ID: 1152822031

View in Genome Browser
Species Human (GRCh38)
Location 17:82442335-82442357
Sequence AGGGCTGGTGGGTGGCAGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 683
Summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 612}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152822031_1152822051 24 Left 1152822031 17:82442335-82442357 CCCCGCTGCCACCCACCAGCCCT 0: 1
1: 0
2: 2
3: 68
4: 612
Right 1152822051 17:82442382-82442404 TGAGGGGAGAGCTCATGCCAGGG 0: 1
1: 0
2: 2
3: 20
4: 245
1152822031_1152822044 6 Left 1152822031 17:82442335-82442357 CCCCGCTGCCACCCACCAGCCCT 0: 1
1: 0
2: 2
3: 68
4: 612
Right 1152822044 17:82442364-82442386 GACGTTGCTCAGGACCCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 95
1152822031_1152822046 8 Left 1152822031 17:82442335-82442357 CCCCGCTGCCACCCACCAGCCCT 0: 1
1: 0
2: 2
3: 68
4: 612
Right 1152822046 17:82442366-82442388 CGTTGCTCAGGACCCCTGAGGGG 0: 1
1: 0
2: 2
3: 7
4: 84
1152822031_1152822050 23 Left 1152822031 17:82442335-82442357 CCCCGCTGCCACCCACCAGCCCT 0: 1
1: 0
2: 2
3: 68
4: 612
Right 1152822050 17:82442381-82442403 CTGAGGGGAGAGCTCATGCCAGG 0: 1
1: 0
2: 0
3: 28
4: 207
1152822031_1152822042 -4 Left 1152822031 17:82442335-82442357 CCCCGCTGCCACCCACCAGCCCT 0: 1
1: 0
2: 2
3: 68
4: 612
Right 1152822042 17:82442354-82442376 CCCTGGCAGGGACGTTGCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 119
1152822031_1152822045 7 Left 1152822031 17:82442335-82442357 CCCCGCTGCCACCCACCAGCCCT 0: 1
1: 0
2: 2
3: 68
4: 612
Right 1152822045 17:82442365-82442387 ACGTTGCTCAGGACCCCTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1152822031_1152822053 26 Left 1152822031 17:82442335-82442357 CCCCGCTGCCACCCACCAGCCCT 0: 1
1: 0
2: 2
3: 68
4: 612
Right 1152822053 17:82442384-82442406 AGGGGAGAGCTCATGCCAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 256
1152822031_1152822052 25 Left 1152822031 17:82442335-82442357 CCCCGCTGCCACCCACCAGCCCT 0: 1
1: 0
2: 2
3: 68
4: 612
Right 1152822052 17:82442383-82442405 GAGGGGAGAGCTCATGCCAGGGG 0: 1
1: 0
2: 0
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152822031 Original CRISPR AGGGCTGGTGGGTGGCAGCG GGG (reversed) Exonic
900210336 1:1452454-1452476 AGGGCTGGCAGGTGGCTGAGGGG + Intronic
900216139 1:1482634-1482656 AGGGCTGGCAGGTGGCTGAGAGG + Intronic
900223259 1:1520637-1520659 AGGGCTGGCAGGTGGCTGAGGGG + Intronic
900338636 1:2177306-2177328 AGGGGAGGTGGCTGGGAGCGGGG - Intronic
900417974 1:2543693-2543715 AGGGCTCGGGGCTGGCACCGAGG + Intergenic
900550621 1:3252613-3252635 GGGGCTGGTGGGCAGCAGGGTGG + Intronic
900597335 1:3487421-3487443 AGGGTGGGAGGGTGGCAGGGAGG + Intergenic
900610105 1:3541110-3541132 AGAGCTGGAGGGTGGCAGAGGGG - Intronic
900643774 1:3699535-3699557 AGGGCTGGAGTCTGGCATCGGGG - Intronic
900938892 1:5784939-5784961 GGGGGGGGTGGGCGGCAGCGTGG + Intergenic
901020710 1:6253951-6253973 GCTGCTGGTGGGCGGCAGCGTGG - Exonic
901026049 1:6279288-6279310 AGGGCCGATGGGTGGCACGGTGG + Intronic
901158231 1:7154915-7154937 CGGGCTTGTGGGTGCCAGCATGG + Intronic
902333621 1:15742807-15742829 GGGGCGGGAGGGAGGCAGCGAGG - Intronic
902670220 1:17968039-17968061 AGGGCTGGTAATTGGCAGGGAGG + Intergenic
903156396 1:21446535-21446557 AGGGAGGGTGGGTGGGAGGGAGG - Intronic
903366206 1:22806888-22806910 AGGGCTGGGGGGTGGTGACGAGG - Intronic
903606746 1:24580406-24580428 AGGGGTGGAGGGGGGCAGAGTGG + Intronic
903996477 1:27308053-27308075 AGGGAGGGTGGGAGGCAGGGAGG - Exonic
904005376 1:27360684-27360706 AGGTGCGGTGCGTGGCAGCGCGG - Exonic
904078471 1:27857252-27857274 GTGGCTGGTGAGTGGGAGCGGGG + Intergenic
904288038 1:29466064-29466086 TGGGTAGGTGGGTGGCAGTGGGG + Intergenic
904349524 1:29895870-29895892 AGGACAGCTGTGTGGCAGCGGGG + Intergenic
904788205 1:32998347-32998369 AGGGCAGGTGGGAGGCAGCAGGG - Intergenic
904829226 1:33295932-33295954 AGGGCTGTTGGCTGGCAGAGTGG + Intronic
905335308 1:37240818-37240840 AGGGCAGGAGGCTGGCAGGGAGG - Intergenic
905357314 1:37393837-37393859 AGAGCTGTTGGGAGCCAGCGAGG + Intergenic
906140434 1:43531099-43531121 GGGGCTGGTGGGGGGCCGGGGGG - Intronic
906202396 1:43968371-43968393 GGGGTGGGTGGGTGGCAGGGAGG + Intergenic
906241184 1:44243140-44243162 TGGGCTGGCAGGTGGCAGGGTGG - Intronic
906298237 1:44662292-44662314 AGGGCTGGCAGGTGTCAGCAGGG - Intronic
907119744 1:51998084-51998106 AGGGGTGGTGGGTGGTACCGGGG - Intergenic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
907848794 1:58234520-58234542 AAGGCAGGGGGCTGGCAGCGTGG + Intronic
907890289 1:58630709-58630731 AGGGCTGGTGAGGGGCTGAGAGG - Intergenic
907904616 1:58773093-58773115 ATGGCTGGAGAGTGGCAGCATGG + Intergenic
907968622 1:59358485-59358507 ATGGCGGGGGGGTGGCAGGGCGG - Intronic
908127325 1:61044061-61044083 GGGCCTGGTGGGTGACAGTGAGG + Intronic
908570563 1:65405965-65405987 ATGGGTGGCGGGTGGCAGCAGGG + Exonic
908827957 1:68151724-68151746 GGGGCTGGTGGGTGGTGGAGAGG + Intronic
910678944 1:89843392-89843414 CGGGCGGGTGGCTGGCAGCGAGG + Intronic
912501689 1:110126906-110126928 AGTGCTGCTGGGTGGCTGTGAGG - Intergenic
912631587 1:111251140-111251162 AGAGCTGCTGGGTGTCAGCTGGG - Intergenic
912746057 1:112246357-112246379 AGCCCTGATGGCTGGCAGCGAGG + Intergenic
912795146 1:112688874-112688896 AGGGCTCGAGGGAGGCAGGGCGG - Intronic
914200037 1:145476208-145476230 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914479155 1:148049343-148049365 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914813874 1:151048740-151048762 GGGGCTGGCGGGTGGCAGGCTGG - Exonic
914847097 1:151289306-151289328 AGGGCTGGTGGGGCGCAGGAGGG + Intronic
915393279 1:155562900-155562922 AGGGGTGGAGGGTGGTAGGGGGG - Intergenic
915932366 1:160068494-160068516 AGGACTGGGGGAAGGCAGCGGGG + Intronic
916169279 1:161988548-161988570 TGGGTGGGTGGGTGTCAGCGGGG - Intronic
916213942 1:162380331-162380353 AGGGCCTTTGGGTGGCAGGGAGG - Intronic
916412423 1:164559326-164559348 AGTGGGGGTGGGGGGCAGCGGGG + Intronic
916830432 1:168485391-168485413 GGGGGTGGTGGGGGGCGGCGTGG + Intergenic
916876082 1:168971099-168971121 AAGGATGGTAGGTGGGAGCGAGG + Intergenic
917799087 1:178553805-178553827 AGGTGTGGTGGGTGGAAGAGAGG + Intergenic
919568496 1:199218702-199218724 TGGTCTGGTGAGTGGCAGTGGGG + Intergenic
919756511 1:201069435-201069457 AGGGGTGCTGAGTGGCAGAGAGG + Intronic
919808181 1:201393102-201393124 TGGGCTGTTGGGTGGTAGTGGGG + Intronic
919922317 1:202174036-202174058 CAGGCTGGTGGGGGGCAGGGTGG + Intergenic
919974699 1:202602970-202602992 AGGGCTGTGGGGGGGCAGAGTGG - Intronic
920273945 1:204789963-204789985 GCTGCTGGTGGGTGGCAGGGAGG + Intergenic
920282409 1:204854081-204854103 AAGGCTGGTGGGTGGGGGTGGGG - Intronic
920385591 1:205568755-205568777 AGAGCGGGCGGGGGGCAGCGCGG + Intergenic
920645909 1:207804326-207804348 AGTGGTGGTGGGTGGGGGCGGGG - Intergenic
920704489 1:208241804-208241826 AATGCTGGTTGGTGGCAGCAGGG + Intronic
920929614 1:210374933-210374955 ACTGCTGGGGGGTGGCAGGGAGG - Intronic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
922584045 1:226720413-226720435 ACAGCTGATGGGTGGCAGAGAGG + Intronic
922664263 1:227455245-227455267 AGGGCAGGGGGGTGGCAGATGGG + Intergenic
923385262 1:233459842-233459864 AGGGCTGGTCAGAGGCAGAGGGG - Intergenic
923650198 1:235866735-235866757 GGGGCTGGTGGCTGTCAGCCTGG - Intronic
924583738 1:245344076-245344098 AGGGAGGGAGGGAGGCAGCGAGG - Intronic
1063367375 10:5499468-5499490 AGGGCCGGTGGGCAGCAGCTCGG - Exonic
1065426449 10:25609452-25609474 AAGGGTAGTGGGTGGCAGGGGGG - Intergenic
1066180524 10:32957743-32957765 AGCGCAGGTGGGAGCCAGCGAGG - Exonic
1067047073 10:42990851-42990873 AGGGCTGGTGGGGCTCAGAGAGG - Intergenic
1067568213 10:47353087-47353109 AGGGCATGTGGGTGGCAGACAGG + Intronic
1068616873 10:59128416-59128438 AGGGATGATGGCTGGCAGAGGGG - Intergenic
1068690028 10:59905809-59905831 TGGGCTGGAGGCTGGCGGCGTGG - Intronic
1069150543 10:64954080-64954102 AGGGCTGTTGGGGGGCACTGTGG - Intergenic
1069828797 10:71270365-71270387 AGGGAGGGTGGGAGGCAGGGAGG + Intronic
1069893302 10:71665325-71665347 AGGGGTAGTGGGAGGCAGTGGGG - Intronic
1069931969 10:71889080-71889102 AGGTCTGCTGGGACGCAGCGCGG + Intergenic
1070658224 10:78285765-78285787 TGGGGTGGTGGGTGGCAGGAAGG + Intergenic
1071986765 10:91059523-91059545 AAGGGTGGTGGGGGGCAGGGTGG - Intergenic
1072721210 10:97782071-97782093 AGGGCTGGTGGGGGGCCCAGTGG + Intergenic
1073578211 10:104642007-104642029 TGGGGGGGTGGGTGGGAGCGAGG + Intronic
1074143421 10:110696689-110696711 AGGGCAAGTGAGTGGCAGCAGGG + Intronic
1074382541 10:112992331-112992353 AGGGCTGGGGGGCGGAGGCGAGG - Intronic
1074594569 10:114849774-114849796 AGGGCTGGGGGTTGGCGGGGAGG - Intronic
1074864408 10:117536540-117536562 ATGGAGGGTGGGTGGGAGCGTGG - Intergenic
1075105629 10:119538414-119538436 ATGGAGGGTGGGAGGCAGCGAGG + Intronic
1075339322 10:121632990-121633012 AGCGCTGTTGGGCGGCAGGGAGG + Intergenic
1075483663 10:122802521-122802543 AGGGGTGGGGGGTGGCGGCGTGG + Intergenic
1075715390 10:124552360-124552382 AGGGGTGGGTGGTGGCAGGGTGG - Intronic
1076063588 10:127431163-127431185 AGGGCTGGTGGGTAGGAGTTGGG - Intronic
1076171319 10:128322518-128322540 AGGGCTGGTTGGAGGCAGAGTGG - Intergenic
1076380605 10:130022526-130022548 AGGGTGGGTGGGCTGCAGCGTGG - Intergenic
1076433282 10:130422455-130422477 AGGGCTGGTGGGGAGATGCGGGG + Intergenic
1076525939 10:131112408-131112430 AGGGCTTGTGGGAGGCACAGTGG - Intronic
1076535368 10:131173725-131173747 AGGGAAGGTTGGTGGCAGCTGGG + Intronic
1076543128 10:131227011-131227033 AGGGCTGGAGAGTGCCTGCGAGG - Intronic
1076765844 10:132632588-132632610 AGTGGTGGTGGGTGGAAGTGTGG - Intronic
1076788166 10:132761558-132761580 ATGGCTGGTGGGGGACAGCACGG + Intronic
1077089133 11:770486-770508 AGAGGTGGTGGGTGGCAGACAGG + Exonic
1077174078 11:1180880-1180902 AGGGGAGGTGGGTGCCAGAGTGG - Intronic
1077243919 11:1526753-1526775 GGGGCTGGTGGGTAGCTGTGTGG - Intergenic
1077315214 11:1916664-1916686 AGGGCTGGTCGGGGGCGGGGTGG - Intergenic
1077317033 11:1924209-1924231 AGGGTTGGGGGGTGGCATGGAGG - Intronic
1077384002 11:2260511-2260533 CTGGCTGGTGGGGGGCAGAGCGG - Intergenic
1077384496 11:2262651-2262673 AGGGCTGGGGGTTCGCAGCTAGG - Intergenic
1078359418 11:10656920-10656942 AAGGATGGTGGGAGGCAGAGGGG + Intronic
1078518699 11:12046716-12046738 AAGGCTGGAGGGTGGGAGAGGGG + Intergenic
1079063119 11:17266942-17266964 GGAGCTGGTGGGTGGGAGTGGGG + Intronic
1079470795 11:20775623-20775645 ATTGCTGGTGGGTGGCAGTGTGG + Intronic
1080503624 11:32892718-32892740 GGGGCTGGCGGGCGGCCGCGAGG - Intergenic
1083298131 11:61726174-61726196 AGGGCTGGTGGGAAGGAGCTGGG + Intronic
1083363739 11:62128992-62129014 AGGGGTGGTGGGTACCACCGCGG + Intronic
1083721604 11:64606436-64606458 AGGGGTGGGGGGTGGGAGGGAGG - Exonic
1084188252 11:67486786-67486808 ACGGCTAGTGGGTGGCTGAGTGG - Intronic
1084267072 11:68010578-68010600 AGATCTGGGGAGTGGCAGCGAGG + Intronic
1084269466 11:68021328-68021350 TGGGCTGCAGGGTGGCAGTGAGG + Intronic
1084453015 11:69251184-69251206 AGGGCAGGTGGGAGGCGGTGGGG + Intergenic
1084569284 11:69949747-69949769 AGGGCTGGAAGGAGGCAGGGAGG + Intergenic
1086681807 11:89681868-89681890 GGGGGTGGTGGGGGGCAGGGAGG + Intergenic
1087105226 11:94401387-94401409 CGGGCTGGTGGCGGGCGGCGCGG - Exonic
1088080582 11:105906957-105906979 AGGTCTGGTGTGTGGCAAGGAGG - Intronic
1089203452 11:116739626-116739648 AGTGCTGGTTGGGGGCAGGGTGG - Intergenic
1089262641 11:117232894-117232916 CGGGGGGGTGGCTGGCAGCGGGG + Intronic
1089384893 11:118060939-118060961 AGGGCTGGAGAGGGGCAGCCTGG - Intergenic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089814814 11:121162762-121162784 AGGGCAGGTGGAAGGCAGAGCGG + Intronic
1090345243 11:126063586-126063608 AGGGCGGGTGGGTGGTGGTGGGG - Intergenic
1091586769 12:1821266-1821288 TGGGGTGGAGGGTGGCAGGGAGG + Intronic
1091751939 12:3027992-3028014 AGGGCTGGGGGGTAGGAGTGGGG - Intronic
1092019443 12:5188646-5188668 AGGCCTGGTGGGTGGCTGGATGG + Intergenic
1092136800 12:6155161-6155183 AGGGGTGGCGGGTAGCACCGAGG + Intergenic
1092146271 12:6216783-6216805 AAGGCGGCTGGGTGGCAGCGGGG - Intronic
1092894588 12:13000223-13000245 AGGGCGGCAGGGTGGCAGGGCGG + Exonic
1093269662 12:17044536-17044558 AGGGATGGGGAGTGGCAGCGAGG + Intergenic
1095570809 12:43683451-43683473 AAGGCTGGGGGGTGGTGGCGGGG - Intergenic
1096224104 12:49853858-49853880 GGGGTTAGTGGGTGGCAGAGGGG + Intergenic
1096584411 12:52610599-52610621 AGTGCAGGTGGGTGGGACCGAGG - Exonic
1098450114 12:70610071-70610093 GGGGCTGGGGCGAGGCAGCGCGG - Intronic
1098704053 12:73665048-73665070 TAGGCTGGTGCGTGTCAGCGGGG - Intergenic
1101842664 12:108339458-108339480 TGGGCTTGTGGGTGGCGGCGGGG + Intergenic
1101940059 12:109093246-109093268 AACACTGGTGGGGGGCAGCGAGG - Exonic
1102234340 12:111284963-111284985 AGGGCTGGTGCAGGGCAGCCTGG - Intronic
1102235761 12:111293577-111293599 AGGGAAGGTGGGTGGGAGGGAGG + Intronic
1102278129 12:111598659-111598681 TGGGCTGGGGGCCGGCAGCGCGG - Intronic
1102299312 12:111759397-111759419 AGGGGTGGTGGTTGGGAGGGGGG + Intronic
1102495561 12:113316718-113316740 AGGACTGGTGGGATGGAGCGGGG - Intronic
1103330397 12:120150121-120150143 AGGGGTGGGAGGTGGCAGGGAGG - Intronic
1103358966 12:120342510-120342532 AGGGCTGGAGGGAGGCGGCCAGG + Exonic
1103410854 12:120710528-120710550 GGGGCTGGTGGCTGGCAAGGAGG + Exonic
1103905499 12:124325464-124325486 AGGCGTGGTGGGGGCCAGCGAGG + Exonic
1104013931 12:124950133-124950155 AGGGCAGGTAGGTGGCACAGCGG - Exonic
1104102312 12:125624280-125624302 AGTGCTGGTGAGGGGCAGAGAGG + Intronic
1104639197 12:130456577-130456599 TGACCTGCTGGGTGGCAGCGCGG - Exonic
1104642848 12:130478459-130478481 AGTGCTGCTGTGTGGCAGTGGGG - Intronic
1104680550 12:130748262-130748284 AGGGCTGGTGCGAGCCAGCCTGG - Intergenic
1104847785 12:131855465-131855487 AGGCCAGGAGGGTGGCAGGGAGG - Intergenic
1104866992 12:131961563-131961585 AGGGCTGGTGGGCGGGGGTGGGG - Exonic
1104885541 12:132104931-132104953 AGGGCTGGTGGGCGGGGGTGGGG - Exonic
1104932002 12:132344936-132344958 AGGGGAGGTGGGAGGGAGCGGGG - Intergenic
1105034243 12:132907453-132907475 AGGGACGGCGGGTGGCAGCCAGG - Intronic
1106104473 13:26722153-26722175 CGGGTGGGTGAGTGGCAGCGAGG - Intergenic
1106994001 13:35459323-35459345 AGGGCTGGTAGGTGGAAGAGGGG + Intronic
1107058513 13:36131217-36131239 AGGGCTGGGGGGCGGCGGCGGGG + Exonic
1107468084 13:40666789-40666811 TGGGCTGGTGGGGGGTAGTGGGG + Intergenic
1107566730 13:41612820-41612842 ATGGCTGGTGGGTTGGAGCCAGG - Intronic
1107995240 13:45852773-45852795 AGGGCTGGTGGGTGGGCGGGAGG + Intergenic
1108304179 13:49114408-49114430 AGGGGTGGTGGGGGGCGGGGAGG - Intronic
1108530735 13:51324973-51324995 TGGGCTGGTGGGGGGCACGGTGG - Intergenic
1108704890 13:52976039-52976061 AGGGTTGGTGGCAGGCAGCTGGG + Intergenic
1112223627 13:97515808-97515830 AAGGCCTGTGGGTGGCAGCAGGG - Intergenic
1112375698 13:98838189-98838211 ACAGCTGGTGAGTGGCAGAGTGG - Intronic
1113605187 13:111599942-111599964 AGGGCTCGGGGGTGGCAGGCTGG + Intronic
1113618453 13:111697196-111697218 AGGGCTGGGAGGTTGCAGGGAGG - Intergenic
1113623982 13:111782457-111782479 AGGGCTGGGAGGTTGCAGGGAGG - Intergenic
1113852298 13:113424740-113424762 AGGGCAGGTAGGTAGAAGCGTGG - Intronic
1113852630 13:113426479-113426501 AGAGCTGGAGGGCTGCAGCGGGG + Intronic
1113941203 13:114019414-114019436 AGGGCTCCTGGGTGACTGCGTGG - Intronic
1114029280 14:18561731-18561753 AGGACTGATGGGTGGCAGTCTGG - Intergenic
1114267573 14:21081840-21081862 AGGGCTGCTGGGGAGCAGCAAGG - Exonic
1114416120 14:22545862-22545884 GGGGCTGGTGGGTGTCAGACTGG - Intergenic
1114476116 14:22996113-22996135 AGGGCGGGGTGGTGGCAGCTTGG + Exonic
1116243541 14:42379073-42379095 TAGGCTGGTGCGTGGCAGTGGGG - Intergenic
1116385941 14:44330001-44330023 TGGGCTGCTGGGTGGCAGCAAGG + Intergenic
1117791231 14:59344044-59344066 AAGGCCTGGGGGTGGCAGCGGGG + Intronic
1117986006 14:61386740-61386762 AGTGCTGGTGGGAGGCAGGGAGG + Intronic
1118819530 14:69336045-69336067 AGGGCAGGGGTGTGGCTGCGGGG - Intronic
1119167340 14:72505687-72505709 ACAGCTGGTAGGTGGCAGCCAGG - Intronic
1119406186 14:74401213-74401235 AGGGCTGGGGTGAGGCAGCAGGG - Intergenic
1119480872 14:74956824-74956846 GGGGCTGGTGGGTGGCTGTGGGG + Intergenic
1119646157 14:76350072-76350094 CAGGTTGGTGGGTGGCAGCAAGG - Intronic
1120462694 14:84817511-84817533 ATGACTGGTGGCTGGCAGCTGGG + Intergenic
1121538938 14:94710913-94710935 AGAGCAGGTGGGTGGCCACGGGG + Intergenic
1122113717 14:99517669-99517691 AGGGCTGGGAGGTGGCAGCTGGG - Intronic
1122254110 14:100464124-100464146 AAGGCTGGGGGTTGGCAGGGAGG - Intronic
1122306699 14:100771008-100771030 AGGTTTGGTGGGAGGCAGTGAGG + Intergenic
1122329225 14:100901775-100901797 AGGGCTGGTGGGGGGAGGTGGGG - Intergenic
1122438770 14:101716215-101716237 AGGGCCGGTGGGGGGCAGCATGG + Intergenic
1122609206 14:102969703-102969725 GGGGCTGGAGGGTAGCAGGGAGG - Intronic
1122731371 14:103801211-103801233 AGGGCTGGTGTTGGGCAGTGGGG - Intronic
1122770012 14:104093704-104093726 AGGGCTGTTGGGTGTGAGTGGGG + Intronic
1122957100 14:105075952-105075974 AGGGCTGGCGGCTGGGAGGGTGG + Intergenic
1124100319 15:26686976-26686998 AGAGCTGGCGGGTGGCTGCGTGG - Intronic
1124589514 15:31040796-31040818 AGGGCTGGTGGGTGCCGGCTAGG + Intronic
1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG + Intronic
1125479212 15:40069176-40069198 AGGGCTGGGAGGCGACAGCGGGG - Intergenic
1126067423 15:44836946-44836968 GGGGGTGGTGGGTGGCAGCTGGG - Intergenic
1126092454 15:45063935-45063957 GGGGGTGGTGGGTGGCAGCTGGG + Intronic
1126456687 15:48870241-48870263 AAGGATGGTGGCTGGCAGGGAGG - Intronic
1127728924 15:61780212-61780234 AGTGCTGCTGGGTGGTAGGGAGG + Intergenic
1128119423 15:65134681-65134703 AGGGGGGGTGGGGGGTAGCGGGG - Intergenic
1128317539 15:66670544-66670566 AGGGGTGGTGGGAGGCAGGCGGG + Intronic
1128943660 15:71807765-71807787 GGGGCTGAGGGGTGGCAGGGAGG - Intronic
1129051210 15:72783509-72783531 AGGGCCGGTTGGCGGCAGCCTGG - Exonic
1129472332 15:75762650-75762672 AGGGTTGGTGGGAGGCAGCTGGG - Intergenic
1129672259 15:77613885-77613907 AGGGCTGGCGGGGGGCAGCAGGG + Exonic
1129750541 15:78059764-78059786 AGAGCTGGTGGGAGGCTGAGGGG - Intronic
1129893872 15:79089839-79089861 AGGGCTGGGCGGTGGGAGTGGGG + Intronic
1130051135 15:80484828-80484850 AGGGGTGTAGGGAGGCAGCGGGG + Intronic
1130167117 15:81472801-81472823 AGGGTTGGTGGGGGCCAGGGAGG + Intergenic
1131144035 15:90000431-90000453 AGGCGTGGTCGCTGGCAGCGCGG - Intergenic
1131873021 15:96779983-96780005 AGGGCTGGAAGGTGGGAGAGAGG + Intergenic
1131986926 15:98051964-98051986 AGGGCTGGGAGGTAGCAGCATGG + Intergenic
1132287038 15:100670918-100670940 AGGGCTGGGGTGAGGCAGCCCGG - Intergenic
1132761813 16:1512154-1512176 AGGGGTGGTGGGGGGCAGGATGG + Intronic
1132788278 16:1670363-1670385 GGGGGTGGGGGATGGCAGCGAGG + Intronic
1132806342 16:1776853-1776875 AGGTCTTGTGGGAGGCTGCGAGG - Exonic
1132810383 16:1794157-1794179 AGGGCGGGTGGATGGCTGGGTGG - Intronic
1133209836 16:4257460-4257482 GGGGCTGGGGGGTGGGAGAGTGG + Exonic
1133339685 16:5028244-5028266 AGGGGTGGTTGGGGGCAGCCTGG - Intronic
1133782175 16:8948025-8948047 AGAGGTGGTGGGTGGGAGTGGGG - Intronic
1134135648 16:11674787-11674809 TGGGCAGGTGGGAGGCAGGGAGG - Intronic
1134411158 16:14004067-14004089 AGGACTGGTGGGAGGCAGGCAGG + Intergenic
1134532862 16:14998399-14998421 AGGGCAGGTAGGTGGCACTGAGG + Exonic
1135867806 16:26120574-26120596 AGAGCTGGTGCGTGGCAGTGTGG + Intronic
1136382061 16:29900383-29900405 ACGGCTGGAGGCTGGCACCGTGG + Intronic
1137561461 16:49504995-49505017 AGGGCAGGTGGGAGGCAGGAAGG + Intronic
1137667345 16:50259436-50259458 AGGGCTTTTGGTTGGCAGGGCGG + Intronic
1137676974 16:50308595-50308617 AGGGCTGGTCGCTGGCAGCCTGG - Intronic
1138106015 16:54287403-54287425 GGGGCTGAAGGGTGGCAGCCCGG + Intergenic
1138370734 16:56524525-56524547 AGGCCTGGAGGGAGGCAGCGTGG + Intergenic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1138972969 16:62169438-62169460 AGGGAGGGTGTGTGGCAGGGAGG + Intergenic
1139361278 16:66401726-66401748 AGGGTTGCCGGGAGGCAGCGTGG + Intronic
1139375719 16:66495291-66495313 AGGGAGGGTGGGAGGCAGGGAGG - Intronic
1139440082 16:66962196-66962218 ATGGCTGGTGGATGGCAGCCAGG + Intronic
1139441738 16:66971435-66971457 AGGTTTGGTGGGGGGCAGTGGGG - Intronic
1139507429 16:67406159-67406181 AGGGCTGGTGTGTGGAAGTGGGG - Intronic
1139666333 16:68459464-68459486 AGAGCTGGTCGGTGGGAGGGTGG + Intergenic
1139863176 16:70042335-70042357 AGGGCAGGTAGGTGGCACTGAGG - Intergenic
1140411735 16:74745187-74745209 AGGGCTGTTGAGTGGCAAGGGGG + Intronic
1141096582 16:81167414-81167436 AGGGCTTCTGGGAGGCAGTGTGG - Intergenic
1141152555 16:81574291-81574313 AGGGCTGAGAGGTGGCAGGGTGG - Intronic
1141605899 16:85153000-85153022 AAGGCTGGTGGGTGGGCACGGGG + Intergenic
1141722740 16:85765913-85765935 AGGGAAGGTGGGTGGGAGCCTGG - Intergenic
1142194311 16:88732575-88732597 AGGGCTGGTGGGCGGCTGGGCGG - Intronic
1142204583 16:88776784-88776806 AGGGGCCGTGGGTGGCAGAGAGG - Intronic
1142278204 16:89133919-89133941 AGAGCAGGAGGGTGGCAGTGGGG - Intronic
1142613840 17:1123973-1123995 AGGGCTGGCGGGGGGCAGGTGGG - Intronic
1142769481 17:2086294-2086316 AGGAGTGGAGAGTGGCAGCGAGG - Intronic
1142785167 17:2215852-2215874 AGGGTGGGTGGGGGGCGGCGAGG + Intronic
1142809254 17:2387531-2387553 GGTGCTGGGGGGTGGCAGGGTGG + Exonic
1143024039 17:3930479-3930501 GGGGCTGGTGGGTGGGAGGAGGG + Intronic
1143032012 17:3973153-3973175 AGGGCTGGATGGTGGCTGAGAGG - Intergenic
1143270654 17:5672392-5672414 GGGGCTTGTGGGTGGCTGCCTGG + Intergenic
1143513399 17:7407789-7407811 AGGGCTGCTGGGTGGGAGTGGGG + Intronic
1143520811 17:7443229-7443251 AGGGCATGTGTGTGGCAGCAGGG - Exonic
1143568547 17:7740091-7740113 AGGGGAGGGGGGTGGCAGCTTGG + Intronic
1143891601 17:10106612-10106634 AGGGTGTGTGGGTGGGAGCGAGG - Intronic
1143901937 17:10181049-10181071 GGGGGTGGGGGGTGGCAGTGCGG + Intronic
1144365531 17:14540959-14540981 AGTCCTGGTGGGTGGGGGCGGGG + Intergenic
1145249498 17:21289505-21289527 AGGGCTGCTGGGCAGCAGCATGG + Intronic
1146454368 17:32997565-32997587 AGGACTGGTGGGCAGCAGCAGGG + Intronic
1147254878 17:39175530-39175552 CGGCCTGGTGGGTGGCTGCTGGG + Exonic
1147316197 17:39621613-39621635 AGGGCAGGTGGGTGGGGGCAGGG - Intergenic
1147357256 17:39907789-39907811 AGAGCTAGTGAGTGGCAGGGTGG + Intronic
1147741558 17:42673462-42673484 AGCGCTGGGGGGTGGCATTGCGG - Exonic
1148018116 17:44536753-44536775 AGGGCAGCTGGGTGGCCACGAGG + Intergenic
1148215031 17:45829730-45829752 AGGGCTGGAGGCTGGGAGCAGGG + Intronic
1148219371 17:45850991-45851013 ACCGCTGGCAGGTGGCAGCGTGG - Intergenic
1148242454 17:46009567-46009589 AGGGCTGGTGGGTGGATGGAAGG + Intronic
1148866030 17:50629149-50629171 TGGGCTGGTGGTCGGGAGCGGGG - Intergenic
1149853047 17:60052840-60052862 GGGGCTGGTGAGGGGCGGCGGGG + Intronic
1150411036 17:64940759-64940781 AGGGCTGGTGAGGGACAGAGGGG + Intergenic
1151257605 17:72891093-72891115 GGGGGTGGGGGGTGGCAGGGCGG + Intronic
1151771029 17:76161800-76161822 GGGACTGGTGGGTGGGAGAGGGG - Intronic
1151921996 17:77163939-77163961 TGGGCTCCTGGGTGGCAGCCAGG + Intronic
1152011698 17:77723000-77723022 AGAGCCGTTGAGTGGCAGCGTGG - Intergenic
1152482045 17:80560745-80560767 AGTGCTGGGGAGTGGCAGTGTGG - Intronic
1152632552 17:81417073-81417095 AGGGCAGGTGGGTGTCCACGTGG + Intronic
1152714266 17:81891151-81891173 GGGGGTGGTGGGCGGGAGCGAGG - Intronic
1152750250 17:82059262-82059284 TGGCCTGGTGGGGGGCAGTGTGG + Intronic
1152783134 17:82235267-82235289 AGGGCCGGTGGGAGGCAAGGGGG + Exonic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1153031000 18:712657-712679 AGGGCGGGAGGGCGGGAGCGCGG + Intronic
1153754078 18:8262494-8262516 AGGCCTGGAGGATGGCAGGGTGG - Intronic
1154204713 18:12326903-12326925 AGGGGTGCTGGGTGGGAGCTGGG + Intronic
1154348433 18:13563646-13563668 AGGACTGGAGGATGGCAGCTAGG + Intronic
1155399567 18:25423047-25423069 AGGGTGGGAGGGTGGGAGCGGGG + Intergenic
1155671751 18:28379947-28379969 AGAGCTTGTGGGAGGCAGGGTGG + Intergenic
1156455184 18:37289175-37289197 AGGGATGGGGGCTGGCAGAGGGG + Intronic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157915904 18:51663707-51663729 AAGGGTAGTGGGTGGCAGGGTGG - Intergenic
1158422546 18:57308401-57308423 AGGGCTGGTGGGGGGAATTGGGG + Intergenic
1158586011 18:58735669-58735691 AGGGTGGGTGGGTGGCATGGAGG + Intronic
1159906061 18:74093339-74093361 GTGGCTGGTGCGTGTCAGCGAGG + Intronic
1160051845 18:75440978-75441000 AGGGATGGAGGGTTGCAGCGGGG + Intergenic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160167828 18:76529585-76529607 AGTGCAGGAAGGTGGCAGCGGGG - Intergenic
1160552682 18:79705088-79705110 AGGGCTGTTGGGTGGGGCCGCGG + Intronic
1160793815 19:934722-934744 AGGGATGGTCGTGGGCAGCGGGG + Intronic
1160858573 19:1228119-1228141 GGAGCTGCTGGGTGGCAGGGGGG + Exonic
1160877193 19:1302203-1302225 AGGGCTGGGAGGGGGCAGCTGGG + Intergenic
1161125059 19:2551130-2551152 AGTGCTGGCTGATGGCAGCGTGG - Intronic
1161200200 19:3010437-3010459 AGGGCTGGAGGTTGGCAATGGGG - Intronic
1161223979 19:3133857-3133879 TGGGCTGGTGGCTGGCAGCTTGG - Intergenic
1161343277 19:3754101-3754123 GGGGCCTGTGGGTGGCGGCGTGG + Exonic
1161469431 19:4448894-4448916 AGGGATGGCAGGTGGCAGAGAGG + Intronic
1161684194 19:5695047-5695069 GGGCATGGTGGGTGGCAGGGCGG - Intronic
1161723267 19:5915140-5915162 CGGGCAGGTGGGTGGCTGCGCGG + Exonic
1161838249 19:6662454-6662476 ATAGCTGGTGAGTGGCAGAGTGG + Intronic
1161857477 19:6773845-6773867 AGGGCTGCTGGGTGGGAACGGGG + Intronic
1161932273 19:7348954-7348976 AGGGCTGAGGGGTGGGAGCAGGG + Exonic
1161960306 19:7519620-7519642 AGACCTGGGGGGTGGCAGTGAGG - Exonic
1161978216 19:7617688-7617710 GGGGCTGGTGGGTGGGTGGGTGG + Intronic
1162300551 19:9842532-9842554 CGGGCTGTGGGGTGGCAGCAGGG - Intronic
1162762519 19:12897090-12897112 AGGCCTGGTGGGTGGGGGCTGGG - Intronic
1163034271 19:14562377-14562399 AGGGCTGGTGGCAGGCGGCATGG + Intronic
1163268686 19:16236161-16236183 AGGCCCCGGGGGTGGCAGCGAGG - Intronic
1163567953 19:18062846-18062868 AGGGTTGGTGGGGGGCAGGCAGG - Intronic
1163673700 19:18644724-18644746 GGGGCTGCTGGGGGGCAGTGGGG + Intronic
1165729543 19:38135927-38135949 CGGCCTGGCTGGTGGCAGCGAGG - Intronic
1165742386 19:38211759-38211781 GGGGGTGGTGGGTGCCAGCCAGG - Exonic
1166113966 19:40641468-40641490 AGTGCTTGTGGGTGGCTGGGTGG + Intergenic
1166358997 19:42244255-42244277 TGGGGTGGTGGGGGGTAGCGGGG + Intronic
1166916114 19:46196968-46196990 AGGGCAGGTGGGTCCCAGCCTGG - Intergenic
1166939887 19:46356130-46356152 AGGCCTGGCGGATGGCAGGGAGG + Intronic
1167129097 19:47572839-47572861 AGGGCCTGTGGGGTGCAGCGGGG + Intergenic
1167602897 19:50464938-50464960 GGGGCAGGTGGGTGGGAGCATGG - Intronic
1167982147 19:53284232-53284254 AGGCCTGTTGGCTGGCAGCCTGG - Intergenic
1167983997 19:53299741-53299763 AGGCCTGTTGGCTGGCAGCCTGG + Intergenic
1168404366 19:56103088-56103110 GGGTCAGGTGGGAGGCAGCGGGG + Intronic
1168654622 19:58118218-58118240 GGGGCTGGGCGGTGGCTGCGTGG - Intronic
925112408 2:1347399-1347421 AGGGCTGGTGAGGGTCAGCTGGG - Intronic
925405057 2:3600652-3600674 AGGGCGCGTGGATGGGAGCGGGG + Intronic
928593923 2:32842919-32842941 GGGGCAGGTGGGTGGCGGGGCGG - Intergenic
928793857 2:34992144-34992166 AGGGCTGGTGGGTGCCTGCTGGG + Intergenic
929916237 2:46138370-46138392 ATGGCTGGTAAGAGGCAGCGTGG - Intronic
932571079 2:72938690-72938712 AGGGCTGGCTGCAGGCAGCGTGG - Intergenic
932591616 2:73071093-73071115 AGGGCTGGGGAGTGACCGCGGGG + Intronic
932597265 2:73101802-73101824 AGGGGTGGTGGGTGTCAGGCTGG - Intronic
932696495 2:73961203-73961225 AGGGCTGGGAGTTGGCAGCAGGG - Intergenic
932702248 2:73999975-73999997 AGGGCTGCTGGAAGGCAGGGTGG + Intronic
932736891 2:74260591-74260613 AGGGCTGGTGGATGGGAGGGAGG - Intronic
933729171 2:85444513-85444535 AGGGCTGGTGGGGGGCATCGGGG - Intergenic
933779843 2:85794049-85794071 AGGGCTGGGGGGAGGCAGGGAGG - Intergenic
935247109 2:101228272-101228294 ACGGATGGTGGGGGGCAGAGAGG - Intronic
935292558 2:101622522-101622544 GGGGGCGGTGGGTGGCAGGGGGG - Intergenic
936400406 2:112160308-112160330 AAGCCTGGTTGGTGGCAGTGGGG + Intronic
937017594 2:118619938-118619960 GGGGCTGCTGGGTGACAGCAGGG - Intergenic
937236985 2:120437029-120437051 AGGGCTGGGGGAAGGCAGCAGGG + Intergenic
937249961 2:120517392-120517414 ACAGCTGGTGGGAGGCAGCATGG - Intergenic
937264394 2:120606916-120606938 AGTCCTGGTGGGTGGTAGGGAGG - Intergenic
937275077 2:120679071-120679093 GGGGCAGGTGGGTGGAAACGAGG - Intergenic
937335435 2:121059484-121059506 AGGGCTGGGGGGCGGCAGAGGGG + Intergenic
937917690 2:127107002-127107024 GGGGCTGGGGGCTGGGAGCGCGG - Exonic
938104248 2:128519569-128519591 AGGACTGGTGGGAGGCAAGGGGG - Intergenic
938540501 2:132280499-132280521 GGGGCTTGGGGGGGGCAGCGGGG + Intergenic
939629701 2:144516992-144517014 GGGGCTCGAGGGGGGCAGCGGGG + Intronic
940774877 2:157875697-157875719 AGGGATCGGGGGTGGCAGGGTGG - Intronic
943349196 2:186778295-186778317 AGGGCTGGAGAGTGGGAGTGGGG + Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
945141661 2:206693159-206693181 AGGCCAGGTGAGTGGCTGCGAGG - Exonic
945561822 2:211349044-211349066 AGGGCAGGGTGGTGGCAGAGTGG + Intergenic
946056808 2:216909985-216910007 AGGGATGGTGGGAGGCAGACTGG - Intergenic
946397127 2:219448805-219448827 AGGGCGGCTGGGCGGCGGCGGGG - Exonic
946588402 2:221216420-221216442 AGGGCTGAAGAGTGGCAGCTGGG - Intergenic
946760406 2:222988141-222988163 ATGGCTAGTGGGGGGGAGCGGGG + Intergenic
947918134 2:233847914-233847936 AGGGCTGGTGGGTGCCATACTGG + Intronic
948255275 2:236563895-236563917 AGGGCTGCTGGGTGGTAGGAGGG - Intergenic
948478728 2:238237645-238237667 AGGGATGGAGGGTGGCAGGATGG - Intergenic
948640352 2:239372016-239372038 AGGGCGCGTGGGTGGCTGCTCGG + Intronic
948687397 2:239677691-239677713 AGGGCTGGTGTGGGACAGAGAGG - Intergenic
949042199 2:241854579-241854601 AGGGCTCCTGGGAGGCAGCCTGG + Intronic
1168803854 20:661815-661837 AGGGATGGTGGGAGGGAGAGGGG - Exonic
1168803946 20:662134-662156 CGGGCGGGTGGCTGGCAGCCCGG + Exonic
1169106935 20:3004520-3004542 AGGACTGGTGGGTGGGTGGGAGG - Intronic
1169267007 20:4172794-4172816 AGGGTGGGTGGGTGGGAGGGGGG + Intronic
1169365271 20:4987068-4987090 AGGGCTGCAGGTGGGCAGCGTGG + Intronic
1170816656 20:19720100-19720122 AGGTCTGCTGGGTGGCACTGGGG - Intronic
1170950743 20:20933713-20933735 AGGGAAGGTGGGAGGCAGCGAGG + Intergenic
1171012087 20:21514323-21514345 AGGGCCGTTGGCTGGGAGCGCGG - Intergenic
1171204278 20:23266948-23266970 AGGGGCGGTGGGAGGCAGAGAGG + Intergenic
1171351292 20:24505154-24505176 AGGGTAGGTAGGTGGCACCGCGG + Intronic
1171460089 20:25293157-25293179 GGGGTTGGGGGGTGGCAGAGGGG + Intronic
1171846682 20:30281643-30281665 AGCGCTGCGGGGTGGCAGCGAGG - Intergenic
1172192648 20:33071202-33071224 AGGGGTGGTTGGGGGTAGCGGGG + Intronic
1172587357 20:36093847-36093869 AGGTCTGGTGGGGGGCTGGGGGG - Intronic
1172644223 20:36460017-36460039 AGGGCTGGTGAGTCCCAGAGAGG + Intronic
1172753477 20:37267681-37267703 CGGGCTGCTTGGTGGCAGCCTGG + Intergenic
1172970645 20:38870848-38870870 AGGGCTGGAGGGTTGGGGCGTGG + Intronic
1172989734 20:39025434-39025456 TGGGCTGGTGCGAGGCAGTGTGG + Intronic
1173249047 20:41354920-41354942 GGTGCAGGTGGGTGGCAGGGAGG + Intronic
1173253145 20:41375174-41375196 AGGGCAGGTGGGTGGGACCCGGG - Intergenic
1173461037 20:43243553-43243575 AGGGCAGTGGGGTGGCAGTGGGG - Intergenic
1174506813 20:51022675-51022697 ACCGCTGGTGCGTGGCGGCGTGG - Intronic
1174767665 20:53269130-53269152 AGGGGTGGGGGCTGTCAGCGTGG + Intronic
1175268926 20:57720162-57720184 TGGGCTGGTGGGGGGCAGTGCGG + Intergenic
1175490180 20:59375088-59375110 AGGGCAGGTGGGTGGGAGAAAGG - Intergenic
1175828758 20:61950945-61950967 AGGGCTGGTGGGAGGGAGGGTGG - Intergenic
1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG + Intergenic
1176090208 20:63315246-63315268 AGGCCTTGTGGGTGGCAGATGGG + Intronic
1176703757 21:10093221-10093243 AGGGGTTGGGGGTGGCAGGGGGG + Intergenic
1176882585 21:14215977-14215999 AGGGCTGGGCGGTGGGAGAGTGG - Intergenic
1177046893 21:16182535-16182557 AGGGATGGAGGGAGGCAGGGAGG - Intergenic
1178935234 21:36856052-36856074 AGGGCTGGTGGGTGGGGGGCAGG + Intronic
1178958115 21:37041649-37041671 GGGGATGGTGGGTGGCAGTGAGG - Intergenic
1179874512 21:44261391-44261413 TGGGCAGGTGGGTGTCACCGCGG - Intronic
1180088258 21:45517812-45517834 AGGGAGGGTGGGTGGCTGGGTGG - Intronic
1180096246 21:45556403-45556425 GGCGCTGGTGGGGAGCAGCGGGG - Intergenic
1180182731 21:46125097-46125119 GGGGGAGGAGGGTGGCAGCGAGG + Intronic
1180453395 22:15488794-15488816 AGGACTGATGGGTGGCAGTCTGG - Intergenic
1181166627 22:20987468-20987490 AGGGGTGGTGAGAGTCAGCGGGG - Intronic
1181831776 22:25565330-25565352 AGGGCCGGTGGGGGGCACCCCGG + Intronic
1182250657 22:28997399-28997421 AGGGTTGGGGGGTGGGAGTGGGG + Intronic
1182521177 22:30885242-30885264 AGTGCTGGGGAGTGGCAGCTGGG + Intronic
1182742283 22:32576798-32576820 AGGGGTGGGGGTTGGAAGCGGGG - Intronic
1182829143 22:33290626-33290648 AGAGCTGGGGGCTGGCAGCTGGG + Intronic
1183429120 22:37755211-37755233 GGGGCTGGTGGTGGGCAGCATGG + Intronic
1183429874 22:37759088-37759110 AGGGCTGGTGGAAGGCAGTGAGG - Intronic
1183512830 22:38245889-38245911 AGGGCTGGCGGGGGGCTGGGGGG - Intronic
1183667589 22:39254439-39254461 AGGCCTGGTGGGGGGCAGCAGGG + Intergenic
1184119022 22:42438412-42438434 AGGGCAGGTGGGGGGCAGAAGGG - Intergenic
1184332129 22:43833817-43833839 ACGGCTGCTGGGTGGCAGGAGGG - Intronic
1184401390 22:44276644-44276666 GGAGATGGTGGGAGGCAGCGGGG + Intronic
1185068617 22:48644348-48644370 ATGGCTGGTGCGTGGCTGCGGGG - Intronic
1185370728 22:50459793-50459815 AGGGCTGGGGGGTGGCTGGGGGG - Intronic
1185419727 22:50728673-50728695 GGGGCTGGTGGGTGGAGGCCAGG + Intergenic
949572234 3:5304655-5304677 AGGGATGCAGGGTGGCAGGGTGG + Intergenic
949925492 3:9037812-9037834 GGGGCTGCTGTGTGGCAGTGGGG - Intronic
950576996 3:13837970-13837992 GGGGCTGTTGCGGGGCAGCGTGG - Intronic
950646873 3:14382637-14382659 AGAGCTGGTGGGGTGCAGCAGGG - Intergenic
950694257 3:14685667-14685689 GGGACTGGAGGGTGGCAGCGGGG - Intronic
950883922 3:16346586-16346608 AGGCCTGGGGGGTGTCAGTGAGG - Intronic
952923948 3:38307859-38307881 ATGGCGGGGGTGTGGCAGCGTGG + Intronic
953535725 3:43775300-43775322 GGGGCTGGTGTGTGTCAGGGTGG + Intergenic
953911021 3:46893104-46893126 AGTCCCGGTGGGTGGCAGCCAGG + Intronic
954117553 3:48475580-48475602 AGGGCTGGGAGGTAGCACCGGGG + Intronic
954293295 3:49661005-49661027 GGGGCTGGAGGCTGGAAGCGGGG - Exonic
954329328 3:49881128-49881150 AGGGCTGTGGGGTGGGAGGGAGG + Intergenic
954368302 3:50157379-50157401 AAGGCTGGTGGGAGGGAGCAAGG - Intronic
955060473 3:55488319-55488341 AGGGCTGGGGGGTGGGAGGGGGG - Intronic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
958882765 3:99691629-99691651 AGGGTGGCTGGGTGGCAGTGAGG - Intronic
959707422 3:109350956-109350978 AGTGGTGGTGGGTGGTAGTGCGG + Intergenic
961462223 3:127058266-127058288 TGGGCTGGTGGGTGACCCCGTGG + Intergenic
961816786 3:129555258-129555280 GGGGCTGGAGGGGGGCAGCTGGG - Exonic
961835711 3:129657131-129657153 AGGACTGTTGGGTGGCAGGGAGG + Intronic
962343704 3:134605112-134605134 AGAGATGGGGGGTGGCAGTGTGG - Intronic
962621964 3:137189433-137189455 AGGGCAGGAGGGTGGAAGTGAGG - Intergenic
962773359 3:138634403-138634425 AGGGTTGCAGGGCGGCAGCGTGG + Intergenic
963043065 3:141083343-141083365 AGGGTGGGGGGGTGGCAGTGTGG - Intronic
966920081 3:184605342-184605364 AGGCCTAGTGGGTGGGAGCCAGG + Intronic
967039027 3:185672546-185672568 AGGGGTGGTAGGGGGCAGCGGGG + Exonic
967227658 3:187307285-187307307 GGGGCTGGTAGGTGGGAGTGGGG - Intergenic
967844806 3:194035038-194035060 AGGGGTGTTGGGTGGCAGGCGGG + Intergenic
967854566 3:194106933-194106955 AGTGGTGGTGGGTGGCAGAGAGG - Intergenic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
968095237 3:195925272-195925294 AGGGCAGGAGGGTGGGAGGGTGG - Intergenic
968377209 4:53585-53607 AGGGCTGAGAGGCGGCAGCGGGG - Intronic
968393555 4:212882-212904 AGGGCTGAGCGGCGGCAGCGGGG - Intergenic
968405769 4:338077-338099 AGGGCTGAGCGGCGGCAGCGGGG - Intronic
968546340 4:1200852-1200874 AGGCCTGGTTGGTGGCATTGAGG - Intronic
968594625 4:1476019-1476041 ATGGGTGGTGGGTGGGAGAGTGG + Intergenic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
969235908 4:5864954-5864976 TGGGCTGGGGGGAGGCAGGGAGG + Intronic
969282655 4:6181558-6181580 AGGGCCTATGGGTGCCAGCGTGG + Intronic
969446474 4:7247676-7247698 AGTGCTGGAGGTGGGCAGCGGGG + Intronic
969450286 4:7269018-7269040 GGGCCTGGTGGTTGGCAGAGCGG + Intronic
969564875 4:7971715-7971737 AGGGCTGGAGGTTGGTAGGGGGG - Intronic
970225635 4:13853834-13853856 AGGGTTGGAGGTTGGCAGTGAGG + Intergenic
972543165 4:40056775-40056797 AGGGCGGGTGGGCGGCCGGGTGG - Intergenic
972698257 4:41468804-41468826 GTAGCTGGTGGGTGGCAGCTCGG + Intronic
973369110 4:49231115-49231137 AGGTCTGGAGGGTGGTAGCATGG - Intergenic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
975420520 4:74158368-74158390 AAGGCTCGTGGGCGGCCGCGCGG + Intronic
976107915 4:81639546-81639568 ATGCTTGGTGGGTGGCAGCAGGG + Intronic
977809704 4:101346070-101346092 CTGGCTGGAGGGTGGCCGCGGGG - Intronic
978356599 4:107881750-107881772 AGTAGTGGTGGGTGGCAGGGCGG - Intronic
980375973 4:131949573-131949595 AGGGGTTGGGGGTGGCAGGGGGG + Intergenic
981581426 4:146252094-146252116 ATGGCTGGTGGCTGGCAGATGGG + Intergenic
982439397 4:155417530-155417552 AGGGTGGGTGGGTGGGAGTGGGG - Intergenic
983637708 4:169914831-169914853 AGGGCCGGTCTGTGGCAGCGGGG + Intergenic
984892280 4:184504596-184504618 AGGCGTGGTGGGTGGGGGCGGGG - Intergenic
985860032 5:2463670-2463692 TGGAGTGGTGGGTGGCAGAGAGG + Intergenic
985995656 5:3595740-3595762 AGGGCGGGCGGGAGGCAGGGAGG + Intergenic
986195766 5:5535390-5535412 TGGGGTGGTGGGAGGCAGGGAGG + Intergenic
986681704 5:10239228-10239250 TGGGCTTGTGGGTGGCACCCTGG - Exonic
987089289 5:14497118-14497140 GGGGCTGGTGGGTGGGAGGGAGG - Intronic
990852281 5:60220136-60220158 CAGGCTTGTGGGTGGCAGTGGGG + Intronic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
992725880 5:79606855-79606877 AAGGCAGGTGAGTGGCAGCCTGG - Intergenic
996023604 5:118618954-118618976 AGGGCTGGTGGAAGGCAGAAAGG - Intergenic
996166147 5:120226428-120226450 AGGGATGGAGGGAGGCAGAGAGG - Intergenic
996993118 5:129660950-129660972 GAGGCTGTTGGGTGGCAGTGGGG - Intronic
997844995 5:137278197-137278219 AGGGCTGCAAGGTGGCAGCTAGG - Intronic
997900057 5:137755258-137755280 AGGGCGGGAGGGTGGCAGGGAGG - Intergenic
998515851 5:142753416-142753438 GGTGCTGTTGGGTGGCAGCCAGG + Intergenic
999373294 5:151069141-151069163 AGCACTTGTGGGTGGCAGGGAGG + Intronic
999708453 5:154295054-154295076 AGGGATGGTGGCTGACAGGGAGG - Intronic
999868603 5:155728194-155728216 GGGGCTGGAGGGAGGGAGCGAGG - Intergenic
1001093722 5:168760545-168760567 AGGGCTGGTGGGTGGGACTCAGG - Intronic
1002270467 5:178068477-178068499 ACAGCTGGTGGGTGGGAGCCGGG + Intergenic
1002427282 5:179183777-179183799 AGGCCTGGTGGGGGGCAGTAGGG - Intronic
1002646510 5:180659183-180659205 CGGGGTGGGGGGTGGCGGCGGGG - Intergenic
1002646523 5:180659209-180659231 GGGGGTGGGGGGTGGCGGCGGGG - Intergenic
1002650855 5:180692273-180692295 TGGGCAGGTGTGTGGCAGTGGGG - Intergenic
1002794690 6:463122-463144 AAGGGTGGTGGGAGGCAGGGAGG + Intergenic
1003518131 6:6834749-6834771 AGGGATGGTGGGGGGCGGGGAGG - Intergenic
1003559420 6:7168662-7168684 AGGACTGGTGTGTGGAAGAGGGG - Intronic
1003572980 6:7268159-7268181 GGGGGTGGTGGGTGGGAGTGGGG - Intergenic
1003869363 6:10390081-10390103 AGGGCTGATGGGAGCCAGCGAGG + Intergenic
1004341588 6:14812750-14812772 AGGGCTGCTGGTTGGCTGGGAGG - Intergenic
1005235490 6:23757388-23757410 TGGGGTGGGGGGTGGGAGCGGGG - Intergenic
1006153530 6:32001887-32001909 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006159838 6:32034624-32034646 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006173221 6:32107408-32107430 AGGGCTGGGTGGTGGCAACAGGG - Intronic
1006393326 6:33771633-33771655 AGGGCCGGTGGGCGGCGGCGCGG + Exonic
1006396949 6:33793722-33793744 AGGGCATGCGGGGGGCAGCGGGG - Intergenic
1006442279 6:34060048-34060070 AGGGCTGGGGGGTGGCTGCTGGG + Intronic
1006547500 6:34792064-34792086 CGCGCTGGTGGGTGGGATCGTGG + Exonic
1007112383 6:39320375-39320397 AGGGCTGCAGGCTGGCAGTGGGG - Intronic
1007121895 6:39389012-39389034 ATGGATTGTGGGTGGCAGCGGGG + Intronic
1007255555 6:40525775-40525797 AGGGCTGGTGGTTGGAGGCCTGG - Intronic
1007721757 6:43889372-43889394 GGGGCTGGGGGGTGGCAGGAAGG - Intergenic
1007793307 6:44326546-44326568 AGGGGTGTGGGGTGGCAGAGAGG + Intronic
1007834519 6:44664373-44664395 AGGTCTAGGGGGTGGCAGGGCGG + Intergenic
1010032954 6:71289038-71289060 AGGGCCGGGCGGCGGCAGCGAGG + Exonic
1017399612 6:154045501-154045523 AGCACTGGTGGGTGGCATGGGGG - Intronic
1017470556 6:154733803-154733825 CGGGCTGCTGCGTGGCCGCGAGG - Intronic
1017871452 6:158489975-158489997 AGTGATGGTGGGTGGCAGAGGGG + Intronic
1017893133 6:158655854-158655876 AGGGCTGGGGGCTGGCTGTGTGG - Intronic
1018030013 6:159834322-159834344 AGGGGTGGGGGGCGGCAGTGGGG - Intergenic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1019357137 7:586491-586513 AGGGCTGGAGGGTGGCAGGAAGG - Intronic
1019477277 7:1249953-1249975 AGGGACGGAGGGAGGCAGCGCGG + Intergenic
1019597747 7:1866127-1866149 AGGGCTGGTTGGTGGGAGGGGGG + Intronic
1019626614 7:2019131-2019153 TGGGGAGGCGGGTGGCAGCGAGG - Intronic
1020005684 7:4782859-4782881 AGGGCGGCTGGGTGGCTGGGAGG - Intronic
1020083655 7:5299221-5299243 AGGGCTGGAGGGTGGCGGGCGGG - Exonic
1020278288 7:6637463-6637485 GGGGCCGGTGGGCGGCGGCGCGG + Intronic
1020756533 7:12210746-12210768 AGGGGTGGGGAGGGGCAGCGTGG + Intergenic
1022319947 7:29278935-29278957 AGGCCTGGGGGGAGGCAGCAAGG - Intronic
1022810359 7:33862021-33862043 AGGGCAGGTGGATGGTAGCCTGG + Intergenic
1023032690 7:36104537-36104559 TGGGCAGGTGGGTGGCAGAAAGG + Intergenic
1023109874 7:36798999-36799021 ATGGCTGGTGAGAGGCAGTGAGG + Intergenic
1023991795 7:45133014-45133036 GTGGCTGGTGGGGGGCAGTGGGG + Intergenic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024597986 7:50955974-50955996 AGACCTGGTGCCTGGCAGCGAGG - Intergenic
1024615455 7:51108102-51108124 AGTGCTGGAGGCTGGAAGCGTGG - Intronic
1025176153 7:56803472-56803494 AGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025951299 7:66147481-66147503 AGGGCTGGTGAGTGGCTGATTGG + Intronic
1026236917 7:68535092-68535114 GGGGGTGGTGGGTGGCGGGGTGG + Intergenic
1026236925 7:68535107-68535129 CGGGGTGGTGGGTGGCCGGGGGG + Intergenic
1026621542 7:71953914-71953936 GGGGTTGGTGGTTGGCAGTGTGG + Intronic
1026702728 7:72661221-72661243 AGGTCTGGTGGGGGGCGGGGGGG + Intronic
1026845660 7:73697688-73697710 AGGGCAGGTGAGTGCCAGCCTGG + Exonic
1027221089 7:76214348-76214370 AGGGATGGTGGGTGGGAGGTAGG - Intronic
1027343898 7:77237952-77237974 ATGGCTGGGGAGTGGCAGCATGG - Intronic
1028580642 7:92406274-92406296 AGGGATGGTGGGGGGCAGGTAGG + Intergenic
1028899079 7:96075829-96075851 GGGGCTGGTGGCTGGGACCGGGG - Intronic
1029422157 7:100477396-100477418 AGGGCAGGGGCGTGGCAGCCCGG + Exonic
1029435699 7:100562899-100562921 CGGGTTGGTGGAAGGCAGCGGGG - Exonic
1029490302 7:100867025-100867047 AGTGCTGGTGGGTAGCTGAGAGG + Intergenic
1029620741 7:101688540-101688562 AGACCCGGTTGGTGGCAGCGCGG - Intergenic
1030138712 7:106284596-106284618 AGGGCTGGGCGGTGGAGGCGGGG - Intronic
1030742435 7:113125951-113125973 AGGACTTGTGGGTGGGTGCGGGG - Intergenic
1030885407 7:114930282-114930304 AGGGTTGGAGGTTGGCAGGGTGG + Intronic
1031721978 7:125187684-125187706 GGGCCTGGTGGGTGGAAGTGGGG + Intergenic
1031963053 7:128006870-128006892 AGGGCTGGTTGTTGCCAGCATGG + Intronic
1032405409 7:131652248-131652270 AGGGCTAGCAGGAGGCAGCGAGG + Intergenic
1032412185 7:131704082-131704104 AGCGATGGTGGGGGGCAGAGGGG + Intergenic
1034268496 7:149792315-149792337 AGGGCAGGTGCTGGGCAGCGAGG + Intergenic
1035384017 7:158458526-158458548 GGGGCTGTTGGGTGGGGGCGTGG - Intronic
1035602140 8:902933-902955 TGGGCAGGTGGGTGGGGGCGGGG + Intergenic
1035619131 8:1024373-1024395 AGGGAGGGTGGGTGGCGGCTGGG - Intergenic
1035619151 8:1024428-1024450 AGGGAGGGTGGGTGGCGGCTGGG - Intergenic
1037446990 8:18975082-18975104 AGGCCTGCTGGGTGGCAGGTGGG + Intronic
1037611950 8:20483294-20483316 AGGGCAGGTGGCAGGCAGGGAGG + Intergenic
1038493967 8:27988919-27988941 AGGGCTGGCAGGTGGCAGTGGGG + Intronic
1038906694 8:31912388-31912410 AGTGCAGGTGGCTGGCAGTGTGG + Intronic
1039414764 8:37384546-37384568 GGGCTTGGTGGGTGGCTGCGTGG - Intergenic
1039918659 8:41877696-41877718 AGAGCAGGTGGGTGGGAGCCAGG + Intronic
1039996751 8:42541317-42541339 AGGGCTGGTCGGCGCCGGCGGGG - Intronic
1042466015 8:69130829-69130851 AGGGCTGGTAGGGGCCAGGGTGG + Intergenic
1042837795 8:73093207-73093229 AGGGCTGGGGAGGGGCGGCGCGG - Exonic
1042851956 8:73225778-73225800 AGGGCTGGGGGGTGGTGGTGAGG - Intergenic
1043482012 8:80663508-80663530 AGGGTTGGTGGGGGGCACAGAGG + Intronic
1043934976 8:86132475-86132497 AGGAATGGTGGGTGGTAGGGAGG - Intronic
1044933405 8:97271331-97271353 ATGGCAGGTGGGTGGCGGGGTGG + Intergenic
1045488317 8:102651430-102651452 ACGGCTGGTGGCTGGCTGGGAGG + Exonic
1048959360 8:139563130-139563152 AGGGATGGAGGGAGGCAGCCAGG - Intergenic
1049231809 8:141488516-141488538 AGGTCTGGTGGCTGGGAGCTGGG + Intergenic
1049374818 8:142284347-142284369 AGGGCTGGGGGCTGGCAGGCAGG + Intronic
1049378612 8:142301215-142301237 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049378680 8:142301406-142301428 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049378727 8:142301535-142301557 AGGGCAGGTGGGGGGCACTGTGG - Intronic
1049659437 8:143813187-143813209 AGGGCAGGCGGGTGGGAGCTGGG - Intronic
1049705555 8:144040476-144040498 GTGGGTGGTGGGTGGCAGAGTGG + Intronic
1049740795 8:144239970-144239992 GGAGCAGGTGGGGGGCAGCGGGG + Intronic
1049749983 8:144278467-144278489 ATGCCTGGTTGGTGGCAGTGGGG - Intronic
1051228199 9:14925007-14925029 GGGACTGGTGGGAGGCAGAGAGG + Intergenic
1051852751 9:21528272-21528294 TGGGCTGGTGTGTGGCTGTGGGG + Intergenic
1052448763 9:28598562-28598584 AGGGAGGTTGGGTGGGAGCGAGG + Intronic
1052984915 9:34479883-34479905 AGGGTTGGAGGGTGGAAGGGAGG - Intronic
1053307037 9:36992114-36992136 AGGGTTGGGGGGTGGGGGCGAGG - Intronic
1053669444 9:40346014-40346036 AGGGTCTGTGAGTGGCAGCGTGG - Intergenic
1053670697 9:40358790-40358812 AGGGTCTGTGAGTGGCAGCGTGG + Intergenic
1053920500 9:42985163-42985185 AGGGTCTGTGAGTGGCAGCGTGG + Intergenic
1054380576 9:64486034-64486056 AGGGTCTGTGAGTGGCAGCGTGG - Intergenic
1054381819 9:64498853-64498875 AGGGTCTGTGAGTGGCAGCGTGG + Intergenic
1054513916 9:66017510-66017532 AGGGTCTGTGAGTGGCAGCGTGG - Intergenic
1054515170 9:66030277-66030299 AGGGTCTGTGAGTGGCAGCGTGG + Intergenic
1054763500 9:69023879-69023901 CTGGCAGGTGGGTGGCAGAGAGG - Intergenic
1056067621 9:82953530-82953552 TGGGTGGGTGGGTGGCAGGGTGG - Intergenic
1056194985 9:84220313-84220335 AAGACTGGTGGGTGGAAGCCGGG - Intergenic
1056467088 9:86868263-86868285 AGGACTGCTGGTTGCCAGCGGGG - Intergenic
1056600765 9:88044957-88044979 AGAGGTGGTGGCTGACAGCGTGG - Intergenic
1057695802 9:97322242-97322264 AGGGCAGGGGGATGGCAGCTAGG - Intronic
1059145613 9:111896896-111896918 GGGTCTGGTGGGCGGCCGCGAGG + Exonic
1059323280 9:113485731-113485753 TGGGCTAGTGGGTGACAGCCAGG + Intronic
1060277665 9:122194067-122194089 AGGGCATGCAGGTGGCAGCGAGG + Intronic
1060440156 9:123631213-123631235 AGTGCTGGTGAGGGGCAGGGAGG - Intronic
1060790287 9:126481450-126481472 CAGGCTGGGGGGTGGCAGAGGGG - Intronic
1061041357 9:128142663-128142685 GGGGCTGGGGGGTGGGAGCCTGG - Intergenic
1061099952 9:128484928-128484950 AGGGCTGGGTGATGGCAGAGGGG + Intronic
1061120120 9:128636902-128636924 ACGGCCGGTGAGTGGCAGCGGGG - Exonic
1061152863 9:128838666-128838688 AGGCCTGGTGGTTGGCACCCTGG - Intronic
1061215975 9:129222297-129222319 TGGGAGGGTGGGTGGCAGCCTGG + Intergenic
1061225403 9:129278378-129278400 AGGCCTGGTGGGCAGCAGCTAGG - Intergenic
1061238273 9:129354361-129354383 AGGCCTTCTGGGTGGCAGGGTGG + Intergenic
1061577160 9:131514315-131514337 AGGGCTGGGGGGAGCCAGGGTGG - Intronic
1061590037 9:131592225-131592247 AGTGCTGGGGGGTGGTAGCCAGG + Intronic
1061865460 9:133489870-133489892 TGGGCTGGTGGGTGTCTGCAAGG + Intergenic
1061949893 9:133930319-133930341 AAGGCTGCTGGGAGGCAGTGTGG - Intronic
1062091175 9:134679523-134679545 AGGGCTGGTTGGGGGCACTGCGG + Intronic
1062125427 9:134858154-134858176 AGGAGTGGTGGGAGCCAGCGTGG - Intergenic
1062300477 9:135864872-135864894 AGGGCTGGAGGGCTGCAGAGAGG - Intronic
1062331934 9:136048760-136048782 AGTGCTGGTTGGGGGCAGAGGGG - Intronic
1062339819 9:136089084-136089106 TGGTCAGGTGGTTGGCAGCGGGG - Intronic
1062414066 9:136439186-136439208 AGGCCTGGCGGGGGGCCGCGGGG + Exonic
1062447645 9:136602295-136602317 AGTGCTGGCAGGTGGCTGCGGGG + Intergenic
1202788794 9_KI270719v1_random:63316-63338 AGGGGTTGGGGGTGGCAGGGGGG + Intergenic
1203572027 Un_KI270744v1:140661-140683 AGGGCTGAGAGGCGGCAGCGGGG + Intergenic
1185819854 X:3191972-3191994 TGGGCTGGTGGGGGCCAGCATGG + Intergenic
1186573753 X:10743877-10743899 AGGGTTGGTGGGGTGCAGGGCGG - Intronic
1187478128 X:19629638-19629660 AAGGCTTGTGGGTGGGAGCAGGG + Intronic
1188549062 X:31342166-31342188 AGGGCTCCTGGGTGGGAGTGGGG + Intronic
1188833747 X:34932018-34932040 TGGGCTGGTGTGTGTCAGTGGGG - Intergenic
1190279334 X:48918919-48918941 AGGGCTGGGGGGCGCCAGGGTGG + Exonic
1190395042 X:49973727-49973749 AGTGCTGGCTGGTGGCAGCCAGG + Intronic
1192123706 X:68480991-68481013 AGGGCTGGTGGTGGGCAATGGGG + Intergenic
1192343650 X:70283723-70283745 AGTGCTGGTAGGGGGCAGAGGGG - Intronic
1192436810 X:71148233-71148255 AGGGCAGGCGGGAGGCAGGGAGG - Intronic
1194976406 X:100401261-100401283 ATGGCTGGTGGGTGGCTGGGAGG - Intronic
1195270131 X:103220824-103220846 CGAGCTGGTGCGTGTCAGCGGGG - Intergenic
1195544573 X:106100594-106100616 CCGGCTGGTGGGTGTCAGCAGGG + Intergenic
1196607788 X:117675161-117675183 AGGGCAGGGTGGTGGCAGCAAGG - Intergenic
1197147733 X:123187770-123187792 AGGGCTGGTGGGTGTCAATCTGG - Intronic
1199226377 X:145379747-145379769 AAGGGTGGAGGGTGGCAGCAGGG - Intergenic
1199981916 X:152925790-152925812 AAGGCTGGTTTGTGGCAGAGTGG + Intronic
1200071313 X:153530808-153530830 GGGGCCGGTGGGGGGCAGAGGGG + Intronic
1200075635 X:153549241-153549263 AGGGCTGGTGGGTAACTGAGAGG + Intronic
1200876439 Y:8160488-8160510 AGGGGTGGTGGGGGACAGAGTGG - Intergenic
1200989294 Y:9334701-9334723 AGAGCTGGTGTGTGGGAGGGTGG - Intergenic
1201176013 Y:11308526-11308548 GGGGCTGGTGGGTGGGGGTGGGG - Intergenic