGGCCTCTCTCCAGCTTCTGG + Intronic
1185206591 22:49542190-49542212 GCTGGCCTCTCTCTAGCTTTAGG + Intronic
1185383311 22:50520333-50520355 CCTTGACTCTCTCTAGGCTCAGG + Intronic
949369980 3:3324403-3324425 CCTTGCCTCTCCCTAGCTTCTGG - Intergenic
949389318 3:3541757-3541779 CCTTGTCTCTTCCTAGCTTCTGG + Intergenic
949558025 3:5175723-5175745 CCTTGCCTCTCTCTAGCTTGTGG + Intronic
949767351 3:7541928-7541950 CCTTGCCTCTTCCTAGCTTTTGG + Intronic
949996715 3:9623081-9623103 TCTTGCCTCTCCCTGGCTTCAGG - Intergenic
950736128 3:15009843-15009865 CCTTGCCTCTTCCTACCTTCTGG + Intronic
950901792 3:16504746-16504768 CCTGTCTTCTCTCCAGCTCCAGG + Intronic
951068197 3:18292913-18292935 ACTTGCTTCTAACTTGCTTCTGG + Intronic
951220696 3:20066105-20066127 CCTTGCCTCTTCCTAGCATCTGG + Intronic
951661353 3:25070065-25070087 CCTTGGCTCTTCCTAGCTTCTGG + Intergenic
951810580 3:26694680-26694702 ACTTGATTTTATCTAGCTTCAGG + Intronic
952651381 3:35730866-35730888 CCTTTCTTCCCTCAAGCTTATGG - Intronic
952751477 3:36828375-36828397 CCTTCCTTCTTTCTTTCTTCAGG - Exonic
953051168 3:39345294-39345316 CCTTGACTCTTCCTAGCTTCTGG - Intergenic
954858743 3:53669591-53669613 CCTTGCTTCTCACTAGTGTCTGG + Intronic
955064954 3:55526164-55526186 CCTTGCCTCTTCCGAGCTTCTGG - Intronic
955499478 3:59569958-59569980 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
955692412 3:61603711-61603733 CCTTGCCACTTTGTAGCTTCTGG + Intronic
956116315 3:65922526-65922548 CCTTGTCTCTTTCTAGCTTCTGG - Intronic
956319845 3:67984627-67984649 CCTTTCCTCTTCCTAGCTTCTGG + Intergenic
956964591 3:74444003-74444025 CCTTGCCTTTTTCTAGCTTCTGG + Intronic
957429618 3:80085146-80085168 CCAAGCCTCTTTCTAGCTTCTGG - Intergenic
958024728 3:88037505-88037527 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
958043750 3:88257780-88257802 CCTTGCCCCTTTCTGGCTTCTGG + Intergenic
958475508 3:94575838-94575860 CGTTGCTTCTTCATAGCTTCTGG + Intergenic
959150097 3:102597867-102597889 GCTTGCCTCTTCCTAGCTTCTGG + Intergenic
959332513 3:105023643-105023665 CCTTTCTTCTTTCTTTCTTCTGG + Intergenic
959379780 3:105628186-105628208 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
959764396 3:110008039-110008061 CCTTGATTCTTTCCAGCTTCTGG + Intergenic
959873459 3:111354592-111354614 CTTTGCCTCTTTCTAGCTTCTGG - Intronic
959968929 3:112386302-112386324 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
961028214 3:123579727-123579749 ATTTGCTTCTCTGTAGCTTGTGG + Intronic
961081101 3:124029066-124029088 CTTTACCTCTTTCTAGCTTCTGG + Intergenic
961821017 3:129575671-129575693 CCCTGCCTCTCTCTACCTTCTGG - Intronic
962029315 3:131582716-131582738 GCTGGCTCCTCTCTTGCTTCTGG + Intronic
962360140 3:134733709-134733731 CCTTACCTCCTTCTAGCTTCTGG - Intronic
962686833 3:137856056-137856078 CCTTGCCTCTTTCTGGCTTCTGG + Intergenic
962750505 3:138431636-138431658 CCTTGCTTCTTTCCAGCTCCTGG + Intergenic
963485887 3:145934043-145934065 CCTTGCCTTTTCCTAGCTTCTGG + Intergenic
963546475 3:146665173-146665195 CCTATCTTGTCTCAAGCTTCAGG - Intergenic
963668864 3:148226480-148226502 CCTTGCATCCTCCTAGCTTCTGG - Intergenic
964221009 3:154344735-154344757 TCTTGCCTCTCCCTAGCTTCTGG - Intronic
964481282 3:157140948-157140970 CCTTGTTTCTTTGTAGTTTCTGG - Intergenic
965002887 3:162980512-162980534 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
965042337 3:163525866-163525888 CCTTCTTTCTCTGTTGCTTCAGG + Intergenic
965312003 3:167140000-167140022 CCTTTCTTCCTTCTAGCTTCTGG - Intergenic
965907651 3:173728775-173728797 CTTTGCGTCTTCCTAGCTTCTGG - Intronic
967660922 3:192108901-192108923 CCTTGCTTCTTCCTAGCTTCTGG + Intergenic
967726027 3:192863187-192863209 CCTTGCCTCTTCCTAGCCTCTGG - Intronic
967835545 3:193959507-193959529 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
968011891 3:195287525-195287547 CCAGGCTTTTCTCCAGCTTCTGG + Intronic
968220614 3:196936172-196936194 CCTTGCTTTTTTTTAGCTTTAGG + Exonic
968312650 3:197696751-197696773 TCTTGCTTCTCTCTGACTTGGGG - Intronic
968844321 4:3031504-3031526 CCCGGCCTCTCTCTAGCTGCTGG - Intronic
968908970 4:3467014-3467036 CCTTGCTCCTGCCCAGCTTCTGG + Intronic
969297135 4:6276835-6276857 CCTCGCCTCTGTCCAGCTTCTGG + Intronic
969359165 4:6650744-6650766 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
969714262 4:8860922-8860944 CCTGGCGTCTCTCTGGCGTCTGG - Intronic
970239121 4:13989665-13989687 CCTTGCCTCTTTCTAGCTTCCGG + Intergenic
970314780 4:14818816-14818838 CCTTGTCTCTTTCTAGCTTCTGG - Intergenic
970638879 4:18041284-18041306 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
970892488 4:21063121-21063143 CCCTGCCTCTCCCTAGCATCTGG - Intronic
971259921 4:25046782-25046804 CCATGCCTCTCCCTAGCTTCTGG + Intergenic
971364431 4:25966252-25966274 CCTTGCCTCTTCCTACCTTCTGG + Intergenic
971451683 4:26806881-26806903 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
972369283 4:38407176-38407198 CCTTGCCTCTTGCTAGCTTCTGG - Intergenic
972649556 4:41003638-41003660 CCTTGCCTCTTCCAAGCTTCTGG - Intronic
973971257 4:56216049-56216071 CCTTGCTTGTCTGTAGCTGTGGG + Intronic
974102584 4:57433862-57433884 CCTTGCTTATGTGTATCTTCAGG - Intergenic
974539191 4:63211472-63211494 CCCTGCCTCTTCCTAGCTTCTGG + Intergenic
975701519 4:77071467-77071489 CCTTGCTTCTGTCTTGCTTTAGG - Intronic
977379065 4:96247244-96247266 CCTTGCCTCTTCCTAACTTCTGG + Intergenic
977987894 4:103406232-103406254 CCTTGCTTCTTCCTGGCTTCTGG + Intergenic
978326173 4:107559299-107559321 CCATGCCTCTTCCTAGCTTCTGG - Intergenic
978327988 4:107580018-107580040 CTTTGCTGTTCTGTAGCTTCCGG + Intergenic
978815255 4:112897195-112897217 CCTTGCATAGCTATAGCTTCTGG + Intronic
979031302 4:115651635-115651657 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
980238900 4:130147408-130147430 CTTTGCTTCTCTCTAAATTCTGG - Intergenic
980738070 4:136917107-136917129 CAATTCCTCTCTCTAGCTTCTGG + Intergenic
980806440 4:137820836-137820858 ACTTCCTTACCTCTAGCTTCTGG + Intergenic
981014327 4:139957845-139957867 CATTGCTCCTATCTAGCTTAAGG - Intronic
981102853 4:140849603-140849625 CCGTGCCTCTCCCTAGCTTCTGG + Intergenic
981187664 4:141823140-141823162 CCTTTTTTCTCTCTCTCTTCTGG - Intergenic
982577371 4:157131586-157131608 CCTTTCTCCTCTCTAAATTCTGG + Intronic
982659279 4:158187683-158187705 CCTTGCCTTTCCCTAGCTTCTGG - Intergenic
983078472 4:163355172-163355194 CCTTGCCCCTTTCTGGCTTCTGG + Intergenic
983380391 4:166984282-166984304 CCTTGGTTCTCACTAGATTCTGG - Intronic
985277679 4:188254408-188254430 CCTTTCTTCTTCCTAGCTCCTGG + Intergenic
985410954 4:189683444-189683466 CCTTCCTCGTCTCCAGCTTCTGG + Intergenic
985790420 5:1923942-1923964 CCGTGCCTCACTCTGGCTTCCGG - Intergenic
986620101 5:9663939-9663961 CCATGCCTCTGCCTAGCTTCTGG - Intronic
986708704 5:10471833-10471855 GCTTTCTTCTCTCCAGATTCTGG - Intronic
986849413 5:11793620-11793642 CCAGGCCTCTCTCCAGCTTCTGG - Intronic
987549576 5:19361198-19361220 CCCTGCCTCTCCCCAGCTTCTGG + Intergenic
987640734 5:20608665-20608687 TCTTACTTTTCTCTAGCTGCAGG + Intergenic
988011892 5:25499212-25499234 CATTGCTACTCTCTTTCTTCAGG - Intergenic
988355829 5:30172897-30172919 CCTTGCCTGTTCCTAGCTTCGGG + Intergenic
988594122 5:32575359-32575381 CCTTGCCTCTGCCTAGTTTCTGG + Intronic
988802559 5:34710243-34710265 CCTTGCTTATTCCTAGCTTCTGG + Intronic
989268438 5:39504244-39504266 CCATGTCTCTCTCTAGCTTCTGG + Intergenic
989447530 5:41548165-41548187 TCTTGCTTCTTCATAGCTTCTGG + Intergenic
989962557 5:50433861-50433883 CCTTGCCTCTGCCTAGCATCTGG + Intronic
990240816 5:53814831-53814853 CCCTGCTTTTCACTATCTTCTGG + Intergenic
991959924 5:72034385-72034407 GCTTGCGTCTCTCTATCTTAAGG + Intergenic
992263316 5:74992324-74992346 CCCTGCCTCTTCCTAGCTTCTGG + Intergenic
992887055 5:81169429-81169451 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
992906879 5:81355795-81355817 ACTTGCTCCTCTCTGGCCTCTGG - Intronic
993031484 5:82711669-82711691 CCTTCCTTCTCTCCATCTCCTGG - Intergenic
993106468 5:83606125-83606147 CGTTGCCTCTTCCTAGCTTCTGG - Intergenic
993210390 5:84942476-84942498 CCTTTCTTTTCTCTAACTTCTGG + Intergenic
993363458 5:87006040-87006062 TCTTCCTTCTCTCTAGCTTTTGG - Intergenic
993550292 5:89265258-89265280 CCATGCTCCTCTCTTGTTTCTGG + Intergenic
993567164 5:89490051-89490073 CCTTGGCTCTTTCTAGCTTCTGG - Intergenic
994376362 5:99019390-99019412 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
995269014 5:110199763-110199785 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
995516169 5:112955974-112955996 ACTTTATTTTCTCTAGCTTCAGG - Intergenic
996272817 5:121628906-121628928 TCTTGCCTCTTTCTAGCTTCTGG + Intergenic
996399016 5:123039710-123039732 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
996424232 5:123295160-123295182 CCTTCCTACTCTCTACCTTCTGG - Intergenic
996506589 5:124275109-124275131 CCTTCCCTCTTTGTAGCTTCTGG + Intergenic
998202577 5:140136862-140136884 CTTTGCTTCCTTCTGGCTTCAGG + Intergenic
998748633 5:145291446-145291468 CCTTGCCTCTTTCTAGCTCCTGG - Intergenic
999632278 5:153583411-153583433 CCTTGACTCTTCCTAGCTTCTGG + Intronic
999681914 5:154068512-154068534 TCTCGCTTCTTCCTAGCTTCTGG + Intronic
999893919 5:156008252-156008274 ACTTTCCTCTTTCTAGCTTCTGG + Intronic
999977848 5:156929615-156929637 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1000209441 5:159096749-159096771 GCTTGCCTCTCTCTAGCTCTGGG + Intronic
1000442920 5:161284500-161284522 ACTTACTTCTGTTTAGCTTCTGG - Intergenic
1000955968 5:167543732-167543754 CCTTGCCCCTTTCTAGCTTACGG + Intronic
1000991296 5:167914730-167914752 CCTTGTCTCTCCCTAGCTTCTGG + Intronic
1001781269 5:174371030-174371052 CCTTACTCCTCTCTCCCTTCAGG + Intergenic
1002137438 5:177116680-177116702 CCTTTCTCCTCTCTCGCCTCTGG - Intergenic
1003667186 6:8122228-8122250 CCTTTCCTTCCTCTAGCTTCTGG + Intergenic
1004603605 6:17173957-17173979 CTTTGCCTCTTCCTAGCTTCTGG - Intergenic
1004677283 6:17855611-17855633 CCTTGCTGTTCTCCAGGTTCGGG - Exonic
1004952371 6:20688094-20688116 CTTTGCTTCTGTCTAGCTAAGGG + Intronic
1005009420 6:21321986-21322008 CATTTCTTCTTTCTAGGTTCAGG - Intergenic
1005617123 6:27584371-27584393 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1005682359 6:28219041-28219063 CCCTGCGTCTCTCGAGCTGCTGG + Intergenic
1005810746 6:29513954-29513976 CCTTGCCTCTTCCTAACTTCTGG - Intergenic
1006339153 6:33436938-33436960 CCTTGCCTCTTCCTAGCTTCCGG + Intronic
1007307069 6:40915229-40915251 TCTTGCTTCTTTCTAGATCCTGG + Intergenic
1007466893 6:42058834-42058856 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1007521674 6:42454788-42454810 CCTTCCTTCTCTGCAGCTTCTGG - Intergenic
1007650209 6:43414714-43414736 CGTTCCCTCTCTCTAGCTCCTGG - Intergenic
1007740851 6:44008676-44008698 CCTTGCTTAGCTCAAGCCTCAGG + Intergenic
1007762555 6:44141575-44141597 CCTCCCTTTTCTCTAGTTTCTGG - Intronic
1007990890 6:46254937-46254959 TTTTGCTTCTTCCTAGCTTCTGG - Intronic
1008028198 6:46662963-46662985 CCTTGCTACTCTCTTTCTGCAGG - Intronic
1008731062 6:54483137-54483159 CCCTGCCTCTTTCTAGCATCTGG - Intergenic
1009824155 6:68845363-68845385 CCATGCCTCTCTCCAGGTTCTGG - Intronic
1010025640 6:71212966-71212988 CCAGGCCTCTCCCTAGCTTCTGG - Intergenic
1010110076 6:72216782-72216804 CGTTTCATCTCTCTGGCTTCAGG + Intronic
1010977207 6:82329376-82329398 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1011078267 6:83461410-83461432 CCTTGCCTCTTCCTTGCTTCTGG - Intergenic
1011684109 6:89810569-89810591 CCTTGCCTCTTCCTAGCTTCTGG + Intronic
1011709506 6:90037963-90037985 CCTTCCTTCTTCCTAGCTTCTGG - Intronic
1012955712 6:105567716-105567738 CCTTCCTTCCATCTATCTTCTGG + Intergenic
1013185994 6:107758720-107758742 TCTTGCCTCTTCCTAGCTTCTGG - Intronic
1013870171 6:114748271-114748293 CATTGCTTCACTTTAGTTTCTGG + Intergenic
1013931508 6:115539858-115539880 CCTTGTTTCTTCCTAGTTTCTGG - Intergenic
1014754758 6:125290707-125290729 CCTTGCCTCTTTCTAGCTTTTGG - Intronic
1014784210 6:125599231-125599253 CCTGGCTTCTTCCTAACTTCTGG - Intergenic
1015161463 6:130156759-130156781 CCTGGCTTCTCTCAAACTCCTGG - Intronic
1015286620 6:131492564-131492586 TCTTGCCTCTCTATAGCTTCTGG - Intergenic
1015337182 6:132053235-132053257 CCTCGCCTCTTCCTAGCTTCTGG - Intergenic
1015859195 6:137657498-137657520 CCTGGTCACTCTCTAGCTTCTGG + Intergenic
1016128934 6:140441751-140441773 TCCTGCTTCTCTCTTGTTTCTGG + Intergenic
1016493634 6:144634683-144634705 CCCTACTTCTCCCTAGCTGCTGG + Intronic
1016944403 6:149515194-149515216 CCTGGCTGCTCTCAAACTTCTGG + Intronic
1017202717 6:151773263-151773285 GCATGCTTCTCTGTAGCTTCTGG - Intronic
1018035468 6:159877722-159877744 CCTTGCTTCTTCCCAGTTTCTGG - Intergenic
1018155337 6:160980357-160980379 CCTTCCTAGTCTCTAGCATCTGG + Intergenic
1018297813 6:162368001-162368023 CCTTCCCTCTCTCCTGCTTCTGG - Intronic
1018483007 6:164210909-164210931 CCCTCCTCCTCTCAAGCTTCAGG - Intergenic
1018735977 6:166687503-166687525 TCTTCCTTTTCTTTAGCTTCTGG - Intronic
1019715598 7:2537931-2537953 CCTTGCTTCTCTCCTGGTCCTGG + Exonic
1019740920 7:2672783-2672805 CCTTGCTTCTCTCCTGGTCCTGG - Intergenic
1019838316 7:3413297-3413319 CCCTGCCCCTCTTTAGCTTCAGG - Intronic
1019938824 7:4273460-4273482 CCTTGCCTCTCTCTGTCTTAGGG + Intergenic
1020225224 7:6274154-6274176 CCATGCTTGTCTCAAACTTCTGG + Intergenic
1020596713 7:10215332-10215354 CCTTGCCTTTTTTTAGCTTCTGG + Intergenic
1020732179 7:11894007-11894029 CCTTATTTCTTCCTAGCTTCTGG + Intergenic
1020753798 7:12175312-12175334 CCTTAGTTTTCTCTAGCTTATGG - Intergenic
1020847702 7:13307806-13307828 CCCTGCCTCTTCCTAGCTTCAGG - Intergenic
1021077267 7:16320204-16320226 TCTTGTTTCTCTCTTGTTTCTGG - Intronic
1021476077 7:21062696-21062718 CTTTGCTTAGCTCTAGGTTCTGG - Intergenic
1021593753 7:22293169-22293191 CCAAGTATCTCTCTAGCTTCTGG + Intronic
1022386930 7:29909262-29909284 CCTTCCTTCTTGCTAGCTTTAGG - Intronic
1022407025 7:30099999-30100021 CCTTACCTCTTCCTAGCTTCCGG + Intronic
1022581225 7:31556948-31556970 CCTGGTTTCTTTCTAGTTTCTGG + Intronic
1022621175 7:31986201-31986223 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
1022778809 7:33557075-33557097 CCTTTCCTCTCCCTGGCTTCAGG + Intronic
1023474983 7:40567570-40567592 CCTTCCTCCTCTCTATCCTCTGG + Intronic
1023639163 7:42240504-42240526 CCTTGCCTCTTACTGGCTTCTGG + Intergenic
1024146300 7:46520886-46520908 CCAGGCTGCTCTCTAACTTCTGG - Intergenic
1025656603 7:63525413-63525435 CCAGGCTCCTCTCTAGCTCCTGG - Intergenic
1025759209 7:64374545-64374567 CCTTTCTTCTCTCTGCCTACAGG + Intergenic
1025939297 7:66062405-66062427 CTCTGCCTTTCTCTAGCTTCTGG - Intergenic
1025956080 7:66184117-66184139 CCTGGCTGCTCTCAAACTTCTGG - Intergenic
1026365882 7:69647834-69647856 CTTTGCCTCTTCCTAGCTTCTGG + Intronic
1027190006 7:75991077-75991099 CCTTTCTTCTCCCTGCCTTCTGG + Intronic
1028555143 7:92115491-92115513 CCTTGCATCTTCCTAGCTTCTGG - Intronic
1029157576 7:98528274-98528296 CTCTGCTTCTCTCCAGCTCCTGG + Intergenic
1029602035 7:101571974-101571996 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
1030412856 7:109203592-109203614 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1030438090 7:109551643-109551665 CCTTGCCTCCATCTAGCTCCGGG - Intergenic
1031023171 7:116650389-116650411 CCTTGCCTTTTCCTAGCTTCTGG + Intergenic
1031096840 7:117430288-117430310 CCTTGCCTCTTCCCAGCTTCTGG + Intergenic
1031311101 7:120197919-120197941 CCTTTCCTCTTTTTAGCTTCTGG - Intergenic
1031452313 7:121937284-121937306 CCTTGCCTCTCCCTTGATTCTGG - Intronic
1032467693 7:132156767-132156789 CCTTGCTTCTCTCTCCCTGTGGG + Intronic
1032614260 7:133449244-133449266 CCTTGCCTTTTCCTAGCTTCTGG - Intronic
1032864929 7:135915659-135915681 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1033412118 7:141127567-141127589 CCATGCCTCTCTCCAGTTTCTGG - Intronic
1033837422 7:145332200-145332222 CCATGCCTCTCTCCTGCTTCTGG + Intergenic
1034888141 7:154814747-154814769 CCACGTTTCTCTCGAGCTTCTGG + Intronic
1036083148 8:5580277-5580299 CCTTGCCTCTCCCCAGCGTCTGG - Intergenic
1037381047 8:18285572-18285594 CCATGCCTCTCCCTACCTTCTGG + Intergenic
1037532764 8:19793913-19793935 ACTTGCAGCTCTCTAACTTCAGG - Intergenic
1037676102 8:21051945-21051967 CCTTGCTTCTCCATAGCCTCTGG + Intergenic
1038009087 8:23459615-23459637 CTTTGCCTCTTCCTAGCTTCTGG + Intergenic
1038170480 8:25127282-25127304 CCATGCTTGTCTCAAGCTCCTGG - Intergenic
1038869412 8:31478242-31478264 CATTGCCTCTTTCTAGTTTCTGG + Intergenic
1039299599 8:36195115-36195137 CCTGGTTTCTCTCTGGCTTCAGG - Intergenic
1039381907 8:37093317-37093339 CCTTGGCTCTTCCTAGCTTCTGG + Intergenic
1039815683 8:41092602-41092624 CCTTGCCTTCCTCTAGGTTCAGG + Intergenic
1040568242 8:48585936-48585958 CATTGCTTATCTGTAGCTGCAGG - Intergenic
1040712070 8:50200633-50200655 CCTTGCTCCTCTTGTGCTTCTGG - Intronic
1041139179 8:54796659-54796681 CCTTGCCTCTTTCTAGCTCCTGG - Intergenic
1041545444 8:59037334-59037356 CCCTGCTTCTCTCTTTCTTAAGG + Intronic
1042029254 8:64456900-64456922 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1042115094 8:65422675-65422697 ACTTGCCTCTTTCTAGCTTTTGG - Intergenic
1042315036 8:67417221-67417243 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1042317581 8:67440184-67440206 CCTTGCCTCTTCCTAGCTTTGGG + Intronic
1043924804 8:86024852-86024874 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1044245689 8:89942255-89942277 CCTTCATTCACTCCAGCTTCTGG + Intronic
1044589437 8:93899446-93899468 CCTTGCCTCTTCCTAGCTGCTGG - Intronic
1044610672 8:94088830-94088852 CCTTGCCTCTTCCTAGCTTCTGG + Intergenic
1044647113 8:94455733-94455755 CTTTGCTTCTTTCTAGCCCCTGG + Intronic
1044667839 8:94649254-94649276 CCTGGCTTCTCTCAAACTCCTGG + Intronic
1044688958 8:94857619-94857641 CCTTGCGTCTTCCTAGCTTCTGG + Intronic
1044773337 8:95660913-95660935 TCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1044810774 8:96058972-96058994 CCTTGATTATCTCTGGCCTCAGG + Intergenic
1044959308 8:97515002-97515024 CCTTGCCTCTTCCTTGCTTCTGG + Intergenic
1045321752 8:101087015-101087037 CCATGCTTTCCCCTAGCTTCTGG + Intergenic
1046194319 8:110839005-110839027 CCTTGCCTCTTTCTAGCTTCTGG - Intergenic
1046313363 8:112467836-112467858 CATTGCTTCTTCCTAGTTTCTGG - Intronic
1047047740 8:121073687-121073709 CCTTGCCTCTTCCTATCTTCTGG - Intergenic
1047192222 8:122688496-122688518 ACTGGCTTCCCTTTAGCTTCAGG - Intergenic
1047284203 8:123472499-123472521 CCTTGCCTATCCCTAGTTTCTGG + Intergenic
1047388023 8:124427421-124427443 CCTTGCCTCTTCCTAGATTCTGG + Intergenic
1047619796 8:126594781-126594803 CCTTGGTTCTTCCTAGCTTCTGG - Intergenic
1047643299 8:126843834-126843856 CTTAACTACTCTCTAGCTTCTGG + Intergenic
1047669361 8:127127786-127127808 CCTTGCCTCTTTTTAGTTTCTGG - Intergenic
1047749613 8:127870318-127870340 CCTTGCCTCTTTCTGGCATCTGG - Intergenic
1047779979 8:128103122-128103144 CCTTGCCTCTTCCTAGTTTCTGG - Intergenic
1047941657 8:129832413-129832435 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1047957047 8:129984183-129984205 CCCTGCCTCTCTCTGGCTGCAGG + Intronic
1048048353 8:130794114-130794136 CCTTGCCTCTTCCCAGCTTCTGG - Intronic
1048176466 8:132156978-132157000 TCTTGCCTCTTCCTAGCTTCAGG - Intronic
1048217920 8:132513706-132513728 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1050092930 9:2033738-2033760 CCTTGCTGCTTCCTAGTTTCTGG + Intronic
1050598020 9:7223574-7223596 CCTTCCTTCTCTCTACCTGAAGG + Intergenic
1051369026 9:16342435-16342457 CCTTGCTTCACTCTCCCTCCAGG - Intergenic
1051686617 9:19664825-19664847 CCTTGCCTCTTCCTAGCTTCTGG - Intronic
1051745715 9:20292977-20292999 CCTTGCCTCTTCCCAGCTTCTGG + Intergenic
1052127721 9:24798437-24798459 CCTTGCCTCTTCCTAACTTCTGG + Intergenic
1052361677 9:27567877-27567899 CCTTGCCTCTTCCTGGCTTCTGG - Intronic
1052686770 9:31766479-31766501 TCTTGCTTCTCTCAACCTTTTGG + Intergenic
1052921338 9:33972509-33972531 CTTTGTCTCTCTCTAACTTCAGG - Intronic
1053098005 9:35345927-35345949 CCTTGTATATGTCTAGCTTCTGG + Intronic
1054741819 9:68813810-68813832 CCTTGCTACTTTTTAGCTTCTGG - Intronic
1055380235 9:75698747-75698769 CCTTGGCTCTTCCTAGCTTCAGG + Intergenic
1055710456 9:79055228-79055250 CCTTGCCTCTTCCTAGCTTCTGG - Intergenic
1055751709 9:79513855-79513877 CCTTGCCCCTCTCTTGCTTCTGG - Intergenic
1055897410 9:81194306-81194328 CCTTGCTTCCTTCCAGTTTCTGG - Intergenic
1056343573 9:85665347-85665369 CCTTGCTTCTTCCTAGCTTCTGG - Intronic
1056879702 9:90379517-90379539 CCTTGCCTCCTCCTAGCTTCTGG - Intergenic
1057540280 9:95961381-95961403 CCTTGCCTCTTTCTAGCTTCTGG - Intronic
1057991051 9:99770010-99770032 CCTTGCCTCTTCCTAGCGTCTGG + Intergenic
1058553372 9:106139516-106139538 CCTTGCTTCTTCCTAGCTTCTGG - Intergenic
1059199468 9:112400740-112400762 CCTTGCTTCTTCCCAGCTTCTGG + Intronic
1059263588 9:113004187-113004209 CTTTGCTTCTCCCTAGCTTCAGG - Intergenic
1059963778 9:119593365-119593387 CCTTGCCTCTTCCTAGATTCTGG - Intergenic
1060007984 9:120017239-120017261 CCTTGCCTCTCCCTAGCTTCCGG + Intergenic
1060923276 9:127437669-127437691 CCTTGCCTCTTTCTAGTTTCCGG + Intronic
1061247819 9:129410125-129410147 CCAGGCTTCTCTCCAGCTTCTGG - Intergenic
1061351009 9:130064879-130064901 CCTTGCCTCTTTCAAGCTCCTGG - Intronic
1062283703 9:135763567-135763589 CCATGCCTCTCTCCAGCTTCTGG + Intronic
1203660635 Un_KI270753v1:38774-38796 CCTTCCTCGTCTCCAGCTTCTGG - Intergenic
1203671808 Un_KI270755v1:21992-22014 CCTTCCTCGTCTCCAGCTTCTGG - Intergenic
1185609287 X:1385028-1385050 CCTGGCTGCTCTCGAGCTCCTGG - Intergenic
1186317648 X:8387991-8388013 CCTTCACTCTCTCTTGCTTCCGG + Intergenic
1186399422 X:9243003-9243025 CCATGCCTCTCTCCAGCTTCTGG + Intergenic
1186902175 X:14068461-14068483 CCTGGTCTCTTTCTAGCTTCTGG + Intergenic
1186961713 X:14743788-14743810 CCTTGCCTTTTCCTAGCTTCTGG + Intergenic
1187117669 X:16369880-16369902 CCTTGCGTCTTCCTAGCTTCTGG + Intergenic
1187299263 X:18031931-18031953 CCTTCCTTCACTGTGGCTTCTGG - Intergenic
1187548224 X:20274392-20274414 CCTTGCCACTTCCTAGCTTCTGG - Intergenic
1187928336 X:24271028-24271050 CTTTGCTTCTTTCTAGCTTCTGG + Intergenic
1188402011 X:29756999-29757021 CCTTGCCTCTTCTTAGCTTCTGG - Intronic
1188457474 X:30383042-30383064 TCTTGCTTCTTCCCAGCTTCTGG - Intergenic
1189136733 X:38558413-38558435 CCTTGCCTCCTCCTAGCTTCTGG + Intronic
1189246022 X:39564183-39564205 CCTTGCTTCTTCAGAGCTTCTGG + Intergenic
1189360777 X:40349207-40349229 CCTTGCCTCTTTCTAGTTTCTGG + Intergenic
1190461823 X:50684348-50684370 CCTTGATTCTTCCTAGCTTCTGG - Intronic
1190529074 X:51356805-51356827 CTTTCCTTTTCTCTAGCTTCAGG - Intergenic
1190947177 X:55107038-55107060 CCATTCTCCTCTCTACCTTCAGG - Intronic
1193405616 X:81097581-81097603 CCTTTTTTCTCTCTCTCTTCTGG - Intergenic
1193686497 X:84582734-84582756 CTTTGCCCCTTTCTAGCTTCTGG + Intergenic
1193800253 X:85926531-85926553 CCTTACTTCTCTGTGGTTTCTGG + Intronic
1193929767 X:87538771-87538793 CCTTCCTTCTCTTAAACTTCAGG + Intronic
1194091480 X:89584818-89584840 CCTTGGTTCTCATTAGCCTCGGG + Intergenic
1194140549 X:90203742-90203764 CCTTCTTTCTCTTTACCTTCTGG + Intergenic
1194372510 X:93091274-93091296 CCTTGCTTTTCTCAAGCTGAAGG + Intergenic
1194562372 X:95438437-95438459 CCTTGCCTCTGCCTAGTTTCTGG - Intergenic
1194890799 X:99376087-99376109 CCTTGGTTCTTCTTAGCTTCTGG + Intergenic
1196004963 X:110826127-110826149 CCTTGCCTCTTCCTAGCCTCCGG - Intergenic
1196051712 X:111312741-111312763 CCTTCCTTTTCTCTTGCTTTGGG - Intronic
1196657565 X:118234961-118234983 CCTTGCTTCCTCCTAGTTTCTGG + Intergenic
1196711536 X:118768786-118768808 CTTTGCCTCTTCCTAGCTTCTGG - Intronic
1196963842 X:121033663-121033685 CCTTGTCTCTTTCTAGCTTCTGG - Intergenic
1197683441 X:129411638-129411660 CTTTGCCTCTCCTTAGCTTCTGG - Intergenic
1197820746 X:130538605-130538627 CCTTGCCCGTTTCTAGCTTCTGG + Intergenic
1197931350 X:131699369-131699391 CCTTTCTTCTCTCTCCCTTATGG + Intergenic
1197977191 X:132178615-132178637 CCTTGTTTCTTTGAAGCTTCTGG + Intergenic
1198083080 X:133257395-133257417 CCCTGCTGGTCTCTAACTTCTGG - Intergenic
1198211335 X:134519142-134519164 CCTTGCTTCCTCCTAGATTCTGG + Intronic
1198659274 X:138949344-138949366 CCTTGCCTCTTCTTAGCTTCTGG + Intronic
1198769891 X:140119187-140119209 CCATGCTTGTCTCGAACTTCTGG - Intergenic
1199118460 X:144021095-144021117 CCTTGCCTCTCCTTAGCTTGCGG + Intergenic
1199726095 X:150582717-150582739 CCTTGCCTCTCCCTAGCTTCTGG - Intronic
1199791299 X:151157650-151157672 CCTTGCCTCTCCCTAGCTACTGG + Intergenic
1199903352 X:152199454-152199476 CCTTGCCTCTCCCTAGTTTCTGG - Intronic
1200411132 Y:2862752-2862774 CCTTCCTTCTGTCTGGCATCTGG + Intronic
1200444120 Y:3240880-3240902 CCTTGGTTCTCATTAGCCTCGGG + Intergenic
1200486288 Y:3772691-3772713 CCTTCCTTCTCTTTACCTTCTGG + Intergenic
1200486308 Y:3772847-3772869 CCTTCTTTCTCTTTACCTTCTGG + Intergenic
1200680549 Y:6205317-6205339 CCTTGCTTTTCTCAAGCTGAAGG + Intergenic
1201701598 Y:16888225-16888247 CCTGGCTGGTCTCAAGCTTCTGG + Intergenic
1201896174 Y:18994743-18994765 TGCTGCTGCTCTCTAGCTTCAGG - Intergenic