ID: 1152822202

View in Genome Browser
Species Human (GRCh38)
Location 17:82443080-82443102
Sequence GTTAGTTTTTTTACAAAGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 867
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 815}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152822200_1152822202 -6 Left 1152822200 17:82443063-82443085 CCAGTTTTTCCTGTTTGGTTAGT 0: 1
1: 0
2: 2
3: 32
4: 324
Right 1152822202 17:82443080-82443102 GTTAGTTTTTTTACAAAGACAGG 0: 1
1: 0
2: 1
3: 50
4: 815
1152822199_1152822202 -5 Left 1152822199 17:82443062-82443084 CCCAGTTTTTCCTGTTTGGTTAG 0: 1
1: 0
2: 0
3: 23
4: 319
Right 1152822202 17:82443080-82443102 GTTAGTTTTTTTACAAAGACAGG 0: 1
1: 0
2: 1
3: 50
4: 815

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152822202 Original CRISPR GTTAGTTTTTTTACAAAGAC AGG Exonic
900274395 1:1814626-1814648 TTTTGGTTTTTTACAGAGACAGG - Intronic
901478922 1:9510628-9510650 TTTTTTTTTTTTTCAAAGACAGG - Intergenic
901616459 1:10543769-10543791 GTGAGTTTTTTTGTAGAGACAGG + Intronic
902192293 1:14772310-14772332 GTTAAATTTTTTATAGAGACAGG - Intronic
903289972 1:22304289-22304311 GCTAATTTTTTTATAGAGACAGG - Intergenic
903432647 1:23319092-23319114 GTTACTATTTTTACCAAGAATGG + Intronic
903460247 1:23515871-23515893 GTAAATTTTTTTATAGAGACAGG + Intronic
903629626 1:24757566-24757588 TTTAGTTTTTTTGTAGAGACAGG - Intronic
903804592 1:25996182-25996204 TTTAATTTTTTTATAGAGACAGG - Intronic
905237123 1:36557915-36557937 TTTAAATTTTTTATAAAGACAGG + Intergenic
905433998 1:37944598-37944620 GTTTTTTTTTTTATAGAGACAGG + Intronic
905698003 1:39990143-39990165 TTTTTTTTTTTTAAAAAGACTGG + Intergenic
905704669 1:40045857-40045879 GTTTGATTTTTTTCAGAGACAGG + Intronic
906019155 1:42611847-42611869 TTTAATTTTTTTATAGAGACAGG + Intronic
906419982 1:45657528-45657550 GTTTGTTTTTTTATTGAGACGGG - Intronic
906958780 1:50400944-50400966 ATTAATTTTTTTCGAAAGACTGG - Intergenic
907083378 1:51645482-51645504 GTTGGTTTTTTTTTTAAGACAGG + Intronic
907114812 1:51959345-51959367 GCTAATTTTTTTATAGAGACAGG - Intronic
907151787 1:52295532-52295554 GTTTGTTTTTTTGTAGAGACAGG + Intronic
908203831 1:61824594-61824616 TTTAGTTGTTTTGCAGAGACAGG + Intronic
908221223 1:62008583-62008605 GCTCATTTTTTTATAAAGACGGG - Intronic
908303216 1:62783416-62783438 TTTAATTTTTTAACAGAGACGGG + Intergenic
909952437 1:81735969-81735991 TTTAGTATTTTTAGTAAGACGGG - Intronic
909984844 1:82148369-82148391 TTTAATTTTTTTGTAAAGACAGG + Intergenic
910245621 1:85135238-85135260 GTTTGTTTGTTTTTAAAGACAGG + Intergenic
910331557 1:86078251-86078273 GGTATTTTTTTTACCAAGAAGGG - Intronic
910687370 1:89931016-89931038 TTTTTTTTTTTTACAAAGACTGG + Intronic
910756873 1:90703406-90703428 TTTAATTTTTTTGCAGAGACAGG + Intergenic
910969420 1:92840181-92840203 ATTAGTTTTTTTATGGAGACAGG + Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
912854735 1:113157304-113157326 TTTAATTTTTTTATAGAGACAGG - Intergenic
912998689 1:114557530-114557552 ATTAATTTTTTTTTAAAGACAGG + Intergenic
913038494 1:114999418-114999440 GTTACTGTTTTTACAGAAACAGG + Intergenic
915162101 1:153927927-153927949 GTTTTTTTTTTTTCTAAGACAGG + Intergenic
915377367 1:155408841-155408863 GTTTGTTTTTCTCCAGAGACAGG - Intronic
915958457 1:160243413-160243435 TTTTTTTTTTTTAAAAAGACGGG + Intronic
915986101 1:160466608-160466630 TTTATTTTTTTTCCTAAGACAGG + Intergenic
916412030 1:164555568-164555590 TTTTTTTTTTTTACAGAGACAGG + Intronic
916655267 1:166869917-166869939 TTTTGTTTTTTTAAAGAGACGGG + Intronic
917032235 1:170706006-170706028 GTTAGATTTTTTAAAAACTCTGG + Intronic
917429975 1:174956205-174956227 GTTTGTTTGTTTTAAAAGACAGG + Intronic
917488563 1:175477772-175477794 GTCAGTTCTTATACAAACACAGG + Intronic
917657703 1:177143289-177143311 GTTAATGTTCTTCCAAAGACTGG - Intronic
917830833 1:178883810-178883832 GTTATTTTTTTAGCAGAGACGGG - Intronic
919648918 1:200126017-200126039 TTTAATTTTTTTATAGAGACAGG + Intronic
920276059 1:204805278-204805300 GTTGGTTTTTTTAAAGAGATGGG + Intergenic
920411607 1:205765895-205765917 TTTTGTATTTTTATAAAGACAGG - Intergenic
920412917 1:205775934-205775956 ATAGGTTTTTTTCCAAAGACTGG - Intergenic
920845813 1:209592173-209592195 TTAATTTTTTTTCCAAAGACAGG - Intronic
920949426 1:210558403-210558425 GTTACTTTATTTAGAAAGAAAGG + Intronic
921371581 1:214428568-214428590 GATAGTTCTTTTACAAAAATAGG - Intronic
921972820 1:221169015-221169037 TTTTTTTTTTTTATAAAGACAGG + Intergenic
922083476 1:222322327-222322349 GTAATGTTTTTTAAAAAGACAGG + Intergenic
922438032 1:225625685-225625707 GTTTGTATTTTTAGAGAGACAGG + Intronic
922454047 1:225760116-225760138 TTTAATTTTTTTATAGAGACAGG - Intergenic
922641684 1:227238334-227238356 GTTTGTTTTTTTAATGAGACAGG - Intronic
923004121 1:230031634-230031656 GTTTGTTTGTTTGTAAAGACTGG + Intergenic
923154575 1:231267040-231267062 GTTAGTTTTTTTCCTGACACAGG + Intronic
923407675 1:233678908-233678930 ATTATTTTTTTTTCAGAGACGGG - Intergenic
923744913 1:236691469-236691491 TTTATTTTTTTTGCAAAGACGGG - Intronic
923931222 1:238699912-238699934 TTTATTTTTTTTGTAAAGACAGG + Intergenic
923935929 1:238760190-238760212 GTTAGATTTTTTAAAAGTACGGG + Intergenic
924022367 1:239797874-239797896 GTTAATTTTTTTGTAGAGACAGG - Intronic
924135864 1:240966121-240966143 GTTAGTGTTTCTAGAATGACAGG - Intronic
924257619 1:242197803-242197825 TTTTGTATTTTTGCAAAGACGGG + Intronic
924460659 1:244255640-244255662 TTTGGCTTTTTTACAGAGACAGG - Intergenic
924673663 1:246153641-246153663 GTTTGTTTTTTAATACAGACAGG + Intronic
924745372 1:246828361-246828383 GTTTGTTTTATTACAAACACAGG - Intergenic
924878328 1:248129521-248129543 GTTAGTTTTTCTTCTAAGCCAGG - Intergenic
1063412997 10:5851124-5851146 GTTTGTTTTTTAGCAGAGACGGG + Intergenic
1064862123 10:19838132-19838154 TTAAGTTTTTTTGTAAAGACAGG + Intronic
1065082038 10:22138731-22138753 GATAACTTTTTTACAGAGACAGG + Intergenic
1065353332 10:24815275-24815297 GTTTATTTTTTTGTAAAGACAGG - Intergenic
1065500646 10:26378842-26378864 ATAGGTTTTTTTAAAAAGACTGG + Intergenic
1065580864 10:27170314-27170336 TATAATTTTTTTACAAGGACTGG - Exonic
1065929748 10:30469215-30469237 GTTAATTTTTTTGTAAAGACAGG + Intergenic
1065998334 10:31080673-31080695 TTTTGTTTTTTTAAAGAGACAGG + Intergenic
1067103468 10:43349908-43349930 ATTTGTATTTTTACAGAGACAGG - Intergenic
1067399582 10:45958648-45958670 GTTTTTTTTTTTAAAGAGACAGG - Intergenic
1067865668 10:49903270-49903292 TTTATTTTTTTTCCAGAGACAGG - Intronic
1068208136 10:53884014-53884036 TTTTGTTTTTTTACAAAAACAGG - Intronic
1068494883 10:57775399-57775421 GTTAATGTTTTTACAAAGCTTGG - Intergenic
1068731557 10:60363876-60363898 GTAAGTTTTTATAAAAAGATAGG + Intronic
1069027214 10:63555853-63555875 GTTGATTATTTTACATAGACAGG + Intronic
1069433933 10:68362773-68362795 CTTTTTTTTTTTTCAAAGACAGG - Intronic
1069667305 10:70171098-70171120 TTTTGTATTTTTACAGAGACAGG + Intergenic
1069673308 10:70229300-70229322 GTTATTTATTTTCCTAAGACAGG + Intronic
1069770027 10:70892596-70892618 TTTAAATTTTTTACAGAGACAGG + Intergenic
1070765759 10:79055279-79055301 TTTAATTTTTATGCAAAGACAGG - Intergenic
1071107195 10:82112070-82112092 TTTATTTTTTTTACAGTGACAGG - Intronic
1072101022 10:92229203-92229225 TTTAATTTTTTTATAGAGACAGG + Intronic
1072130449 10:92489005-92489027 GTTTTTTTTTTTAAATAGACAGG - Intronic
1072286852 10:93924301-93924323 TTTAATTTTTTTGCAGAGACAGG + Intronic
1072849674 10:98875238-98875260 GTTAATCTTTTCAAAAAGACAGG - Intronic
1072968406 10:99994927-99994949 GTTTGTTTGTTTAAAGAGACAGG + Intronic
1072990689 10:100190191-100190213 TTTATATTTTTTATAAAGACAGG + Intronic
1073005087 10:100317366-100317388 TTTTGTTTTTTTGTAAAGACAGG - Intronic
1073213125 10:101820444-101820466 TTTTATTTTTTTATAAAGACTGG - Intergenic
1073337667 10:102722538-102722560 GTTAGTGTTTTTTCCCAGACAGG + Intronic
1073378700 10:103060388-103060410 GTTTGTATTTTTGTAAAGACAGG - Intronic
1073537706 10:104292625-104292647 GTTAGTTTTTTTGTAGAGACAGG + Intronic
1073551472 10:104405930-104405952 GTTAATTTTTTTGTGAAGACAGG - Intronic
1073740077 10:106396583-106396605 GTTAATTTTTATAGAAATACTGG - Intergenic
1074022579 10:109599061-109599083 ATTAATTTTTTTAAAAAAACCGG - Intergenic
1074187590 10:111110403-111110425 GTTATTTTTTTTTGAGAGACAGG + Intergenic
1075411379 10:122231061-122231083 GTTTGTTTTTTTACAAAAAACGG + Intronic
1078268553 11:9773475-9773497 GCTAATTTTTTTATAGAGACAGG - Intergenic
1078496339 11:11821204-11821226 TTTAATTTTTTTACACAGATTGG + Intergenic
1078628601 11:12981316-12981338 ATTATTTTTTTTGTAAAGACGGG + Intergenic
1078836705 11:15037030-15037052 ATTAGCTTTTTTCCAAAGATTGG - Intronic
1078955791 11:16193364-16193386 TTTATTTTTTTTTTAAAGACAGG - Intronic
1079469532 11:20765150-20765172 TTTTTTTTTTTAACAAAGACAGG - Intronic
1080620641 11:33984633-33984655 ATTTGTTTTTTTTCAGAGACGGG - Intergenic
1080812372 11:35717386-35717408 GTTACTTTTTTTTTAAAGTCTGG + Intronic
1080916312 11:36664013-36664035 TTTAATTTTTTTATAGAGACGGG + Intergenic
1081377012 11:42371978-42372000 CTTAGTATTTCTTCAAAGACAGG + Intergenic
1081568296 11:44273945-44273967 TTTATTTTTTTTAAAGAGACTGG - Intronic
1082194741 11:49288778-49288800 GTTAGTGTTTTTAAAACTACAGG + Intergenic
1083195911 11:61087341-61087363 TTTAATTTTTTTATAGAGACAGG + Intergenic
1083244147 11:61412845-61412867 TTTATTGTTTTTACAAAAACAGG - Intronic
1083608838 11:63995497-63995519 CTTATTTTTTTTAGAGAGACGGG + Intronic
1083956254 11:65984544-65984566 GCTAATTTTTTTGCAAAGACAGG + Intergenic
1084077965 11:66796775-66796797 TTTTTTTTTTTTCCAAAGACAGG - Intronic
1084194259 11:67515228-67515250 TTTTGTTTTTTTAGAGAGACAGG + Intergenic
1084306971 11:68292223-68292245 GCTAGTTTTTTTTTTAAGACAGG - Intergenic
1085000806 11:73032395-73032417 TTTAATTTTTTTATAGAGACAGG + Intronic
1085581475 11:77654771-77654793 TTTTGTTTTTTTGTAAAGACAGG + Intergenic
1086271705 11:85075114-85075136 GTTATTTTATCTAAAAAGACCGG + Intronic
1086326184 11:85702352-85702374 GTTAATTTCTTTGCAAAGGCAGG + Intronic
1086333321 11:85775651-85775673 TTTTGTATTTTTACTAAGACGGG + Intronic
1086671392 11:89552151-89552173 GTTAGTGTTTTTAAAACTACAGG - Intergenic
1087857180 11:103106491-103106513 GTTATTTATTTTACCAAGAATGG + Intergenic
1088360179 11:108981206-108981228 GTGCGTTTTTTCCCAAAGACTGG - Intergenic
1088642954 11:111891319-111891341 TTTATTTTTTTTCCAAGGACTGG + Intergenic
1089027848 11:115290290-115290312 GTTAGTTTTTTTTAAAAGCAGGG + Intronic
1089407619 11:118211417-118211439 GTTTGTTTTTTTATAGAGATGGG + Intronic
1090044723 11:123321092-123321114 GTTTGTTTGTTTATCAAGACAGG - Intergenic
1090151665 11:124391098-124391120 ATTAGTTTAGTTATAAAGACAGG - Intergenic
1091014692 11:132039426-132039448 TTTTTTTTTTTTAGAAAGACAGG + Intronic
1091758331 12:3070832-3070854 GATAATTTTTTTAAAAAAACAGG - Intergenic
1092203279 12:6600418-6600440 GGTAGTTTTTTTCCAATAACTGG - Intronic
1092249268 12:6883510-6883532 GTTTGTTTGTTTTAAAAGACAGG - Intronic
1092672099 12:10875298-10875320 TGTAATTTTTTTATAAAGACTGG - Intronic
1093159312 12:15727170-15727192 TTTAAATTTTTTACAAAGCCTGG + Intronic
1093734893 12:22609506-22609528 GTTTGTTTGTTTATAAAAACAGG - Intergenic
1094045744 12:26164747-26164769 TTTAATTGTTTTACAAAAACAGG - Intronic
1094201289 12:27797116-27797138 TTTTGTTTTTTTTTAAAGACAGG - Intronic
1094472451 12:30816411-30816433 GTTTGTATTTTTACAGATACTGG - Intergenic
1095890668 12:47233075-47233097 GTTAATTTTTGTATAAAGATGGG + Intronic
1096065208 12:48734280-48734302 GCTAATTTTTTTGTAAAGACGGG + Intergenic
1096369287 12:51055490-51055512 TTTAATTTTTTTGCAGAGACGGG - Intronic
1096562320 12:52445296-52445318 TTTAGTTTTTTTGTACAGACAGG + Intergenic
1096757972 12:53815956-53815978 TTTAATTTTTTTATAGAGACAGG + Intergenic
1097063981 12:56306688-56306710 GCTAATTTTTTTGCATAGACAGG + Intronic
1097292321 12:57928402-57928424 TTTAATTTTTTTATACAGACAGG - Intergenic
1097572689 12:61354850-61354872 GTTAATTTTTTTATTGAGACAGG - Intergenic
1097920175 12:65063717-65063739 GTTTGTTTTTTAAAAGAGACAGG + Intronic
1097927185 12:65142046-65142068 GTGAGTGTTTTTAAAAAGAAAGG + Intergenic
1099430080 12:82572835-82572857 GGTAGTATTTTTACAAAGAAAGG + Intergenic
1099756171 12:86852504-86852526 GTTATTTTTGTTGTAAAGACAGG - Intergenic
1100220394 12:92498713-92498735 ATTACTTTTTTTAAAAAAACAGG - Intergenic
1100261294 12:92934650-92934672 TTTAGTATTTTTGTAAAGACAGG - Intergenic
1100508294 12:95242700-95242722 TTTTGTATTTTTACAAATACAGG - Intronic
1100583628 12:95959412-95959434 GTTAATTTTTTTTTAGAGACAGG + Intronic
1100794833 12:98170842-98170864 GTTAGTGTTTTTATAGAGGCAGG - Intergenic
1100833064 12:98536824-98536846 GTTATTTTTATTATAAGGACTGG + Intronic
1100974855 12:100111911-100111933 GCTAGTTATTTTTTAAAGACAGG + Intronic
1101107064 12:101451208-101451230 GTTACTTTTTTTATAGAGACAGG + Intergenic
1101277373 12:103217343-103217365 GTGTGTTTTTTTGTAAAGACAGG - Intergenic
1101379952 12:104205819-104205841 TTTTGTTTTTTTGTAAAGACAGG + Intergenic
1101819767 12:108174791-108174813 GTGAGTTTTTTTGCAGAGATGGG + Intronic
1101950026 12:109167424-109167446 TTTAATTTTTTTGCAGAGACAGG - Intronic
1102189287 12:110974424-110974446 GCTAGTTTTTTTTCAGAGATGGG - Intergenic
1102265176 12:111477966-111477988 TTTTTTTTTTTTGCAAAGACAGG + Intronic
1102501222 12:113353926-113353948 GTTTGTTTGTTTTCAGAGACAGG + Intronic
1102614261 12:114139437-114139459 GTTAGGTTCTTTGCAAATACAGG - Intergenic
1102780341 12:115559006-115559028 TTAAGTTTTTTTGTAAAGACAGG + Intergenic
1102847876 12:116207170-116207192 GTAAGATTTTTTACAGAGATGGG + Intronic
1103437329 12:120937040-120937062 TTTAGTTTTTTTGTAGAGACTGG + Intergenic
1103504666 12:121434005-121434027 TTTTGTTTTTTTATAGAGACAGG - Intronic
1103547049 12:121709674-121709696 TTTTTTTTTTTTTCAAAGACAGG + Intergenic
1104130965 12:125893510-125893532 CTAATTTTTTTTGCAAAGACAGG - Intergenic
1104432149 12:128725115-128725137 TTTAGTTTTTATACAAACTCTGG + Intergenic
1104888914 12:132130131-132130153 CTTATTTTTTTTGCAGAGACGGG - Intronic
1105962473 13:25354638-25354660 TTTAATTTTTTTATAGAGACAGG - Intergenic
1106158778 13:27182342-27182364 TTTTGTTTTTTTTCAAAGATAGG - Intergenic
1106805447 13:33301878-33301900 GTTTCTTTTTTTAGAAAGACTGG + Intronic
1107211550 13:37862308-37862330 GTAAGTTGTTTTCCAAAGTCTGG - Intronic
1107593074 13:41929322-41929344 ATTAATTTTTTTATAGAGACAGG + Intronic
1109203059 13:59452422-59452444 TTTAATTTTATTCCAAAGACAGG + Intergenic
1109531572 13:63655387-63655409 GTTTGTTTTTTTAAAAACACCGG + Intergenic
1109694943 13:65942404-65942426 GTTTGTTTGTTTTCAGAGACAGG + Intergenic
1111309430 13:86463142-86463164 TTTATTTTTTTTATGAAGACTGG - Intergenic
1111868688 13:93802573-93802595 GTTTGTTTTTTTGTAGAGACAGG + Intronic
1111924528 13:94448314-94448336 GTAAGTTTTTTTGAAAAGACTGG + Intronic
1112471847 13:99696399-99696421 TTTAGTTTTTTTATAGAGACAGG + Intronic
1112496935 13:99912721-99912743 TTTTGTATTTTTACAGAGACAGG + Intergenic
1114332922 14:21656105-21656127 GTTGGTTTTTTTGTAGAGACAGG - Intergenic
1115015780 14:28611941-28611963 TTTTTTTTTTTTACAAAAACAGG + Intergenic
1115225380 14:31096698-31096720 TTTCGTTTTTTTTTAAAGACAGG + Intergenic
1115246126 14:31297473-31297495 GTTTGTTTGTTTAAAGAGACAGG - Intronic
1115386430 14:32803270-32803292 GTTTTTTTTTTTATAGAGACGGG - Intronic
1115605933 14:35002346-35002368 GTTTGTTTTTTTTTAAAGACAGG - Intronic
1115672922 14:35636078-35636100 TTTTGTTTTTTTTCAAAGAGAGG + Intronic
1115874718 14:37847316-37847338 TCTAGTTCTTTTACAAAGAAAGG - Intronic
1115941930 14:38619400-38619422 GTTTGTTTGTTTGCAGAGACAGG + Intergenic
1115978841 14:39027034-39027056 GTTTGTTTTTTTTTAGAGACAGG - Intergenic
1116753388 14:48915367-48915389 AACAGTTTTTTTAAAAAGACGGG + Intergenic
1117394111 14:55291797-55291819 GCTATTTTTTTTCTAAAGACAGG - Intronic
1117477431 14:56110641-56110663 GCTAATTTTTTTATAGAGACAGG - Intergenic
1118052456 14:62044192-62044214 TTTTTTTTTTTTTCAAAGACAGG - Intronic
1118202848 14:63693102-63693124 GTATTTTTTTTTATAAAGACAGG + Intronic
1118203469 14:63699569-63699591 TTCTGTTTTTTTAGAAAGACAGG + Intronic
1118216047 14:63809480-63809502 GTTTGTTTGTTTAAAGAGACAGG + Intergenic
1118343824 14:64918825-64918847 GTTTGTTTTTTTAAGTAGACAGG - Intronic
1118351665 14:64976571-64976593 GGTATTTCATTTACAAAGACCGG - Intronic
1118367943 14:65111384-65111406 TTTACTTTTTTTATACAGACAGG - Intergenic
1119388366 14:74273222-74273244 TTTAATTTTTTTATAGAGACAGG + Intergenic
1119447925 14:74682028-74682050 TTTAATTTTTTTAAAAAGGCTGG + Intronic
1120204002 14:81567992-81568014 TTTTGTTTTTTCAAAAAGACAGG - Intergenic
1120660505 14:87243744-87243766 GTAACTTTTTTAACAAATACTGG + Intergenic
1120800511 14:88683140-88683162 ATTAGATTTTTTACAAATTCTGG - Intronic
1120810613 14:88799554-88799576 GATAATTTTTTTTTAAAGACAGG - Intergenic
1121367082 14:93323115-93323137 GTTTGTTTTTTTTAAGAGACAGG - Intronic
1121396851 14:93632526-93632548 TTTAATTTTTTTATAGAGACTGG - Intronic
1121826341 14:97012821-97012843 TTTATTTTATTTGCAAAGACAGG + Intergenic
1122221756 14:100243619-100243641 TTTTGTTTTTTTGCAGAGACGGG - Intronic
1122472725 14:101982418-101982440 TTTTGTATTTTTACAAACACGGG - Intronic
1123816119 15:23981100-23981122 GTTTTTTTTTTTAGAGAGACAGG + Intergenic
1124352814 15:28970504-28970526 TTTTTTTTTTTTAGAAAGACAGG - Intronic
1125666555 15:41435378-41435400 GTTTTTTTTTTTATAGAGACTGG + Intronic
1125721479 15:41847188-41847210 GAGAGTTTTTTTCCAACGACTGG + Intronic
1125952004 15:43760217-43760239 TTTTGTATTTTTATAAAGACGGG - Intronic
1125962996 15:43848056-43848078 GTTTGTTTTTTTTAAGAGACAGG - Intronic
1125974574 15:43939730-43939752 GTTTGTTTTTTTGTAGAGACGGG + Intronic
1126008412 15:44280230-44280252 CTTAGTTTTTTTTTAGAGACAGG + Intergenic
1126028994 15:44477527-44477549 TTTTTTTTTTTTAAAAAGACAGG - Intronic
1126512829 15:49500197-49500219 GTTAGTTCGTTTTTAAAGACAGG - Intronic
1126591585 15:50345552-50345574 TTTACTTTTTTTTCGAAGACAGG - Intronic
1127823751 15:62684453-62684475 GTCAGATTTTTTTCAAAGAGAGG - Intronic
1127938146 15:63663628-63663650 TTTAATTTTTTTGTAAAGACAGG + Intronic
1128091299 15:64920718-64920740 ATTAATTTTTTTATAGAGACAGG + Intronic
1128200521 15:65802562-65802584 GTTTGTTTTTTAATAGAGACAGG - Intronic
1128208331 15:65872123-65872145 TTTTGTTTTTTTGTAAAGACAGG + Intronic
1128209856 15:65889729-65889751 GGTAGATTTTTTACAAAGTAAGG + Exonic
1128317817 15:66672083-66672105 TTTTGTATTTTTATAAAGACGGG - Intronic
1128355235 15:66921851-66921873 GTTTGTTTTTTTGTCAAGACAGG + Intergenic
1128399435 15:67262709-67262731 TTTATTTTTTGTAAAAAGACAGG - Intronic
1128794204 15:70452857-70452879 TTTTTTTTTTTTACAGAGACGGG + Intergenic
1128855484 15:71009443-71009465 ATAAATTTTTTTAAAAAGACTGG - Intronic
1129305673 15:74659698-74659720 TTTTATTTTTTTATAAAGACAGG - Intronic
1129359172 15:75013661-75013683 GCTAGTTTTTTTAAAGAGATGGG - Intronic
1129423208 15:75446661-75446683 TTTAATTTTTTTATAGAGACAGG + Intronic
1129435760 15:75538996-75539018 TTTATTTTTTTTATAGAGACTGG - Intronic
1130128943 15:81119882-81119904 TTTAATTTTTTTTTAAAGACAGG - Intronic
1130437577 15:83916772-83916794 TTTATTTTTTTTCTAAAGACTGG - Intronic
1132489940 16:222464-222486 GTTAATTTTTTCATAGAGACAGG - Intronic
1132731588 16:1365162-1365184 TTTTGTATTTTTACTAAGACGGG + Intronic
1133816925 16:9204533-9204555 GTTTGTTTTTTTTTAGAGACAGG + Intergenic
1133876007 16:9735116-9735138 TTTAGTTTTCTTACAAACAGAGG + Intergenic
1134034901 16:11022350-11022372 TTTTTTTTTTTTGCAAAGACAGG + Intronic
1134397529 16:13878733-13878755 TTTAATTTTTTTATAGAGACGGG - Intergenic
1134476888 16:14581746-14581768 TTTAATTTTTTTATAGAGACAGG - Intronic
1134642520 16:15840558-15840580 TTTAATTTTTTTACAGAGACAGG - Intronic
1135502573 16:23009859-23009881 GTTTTTTTTTTAACAAAAACAGG + Intergenic
1135558138 16:23454150-23454172 TTTAATTTTTTTGCAGAGACGGG - Intergenic
1135785204 16:25342447-25342469 GTTTGTTTTTTTTCCAAGACAGG - Intergenic
1135949785 16:26903286-26903308 GTGAGTTTATTTCCAAGGACTGG - Intergenic
1136058473 16:27708192-27708214 TTTAATTTTTTTGTAAAGACAGG + Intronic
1136113566 16:28080256-28080278 TTTTGTTTTTTTATAAAGACAGG + Intergenic
1136184760 16:28580852-28580874 TTTAATTTTTTTGTAAAGACGGG + Intronic
1136531179 16:30870491-30870513 TTTATTTTTTTTGTAAAGACGGG - Intronic
1136621917 16:31435292-31435314 TTTAGTTATTTTAGAGAGACAGG + Intronic
1136634508 16:31511164-31511186 TTTAATTTTTTTTAAAAGACAGG + Intergenic
1136867728 16:33770202-33770224 GTTTGTGTTTTTATAGAGACGGG - Intergenic
1137229241 16:46547275-46547297 TTTAGTTTTTTTAAAGAGATGGG - Intergenic
1137664724 16:50243354-50243376 GTTTGTTTTTTTAAAAAGACAGG + Intergenic
1137821178 16:51447576-51447598 TTTATATTTTTTATAAAGACAGG - Intergenic
1138681831 16:58689304-58689326 TTTAAATTTTTTGCAAAGACAGG + Intergenic
1139196619 16:64926345-64926367 GTTTGTTTTTTTGTAGAGACAGG - Intergenic
1140193715 16:72839306-72839328 GGTAGTTTTTGTCCAAAGAAAGG - Intronic
1140981577 16:80114998-80115020 TTTATTTTTTTTACAAGAACAGG + Intergenic
1141088491 16:81113716-81113738 ATTATTTTTTTTATAGAGACAGG - Intergenic
1141204984 16:81926477-81926499 GTTAGTGTTGTTATAAAGATAGG + Intronic
1142097476 16:88249741-88249763 TTTAATTTTTTTATAGAGACAGG + Intergenic
1142163034 16:88569227-88569249 GTTAATTTTTTTGTAGAGACAGG + Intergenic
1203104432 16_KI270728v1_random:1346001-1346023 GTTTGTGTTTTTATAGAGACGGG + Intergenic
1203129082 16_KI270728v1_random:1616367-1616389 GTTTGTGTTTTTATAGAGACGGG - Intergenic
1143127400 17:4652263-4652285 TTTAGTTTTTTCATAGAGACAGG - Intergenic
1143612593 17:8028171-8028193 GTTTGTTTGTTTTTAAAGACAGG + Intergenic
1143649006 17:8251455-8251477 ATTTTTTTTTTTATAAAGACAGG + Intronic
1143859660 17:9879489-9879511 GTTAATTTTTTTTAAGAGACAGG - Intronic
1144049204 17:11483782-11483804 TTTAATTTTTTTATAGAGACAGG - Intronic
1144178211 17:12728777-12728799 GGTTCTTTTTTTAAAAAGACTGG - Intronic
1144392111 17:14803379-14803401 TTTTGTTTTTTTATAGAGACGGG + Intergenic
1145185470 17:20790313-20790335 GTTTGTTTTTTTAAAGAGACAGG - Intergenic
1145820225 17:27827296-27827318 GTTATTTATTTTGCAGAGACAGG - Intronic
1145894398 17:28445282-28445304 TTTTTTTTTTTTATAAAGACAGG - Intergenic
1145966571 17:28922906-28922928 TTTATATTTTTTATAAAGACAGG - Intronic
1147707881 17:42440019-42440041 GTTTTTTTTTTTGTAAAGACAGG + Intergenic
1147881322 17:43655650-43655672 TTTTTTTTTTTTAGAAAGACAGG - Intronic
1148427601 17:47612959-47612981 GTAACTTTTTTTAAAAAGCCTGG + Intronic
1148726941 17:49799666-49799688 GTTTGTTTTTATAGAGAGACAGG + Intronic
1149662339 17:58340984-58341006 TTTTTTTTTTTTCCAAAGACAGG - Intergenic
1149749647 17:59133145-59133167 TTTTGATTTTTTACAGAGACAGG + Intronic
1150568829 17:66367942-66367964 GTAAGTTATTTTATAAACACAGG - Intronic
1150761900 17:67969789-67969811 TTTTGTTTTTTTGTAAAGACAGG - Intronic
1151006195 17:70438921-70438943 TTTATTTTTTTTGCAAACACAGG + Intergenic
1151281422 17:73077497-73077519 TTTTGTTTTTTGACAGAGACAGG + Intronic
1151583263 17:74992201-74992223 CTAAGTTTCTTTTCAAAGACAGG + Intronic
1152107277 17:78337963-78337985 TTTAATTTTTTTGCAGAGACGGG - Intergenic
1152385729 17:79973399-79973421 TTAATTTTTTTTATAAAGACGGG - Intronic
1152764979 17:82131567-82131589 GTTTGTTTTTTAATAGAGACAGG - Intronic
1152822202 17:82443080-82443102 GTTAGTTTTTTTACAAAGACAGG + Exonic
1152871915 17:82759018-82759040 GTTTGTTTTTTTAAAGAGATGGG + Intronic
1153166402 18:2266660-2266682 GTTTTTTTTTTTAAAGAGACAGG - Intergenic
1153177311 18:2391887-2391909 GGTAGATTTTTTTCAGAGACAGG - Intergenic
1153242123 18:3040766-3040788 TTTAATTTTTTTGTAAAGACAGG - Intergenic
1153506558 18:5805190-5805212 GTTAATTTTTTTAAAAAAAGAGG - Intergenic
1153567589 18:6434300-6434322 TTTAAATTTTTTACAGAGACCGG + Intergenic
1153802173 18:8681137-8681159 TTTAATTTTTTTGTAAAGACAGG + Intergenic
1153934277 18:9906943-9906965 TTTAATTTTTTTGCAGAGACGGG - Intergenic
1154086124 18:11307236-11307258 CTTTTATTTTTTACAAAGACAGG + Intergenic
1154322445 18:13366077-13366099 TTTATTTTTTTTAAAGAGACAGG + Intronic
1154384154 18:13878674-13878696 TTTAGTTTTTTTGTAAAGATGGG + Intergenic
1155076535 18:22361768-22361790 TATAGTTCCTTTACAAAGACCGG - Intergenic
1155194290 18:23458651-23458673 GTTAGATTTTTTACAAAAAGCGG + Intronic
1155848085 18:30734163-30734185 GTTAATTTTTTCAAAAAAACAGG - Intergenic
1156246042 18:35299629-35299651 TTTATATTTTTTATAAAGACAGG + Intergenic
1156247382 18:35314778-35314800 TTTTTTTTTTTTTCAAAGACTGG - Intergenic
1156328263 18:36094207-36094229 TTTATTTTTTTTGTAAAGACAGG + Intergenic
1156861667 18:41843380-41843402 GCTAATTTTTTTATAGAGACAGG + Intergenic
1157084360 18:44563798-44563820 TTAAGTTTTTTTAAAAAGTCAGG + Intergenic
1157250950 18:46095792-46095814 CTTATTTTTTTTATAGAGACAGG + Intronic
1157358751 18:46959457-46959479 GTTAGTTTTTTTTAAAAAAAAGG - Intronic
1157665254 18:49480591-49480613 GTAATTTTTTTTATAGAGACAGG - Intronic
1158568156 18:58573412-58573434 GTTTTTTTTTTTTCAGAGACAGG + Intronic
1158819219 18:61139336-61139358 GCTGGATTTTTTAAAAAGACTGG + Intergenic
1158855677 18:61541484-61541506 GTTTGTTTGATTACAAAAACAGG - Intronic
1158918112 18:62157367-62157389 GTTAGTTTTTTTTTAAATAGTGG - Intronic
1158980394 18:62754953-62754975 GTCACTTTTTTTTCAGAGACAGG - Intronic
1159082327 18:63749399-63749421 GTGAGTATTTTTAGTAAGACTGG - Intergenic
1159326288 18:66923845-66923867 ATGAGATTTATTACAAAGACTGG - Intergenic
1159366441 18:67471659-67471681 ACTAGTTTTTTTACAATGACAGG - Intergenic
1159672036 18:71232931-71232953 ATTAAATTTTTTATAAAGACAGG + Intergenic
1159704854 18:71674510-71674532 GATAGTTTTTTTGCACAGGCAGG + Intergenic
1161132830 19:2601740-2601762 GCTAATTTTTTTATAAAGACAGG - Intronic
1161194504 19:2978576-2978598 GTTTTATTTTTTACAGAGACAGG - Intronic
1161363544 19:3865520-3865542 GTTAATTTTTTTATAGAGATGGG + Intronic
1161414413 19:4137440-4137462 TTTTCTTTTTTTAGAAAGACAGG + Intergenic
1161602897 19:5195742-5195764 GCTAATTTTTTTACAGAGACAGG + Intronic
1161998058 19:7726536-7726558 GTTAGTTTTTTTGTAGAGATGGG - Intergenic
1162212195 19:9101139-9101161 GTTTCTTTTTTTCCATAGACAGG - Intergenic
1162323333 19:9983328-9983350 TTTAAATTTTTTACAGAGACAGG - Intronic
1162491968 19:10998059-10998081 GTTTGTTTTTTTGCAGAGATGGG + Intronic
1162651174 19:12090169-12090191 GTTTGTTTGTTTATAGAGACAGG + Intergenic
1162689977 19:12421420-12421442 TTTTTTTTTTTTACAGAGACAGG - Intronic
1162851269 19:13432985-13433007 TTAAGTTTTTTTATAAAGGCGGG - Intronic
1162880838 19:13658028-13658050 TTTATTTTTTTTAAAGAGACAGG - Intergenic
1163023950 19:14498720-14498742 GTTTGTTTTTTGATAGAGACAGG + Intergenic
1163240813 19:16062432-16062454 TTTTGTATTTTTGCAAAGACAGG - Intergenic
1163497148 19:17653189-17653211 TTTGGTTTTTTTTTAAAGACAGG + Intronic
1163706747 19:18818817-18818839 GTTATTTATTTTTCAGAGACAGG + Intergenic
1163768279 19:19175680-19175702 TTTTGTTTTTTTATAGAGACAGG + Intronic
1163993288 19:21020242-21020264 TTTATATTTTTTATAAAGACTGG + Intergenic
1164428653 19:28167595-28167617 TTTATTTTTTTTATAGAGACAGG + Intergenic
1164964072 19:32465469-32465491 GTTAGGTTCTTTAAAAAGAGAGG - Intronic
1164975363 19:32569023-32569045 TTTAATTTTTTTGCAGAGACGGG + Intergenic
1164985610 19:32646239-32646261 TTTAATTTTTTTATAGAGACAGG + Intronic
1165048991 19:33129399-33129421 TTTAATTTTTTTATAGAGACAGG - Intronic
1165783445 19:38447030-38447052 TTTATTTTTTTTGCAGAGACGGG - Intronic
1165784311 19:38452263-38452285 GTTATTTTTTTTATAGAGACAGG - Intronic
1166083600 19:40460454-40460476 TTTATTTTTTTTGCAGAGACGGG - Intronic
1166962644 19:46508048-46508070 TTTTGTATTTTTACTAAGACGGG - Intronic
1168031871 19:53686647-53686669 GTTTGTTTGTTTTCTAAGACGGG + Intergenic
1168512598 19:56985148-56985170 GTTAATTTTTTTGTAGAGACAGG - Intergenic
924991769 2:318602-318624 GTTAGTTCTTTTTCAAAAAGAGG - Intergenic
925687721 2:6490548-6490570 TTTTGTATTTTTAGAAAGACAGG + Intergenic
925816097 2:7751733-7751755 TTTACTTTTTATATAAAGACAGG + Intergenic
926363868 2:12115323-12115345 TTTACATTTTTTGCAAAGACAGG + Intergenic
926432919 2:12807976-12807998 GTTTGTATTTTAAAAAAGACTGG + Intergenic
927145149 2:20159960-20159982 GTTAATTTTTTTATACAGCCTGG + Intergenic
927258456 2:21061580-21061602 TTTCGTTTTTTTAAAAAAACTGG + Intergenic
927539322 2:23893674-23893696 TTTTTTTTTTTTACGAAGACAGG + Intronic
927659256 2:24979044-24979066 TTTATTTTTTTTTCAGAGACGGG + Intergenic
927724552 2:25411415-25411437 GTTATTTTTTTTCCAAAAAGAGG - Intronic
927760770 2:25751626-25751648 CTTTTTTTTTTTTCAAAGACAGG - Intronic
927947177 2:27142531-27142553 GCTACTTTTTTTGTAAAGACGGG - Intergenic
928519998 2:32079344-32079366 GTTAATTTTTTTCTAAAGACAGG - Intronic
928563462 2:32517024-32517046 GTTAGTTTTATTAAGAAGAAGGG + Intronic
928599931 2:32894572-32894594 TTTAATTTTTTTGTAAAGACAGG - Intergenic
928745248 2:34406100-34406122 GTTATTATTTTTGCAAAGAAGGG + Intergenic
928871540 2:35986936-35986958 GTTAGGCTTTCTAGAAAGACTGG + Intergenic
929703485 2:44186544-44186566 GTTTTTTTTTTTATAGAGACAGG + Intronic
929729423 2:44471592-44471614 GTTAATTTTTTTTCTGAGACAGG - Intronic
930312748 2:49762393-49762415 TTTAGTTTTTCCACAAGGACAGG + Intergenic
930355797 2:50317721-50317743 GTTAATATTTTTACAAAGTAAGG - Intronic
930442926 2:51431800-51431822 GTTAGTTTTGGCAAAAAGACTGG + Intergenic
930688605 2:54335624-54335646 ATTATCTTTTTTACAAAGTCAGG + Intronic
931057798 2:58492302-58492324 GTTATTTTTTTTAAAAAAAAAGG - Intergenic
931083449 2:58801821-58801843 GTTGTTTTCTTTACAAAGAAGGG + Intergenic
931135335 2:59393061-59393083 GTTGGGTTGTTTGCAAAGACAGG + Intergenic
931522191 2:63111123-63111145 TTTAATTTTTTTATAGAGACAGG - Intergenic
931595224 2:63934654-63934676 TTTTATTTTTTTACAAAAACTGG - Intronic
931717204 2:65038553-65038575 GTAATTTTTTTTATAGAGACAGG - Intergenic
931806396 2:65810912-65810934 GTTTGTTTGTTTTCAGAGACAGG - Intergenic
932249221 2:70226346-70226368 GGTAGTTTTTTTGAAAACACGGG - Intronic
932535856 2:72594152-72594174 TTTAAATTTTTTACAGAGACAGG + Intronic
932551865 2:72778890-72778912 ATTAGTTTTTTTAAAAAAGCAGG + Intronic
932754038 2:74392573-74392595 TTTTGTTTTTTTGTAAAGACGGG + Intergenic
933471410 2:82730333-82730355 TTTTGTATTTTTATAAAGACAGG - Intergenic
934058936 2:88276069-88276091 GTTAGGTTTTTTGGAGAGACAGG - Intergenic
935060800 2:99605857-99605879 ATTTTTTTTTTTATAAAGACAGG + Intronic
935535646 2:104290541-104290563 ATTATTTTTTTAACAAATACAGG + Intergenic
935665941 2:105512686-105512708 GTTAGTTTGTCTAAAAAGAAAGG + Intergenic
935988608 2:108698745-108698767 TTTTGTTTTTTTATAGAGACAGG + Intergenic
936471759 2:112805150-112805172 CTTATTTTTTTTTTAAAGACAGG - Intergenic
936729676 2:115365529-115365551 TTTATTTTTTTTTCTAAGACTGG + Intronic
936848707 2:116870243-116870265 GTTTGTTTTTTCAAAAAGCCAGG + Intergenic
938506620 2:131891245-131891267 ATTATTTTTTATACAAAAACGGG + Intergenic
938759247 2:134408876-134408898 GTTTATTTTTATACAATGACTGG - Intronic
938859579 2:135353827-135353849 GTACGTTTTTTTATAGAGACAGG - Intronic
938907567 2:135853277-135853299 GCTAGTTTTTTTGTAGAGACAGG - Intronic
939487490 2:142833417-142833439 TTTGGTTTTTTTTCTAAGACAGG + Intergenic
940123948 2:150301700-150301722 ATTAATTTTTTTAAAAAGATAGG - Intergenic
940191063 2:151040490-151040512 GTTAGTGTGTTTACAAATAGTGG - Intronic
940310175 2:152270553-152270575 TTTATTTATTTTACAGAGACGGG - Intergenic
940587068 2:155666126-155666148 GTTAGACTTGCTACAAAGACAGG - Intergenic
940901534 2:159130726-159130748 GTTTATTTTTTTAAAGAGACAGG + Intronic
941046332 2:160679699-160679721 GTTACTCTTCTTACAAAGATAGG + Intergenic
941097780 2:161260192-161260214 TTTAATTTTTTTACAGAGATTGG + Intergenic
941448664 2:165632501-165632523 GTTATTTTTTTTAAAGAGACAGG - Intronic
941789515 2:169536101-169536123 TTTAATTTTTTTATAGAGACAGG - Intronic
941982084 2:171469809-171469831 GTTAGTTTGTTTTTCAAGACAGG + Intronic
942060297 2:172223205-172223227 ATTAAATTTTTTACAGAGACAGG - Intergenic
942178597 2:173357716-173357738 TTTAATTTTTTTAAAAAAACAGG + Intronic
942220987 2:173768734-173768756 ATAAGTTTTTTTAAAGAGACAGG - Intergenic
942919818 2:181358899-181358921 GTGAAATTTTTTCCAAAGACTGG + Intergenic
942970575 2:181953257-181953279 TTTAATTTTTTTGTAAAGACGGG - Intergenic
944229083 2:197375412-197375434 TTTTTTTTTTTTGCAAAGACAGG - Intergenic
944375786 2:199040121-199040143 GATTGTTTTTTTTGAAAGACTGG - Intergenic
944411858 2:199453535-199453557 GTTAGTTTTTTTATAATTAAAGG - Intronic
945003462 2:205376911-205376933 GTTTTGTTTTTTAAAAAGACTGG + Intronic
945421490 2:209642419-209642441 TTTTTTTTTTTTTCAAAGACAGG - Intronic
945474305 2:210263523-210263545 TTTAATTTTTTTATAGAGACAGG - Intergenic
946590672 2:221243833-221243855 GTGAGTTTTCTTACATATACTGG - Intergenic
946596525 2:221311372-221311394 GTAAGTTTTTATATAGAGACAGG + Intergenic
946886089 2:224224833-224224855 CTTAGTTTCTTTACTAAGACTGG - Intergenic
947187486 2:227468200-227468222 TTTAGTTGTTTTAAAGAGACAGG - Intergenic
947364420 2:229379504-229379526 TTTAGATTTTTTACAATGATAGG + Intronic
947631266 2:231654830-231654852 GCTAATTTTTATACAGAGACAGG - Intergenic
947855068 2:233318340-233318362 TTTTGTTTTTTTATAGAGACAGG + Intronic
947942989 2:234075345-234075367 GATGGTGTTTTTAAAAAGACAGG - Intronic
1168769016 20:402377-402399 GTTTCTTTTTTAAAAAAGACAGG + Intergenic
1169639871 20:7739783-7739805 TTTTGTTTTTTAATAAAGACTGG - Intergenic
1169649952 20:7855863-7855885 GAAACTTTATTTACAAAGACAGG - Intergenic
1169895423 20:10500577-10500599 TTTAATTTTTTTGCAGAGACAGG - Intronic
1170217516 20:13907391-13907413 TTTAGTTTTTTTTTTAAGACAGG - Intronic
1170284602 20:14692432-14692454 GTTATTTTGTCTAAAAAGACAGG - Intronic
1171331535 20:24343488-24343510 ATTATTTTTTTTTCTAAGACAGG + Intergenic
1172081786 20:32347236-32347258 GTTATTTTTTATAAAGAGACAGG + Intergenic
1172253660 20:33497852-33497874 TTTATTTTTTTTATAGAGACAGG + Intronic
1172396394 20:34609106-34609128 GTTGGTTTTTTTTTAGAGACAGG - Intronic
1172402673 20:34663303-34663325 TTTTGTTTTTTTATAGAGACAGG - Intronic
1172433137 20:34909184-34909206 TTTTTTTTTTTTGCAAAGACAGG - Intronic
1172627541 20:36356665-36356687 TTTTTTTTTTTTACAAAAACAGG - Intronic
1172849696 20:37952422-37952444 TTTTGTATTTTTACAGAGACTGG - Intergenic
1172958177 20:38777329-38777351 GTTTGTTTTTTAATAGAGACAGG - Intergenic
1173217454 20:41098824-41098846 TTTTTTTTTTTTACAAAAACAGG - Intronic
1173527040 20:43740709-43740731 GTTTGTTTTTTTTCAGTGACAGG - Intergenic
1173539602 20:43841480-43841502 GTTTGTTTGTTTGTAAAGACAGG + Intergenic
1174610359 20:51793307-51793329 CTTATTTTTTTTATAGAGACGGG - Intronic
1176628296 21:9113891-9113913 GTTTGTTTTTTTTTTAAGACAGG - Intergenic
1176946837 21:14992218-14992240 GTTTGTTTGTTTATAGAGACGGG + Intronic
1177213166 21:18095385-18095407 TTTAGTTTTTTTAAATATACTGG - Intronic
1177278552 21:18948588-18948610 TTTAATTTTTTTATAGAGACAGG + Intergenic
1178307044 21:31499533-31499555 CTTAATTTTTTTTCAGAGACAGG - Intronic
1178351783 21:31876816-31876838 TTTAAATTTTTTATAAAGACAGG + Intronic
1179485605 21:41708467-41708489 GTTTATTTTTTTATAGAGACAGG + Intergenic
1179834661 21:44022464-44022486 TTTTTTTTTTTTACAAAGACGGG + Intronic
1180307214 22:11139265-11139287 TTTATTATTTTTAAAAAGACAGG + Intergenic
1180545734 22:16501449-16501471 TTTATTATTTTTAAAAAGACAGG + Intergenic
1181752608 22:24999732-24999754 GTTCAGTTTTTTGCAAAGACAGG + Intronic
1182191014 22:28460854-28460876 GTAAGTTTTTTTGTAGAGACGGG + Intronic
1182473378 22:30562054-30562076 GATAATTTTTTTAAAAAGACAGG + Intronic
1182578226 22:31288203-31288225 TTTAATTTTTTTATAGAGACAGG - Intronic
1182878357 22:33711830-33711852 TTTATTTTTTTTGCAGAGACAGG + Intronic
1183210163 22:36446372-36446394 TTTTGTATTTTTGCAAAGACGGG + Intergenic
1183526220 22:38324579-38324601 GTTTGTTGTTTTATAGAGACAGG + Intronic
1183547434 22:38462036-38462058 GTTATTTTTTTCTAAAAGACAGG - Intergenic
1183767085 22:39888271-39888293 TTTTTTTTTTTTCCAAAGACAGG + Intronic
1183846905 22:40549068-40549090 GTTTGTTTTTTTTAAGAGACAGG + Intronic
1184843584 22:47066958-47066980 ATGAGTTTTTTTAAAAGGACTGG - Intronic
1184873071 22:47253171-47253193 GTTTGTTTTTTTAGAGAGATGGG + Intergenic
1185378822 22:50496901-50496923 TTTATTTTTTTAATAAAGACGGG - Intergenic
949315680 3:2752134-2752156 GATAGTTATTTTAAAAAGACAGG - Intronic
949834457 3:8252905-8252927 TTTAGATTTTTTATAGAGACAGG - Intergenic
950742109 3:15060339-15060361 TTTAATTTTTTTATAGAGACAGG - Intronic
950825621 3:15817022-15817044 TTTTGTTTTCTTACAGAGACAGG - Intronic
951402176 3:22246553-22246575 GTTAGTTTTATAGCAAAGTCAGG - Intronic
951714659 3:25627758-25627780 GTTTGTTTTTTTCCAAAGTCAGG - Intronic
951933974 3:28001445-28001467 TTTAATTTTTTTGCAGAGACAGG - Intergenic
952371123 3:32723905-32723927 TTTAATTTTTTTGCAGAGACAGG - Intronic
952769089 3:36981198-36981220 TTTAATTTTTTTATAGAGACAGG + Intergenic
952814971 3:37439320-37439342 TTTTGTTTTTTTGCAGAGACAGG - Intergenic
953014822 3:39063769-39063791 GTTTTTTTTTTTGCAGAGACAGG - Intronic
954153135 3:48669083-48669105 TTTTTTTTTTTTACAGAGACGGG + Intergenic
954820147 3:53319138-53319160 GATTGTTTTTTTACAAAAATAGG - Intronic
954956022 3:54518822-54518844 GTTATTTTTTTTACTTATACAGG + Intronic
955099040 3:55828964-55828986 GCTAATTTTTTTATAGAGACAGG - Intronic
955355487 3:58227933-58227955 GCTATTTTTTTTGTAAAGACTGG - Intergenic
955683358 3:61525711-61525733 GTTTGTTTTGTTTCAGAGACAGG + Intergenic
955892722 3:63666978-63667000 TTTTGTTTTTTGACAAACACAGG + Intronic
955932514 3:64071783-64071805 TTTTGTTTTTTTACAAATATGGG + Intergenic
956692709 3:71892514-71892536 GTTTTATTTTTTACAGAGACAGG + Intergenic
956745685 3:72309322-72309344 GGTAGATTTTTTACAAAGTGGGG + Intergenic
957006221 3:74950420-74950442 GTTGATTTTATTACAAATACAGG - Intergenic
959148713 3:102581726-102581748 TTTTGTTTTTTTGTAAAGACAGG - Intergenic
959201068 3:103248375-103248397 CTTAGTTGTTTTTCAAAAACCGG - Intergenic
959286975 3:104427211-104427233 GTTTCTTTTTTTGCAGAGACAGG - Intergenic
959427317 3:106207007-106207029 AATAGTTTTGTTGCAAAGACAGG + Intergenic
959797525 3:110449060-110449082 GTTAGTATTTTTGCAATGAAAGG + Intergenic
959843329 3:111003561-111003583 GTTAATTTTTTTATAAGGAAGGG - Intergenic
960133400 3:114081607-114081629 TTTAAATTTTTTGCAAAGACAGG + Intronic
960187757 3:114664463-114664485 GTTAGTTTTATTGTAATGACTGG - Intronic
960421580 3:117452625-117452647 ATTTGTTTATTTAAAAAGACTGG + Intergenic
961223031 3:125214618-125214640 GTTTGTTTTTTTTTTAAGACAGG - Intergenic
961723911 3:128913365-128913387 TTTAGTTTCTTTACAAGAACTGG + Intronic
962101518 3:132347653-132347675 TTTAAATTTTTTGCAAAGACAGG + Intronic
962387268 3:134942096-134942118 GTTTCTTCTTTCACAAAGACAGG + Intronic
963881038 3:150528690-150528712 GTTAGTATTTTTATAATGATTGG - Intergenic
964628046 3:158777894-158777916 GTTTATTTTTTGACAAAAACAGG + Intronic
964692740 3:159470094-159470116 TTTAGTGTTTTTAGGAAGACTGG - Intronic
964762514 3:160147682-160147704 TTTAATTTTTTTATACAGACAGG + Intergenic
965570119 3:170164026-170164048 GTTTGTTTTTTTATAGAGAAGGG - Intronic
965679764 3:171237748-171237770 TTTAGATTTTTTATAGAGACGGG - Intronic
965924043 3:173956162-173956184 TTTATTTATTTTAAAAAGACAGG - Intronic
966042001 3:175502880-175502902 TTTAGTTTTTGTAAGAAGACAGG + Intronic
966699635 3:182833498-182833520 GTTATTTTTTTTGTAGAGACAGG + Intronic
966960273 3:184929359-184929381 TTTAGTTTTTTTGTAGAGACGGG + Intronic
967012608 3:185450761-185450783 TTTATTTTTTTTTCAGAGACGGG - Intronic
967029591 3:185593279-185593301 TTTAGTTTTTTAATAGAGACAGG + Intronic
967258197 3:187614706-187614728 GTTAGTTTTTGCAAAATGACTGG + Intergenic
967377191 3:188817750-188817772 TTTAGTTTTTAGACAAACACAGG - Intronic
967405164 3:189107374-189107396 ATTAGTTTTTGTCCAAAGAGTGG + Intronic
967688043 3:192440152-192440174 GGAAGTTATTTTTCAAAGACTGG + Intronic
968768435 4:2487591-2487613 TTTAATTTTTTTATAGAGACAGG + Intronic
969457216 4:7306934-7306956 ATTAGTTATTTGACAAAGAAGGG + Intronic
969711123 4:8844601-8844623 GTTTGTTTTTTATTAAAGACAGG - Intergenic
969993299 4:11286680-11286702 TTGCTTTTTTTTACAAAGACAGG + Intergenic
970250580 4:14111388-14111410 CTCAGTCTTTTTAGAAAGACAGG - Intergenic
970976667 4:22049695-22049717 GTTAATTTGTTTACAAAGCCTGG + Intergenic
971135004 4:23858814-23858836 TTTAGCCTTTTTAGAAAGACAGG + Intronic
971286666 4:25296762-25296784 TTTTTTTTTTTTTCAAAGACAGG + Intergenic
972051877 4:34745326-34745348 GACATTTTCTTTACAAAGACTGG + Intergenic
972178197 4:36433619-36433641 GTTTGTCTTTTTCCAAAGCCTGG + Intergenic
972365477 4:38370619-38370641 TTTAGTTTTTTTGTAGAGACAGG + Intergenic
972612021 4:40664592-40664614 ATTATTTTTTATATAAAGACAGG + Intergenic
972623143 4:40768740-40768762 GTTACATTTTATACAAAGAATGG - Intronic
972763083 4:42125910-42125932 GTTAATTTTTTTGCAGAGATAGG + Intronic
973040874 4:45469117-45469139 GTTATTTTTGTTAAAAATACTGG + Intergenic
973056800 4:45669885-45669907 GTAAGCTATTTTACAAAGACAGG + Intergenic
973686041 4:53370904-53370926 ATTTTTTTTTTTACAGAGACAGG + Intergenic
973714397 4:53660856-53660878 GTTATTTTTTTAAAAAAGAATGG + Intronic
973848965 4:54942314-54942336 ATTCATTTTTTTTCAAAGACAGG - Intergenic
974728135 4:65823612-65823634 AGTAGTGTTTTTAAAAAGACAGG - Intergenic
974979822 4:68941080-68941102 GCTAGTTGTTTTACAAAACCTGG + Intronic
975081241 4:70283059-70283081 TTTATTTTTTTAACAGAGACAGG - Intergenic
975198517 4:71555861-71555883 TTTGGTTTTTTTAAAGAGACAGG - Intronic
975925661 4:79448672-79448694 TTTAATTTTTTTAAAAAGAGAGG - Intergenic
976619760 4:87115614-87115636 TTTTTTTTTTTTCCAAAGACAGG + Intronic
976652208 4:87448024-87448046 TTTTTTTTTTTTAAAAAGACAGG - Intronic
977098997 4:92784298-92784320 TTTATTATTTTAACAAAGACTGG + Intronic
977138403 4:93335859-93335881 GCTAGTTTTTTTGTAGAGACAGG + Intronic
977743472 4:100516004-100516026 GTTTGTTTGTTTACAGATACTGG + Intronic
978215342 4:106194457-106194479 GTTAATTTTTTTTCAAAGGGGGG + Intronic
978443595 4:108759749-108759771 GTTTGTTATTTTACAAATTCAGG - Exonic
978804438 4:112785671-112785693 TTTTGTTTTTTTAAAGAGACAGG + Intergenic
979455903 4:120925266-120925288 GTTATTTATTTTTTAAAGACTGG - Intergenic
979929664 4:126615576-126615598 TGTAATTTTTTTAGAAAGACAGG + Intergenic
979966649 4:127084563-127084585 GTTTGTATTTTTAGAGAGACAGG + Intergenic
980011249 4:127597091-127597113 GTTTGTTTGTTTATAGAGACAGG + Intergenic
980165885 4:129226514-129226536 TTTAATTTTTTTGTAAAGACAGG - Intergenic
980834726 4:138177207-138177229 GTTTGTTTTTTTAGTAACACTGG + Intronic
980935353 4:139220717-139220739 TTTTTTTTTTTTCCAAAGACAGG - Intergenic
980989031 4:139722634-139722656 CTTATTTTTTTCACAAATACAGG - Intronic
981102135 4:140840849-140840871 GCTAATTTTTTTACAATGAATGG - Intergenic
981594512 4:146404189-146404211 TTTAATTTTTTTGTAAAGACGGG + Intronic
981942113 4:150292985-150293007 ATTACTTTTTTTATAAAGCCAGG - Intronic
982223015 4:153140938-153140960 TTTAATTTTTTTTTAAAGACAGG + Intergenic
982256776 4:153458548-153458570 GTTAGTTTTTTTAGAGATGCGGG + Intergenic
983182237 4:164662062-164662084 TTTAGTGTTATTACAAAGCCAGG + Intergenic
983561440 4:169105719-169105741 GCTAATTTTTTTGTAAAGACGGG - Intronic
983867657 4:172788172-172788194 GTTTGTTTTTTTGTAGAGACAGG - Intronic
983942890 4:173554526-173554548 TTTTATTTTTTTATAAAGACAGG - Intergenic
983980929 4:173996256-173996278 TTTTTTTTTTTTATAAAGACAGG + Intergenic
984156170 4:176198334-176198356 TTTAAATTTTTTATAAAGACGGG + Intergenic
984339135 4:178431336-178431358 TTTATTTTTTTTTTAAAGACAGG - Intergenic
984492073 4:180446883-180446905 GTTTGTTTTTTGATAGAGACAGG - Intergenic
984743596 4:183191731-183191753 TTTAGTTTTTTTTTAGAGACAGG + Intronic
984806618 4:183757510-183757532 GTCAATTTTTTTACAGAGACGGG - Intergenic
984916725 4:184732094-184732116 GTTTGTTTTTTTAAAAATGCTGG - Intronic
985503393 5:263109-263131 TTTATATTTTTTACAGAGACAGG + Intergenic
985734300 5:1569174-1569196 TTTATATTTTTTACAGAGACAGG - Intergenic
986976188 5:13397094-13397116 TTTAGTTTTTTTGTAGAGACAGG + Intergenic
987588254 5:19887741-19887763 TTTAATTTTTTTGTAAAGACTGG + Intronic
987589009 5:19898534-19898556 GTTAGTTTTTTTTAAAAAAAGGG + Intronic
987824132 5:23006525-23006547 TTTAATTTTTTTTCAGAGACAGG - Intergenic
987852005 5:23367376-23367398 AATAGTTTTTTTAAGAAGACAGG + Intergenic
987939009 5:24508528-24508550 TTTTCTTTTTTTACAAAGACAGG + Intronic
988015699 5:25556315-25556337 GTTTGTTTATTTACAAACAATGG + Intergenic
988040198 5:25879165-25879187 TTTAGTTTTTTTTTTAAGACAGG - Intergenic
988137242 5:27189601-27189623 GTTAGTTTTTTTCTAAATATTGG - Intergenic
989036746 5:37181641-37181663 TTTAAATTTTTTATAAAGACAGG - Intronic
989783567 5:45300054-45300076 CTAAGGTTTTATACAAAGACTGG - Intronic
990555385 5:56929394-56929416 GTTTGTTTTTTTGTAAAGACAGG - Intronic
991158807 5:63470376-63470398 GTTTGTTTGTTTGTAAAGACAGG - Intergenic
991469810 5:66955992-66956014 GTTTGTTTTTTGGTAAAGACAGG + Intronic
991693985 5:69252513-69252535 TTTTTTTTTTTTAAAAAGACAGG + Intronic
992297757 5:75343151-75343173 TTTAATTTTTTTTTAAAGACTGG - Intronic
992629714 5:78668434-78668456 TTTTGTATTTTTATAAAGACAGG + Intronic
992727206 5:79619913-79619935 TTTAATTTTTTTTCAGAGACTGG + Intronic
992793746 5:80237199-80237221 GGCAGTGTTTTCACAAAGACTGG + Intronic
993566803 5:89486524-89486546 GTTTGTTCTATTAAAAAGACCGG + Intergenic
993992712 5:94679584-94679606 GTTTTTTTTTTTAAAGAGACAGG - Intronic
994138753 5:96319159-96319181 GTTAGTTGTTTAACAGAGCCTGG - Intergenic
994702835 5:103158747-103158769 TTTAATTTTTTTGCAGAGACAGG - Intronic
995812141 5:116119606-116119628 ATTATTTTTTTTCCAGAGACAGG + Intronic
996553488 5:124753575-124753597 TTTTGTTTTTTTAAAAAGACAGG - Intergenic
996570762 5:124930227-124930249 GTTAATTTTTTTATAGAAACGGG + Intergenic
996662510 5:126021015-126021037 GGGAGTGTTTTTCCAAAGACTGG - Intergenic
996886978 5:128368848-128368870 TTTTTTTTTTTTACCAAGACAGG + Intronic
997017267 5:129950782-129950804 GTTATTTATTCTACAAACACAGG - Intronic
997114660 5:131112966-131112988 GCTAGATTTTTTAAAAAGAAAGG + Intergenic
997192100 5:131946620-131946642 GTAAATTTTTTTATAGAGACGGG + Intronic
997776625 5:136614257-136614279 ATTAGTTTTTTTTTAAAGAATGG + Intergenic
997910413 5:137866455-137866477 ATTAGTTTTTTTTTAGAGACAGG - Intergenic
998219456 5:140264663-140264685 GTTTTTTTTTTTGTAAAGACAGG - Intronic
998611934 5:143698861-143698883 GTTTGTTTTTTTTCAGAGAGAGG - Intergenic
999035344 5:148342820-148342842 GTTACCTGTTTTACAAGGACTGG - Intergenic
999916913 5:156272800-156272822 GTAACTTTATTTACAAAAACAGG - Intronic
1000095170 5:157965349-157965371 GTAACTTTATTTACAAACACAGG + Intergenic
1000478382 5:161741541-161741563 ATTTGTTTTTTTACATAAACAGG - Intergenic
1001504092 5:172263100-172263122 GTTAATTTTTTTGTACAGACAGG + Intronic
1002382353 5:178839850-178839872 GTTTGTTTTTTTGCAGAGGCAGG + Intergenic
1002518866 5:179779181-179779203 TTTTTTTTTTTTACAGAGACAGG - Intronic
1003578677 6:7319897-7319919 GAGAGTTTTTTTTTAAAGACAGG - Intronic
1004675800 6:17841084-17841106 TTTTTTTTTTTTCCAAAGACAGG + Intronic
1005055646 6:21726445-21726467 TTTCATTTTTTTGCAAAGACTGG + Intergenic
1005081152 6:21957843-21957865 GTTTGTTTGTTTACAGAGACAGG - Intergenic
1005205307 6:23396108-23396130 GATAGTTTTTATAAAAAGATGGG + Intergenic
1005523517 6:26622877-26622899 GTTAATTTTTTTAGAAAAATAGG + Intergenic
1005984977 6:30865980-30866002 TTTATTTTTTTTTCCAAGACAGG - Intergenic
1006125689 6:31836408-31836430 TTTAGTTTTTTTACAGAAGCGGG + Intronic
1006172813 6:32104806-32104828 TTAATTTTTTTTGCAAAGACAGG + Intronic
1007000197 6:38304613-38304635 GTTTGTTTGTTTATAAAGACAGG + Intronic
1007055050 6:38874539-38874561 TTTAGATTTTTTATAGAGACAGG + Intronic
1007545881 6:42694197-42694219 TTTGGTTTTTTTAAAGAGACAGG + Intergenic
1007553893 6:42750333-42750355 GTATTTTTTTTTGCAAAGACAGG + Intronic
1007806626 6:44455171-44455193 GTTAGTTTTTTTGTAGTGACAGG + Intergenic
1007832155 6:44646961-44646983 TTTTTTTTTTTTTCAAAGACAGG + Intergenic
1007852449 6:44817053-44817075 GTTTGTATTTTTAAAGAGACAGG - Intronic
1008252243 6:49254337-49254359 TTTAGTATTTTTATAGAGACGGG - Intergenic
1008935095 6:56982850-56982872 GTTAGTTTTGTGCCAAAGACAGG - Intronic
1008939485 6:57030752-57030774 GAAAGTTTTTTCATAAAGACGGG + Intergenic
1009934181 6:70213971-70213993 GTTTTTATTTTTACAGAGACAGG + Intergenic
1010085832 6:71917011-71917033 GTAAGTCTTTTTTCAAACACTGG - Intronic
1010367523 6:75068751-75068773 GGTGGTTTCTTTACAAATACTGG - Intergenic
1010920950 6:81679982-81680004 GTTAATTTTTTTGTAGAGACTGG - Intronic
1011068039 6:83350469-83350491 GTTTGTTTTTTTTCTGAGACAGG + Intronic
1011617100 6:89207198-89207220 GTTAATTTTTTTTTGAAGACAGG + Intronic
1011620568 6:89238340-89238362 GATAGTTTTTTTCCAAAAAATGG - Intergenic
1011671773 6:89690398-89690420 TTTATATTTTTTACAGAGACAGG - Intronic
1011697156 6:89922695-89922717 TTTTGTTTTTTTTAAAAGACAGG + Intergenic
1012893437 6:104922545-104922567 GATATTTTTTTTAGCAAGACAGG + Intergenic
1013039201 6:106417164-106417186 GTTATTTTTTTTTAAAAGACAGG + Intergenic
1013364760 6:109428377-109428399 CTTAATTTTTTTGTAAAGACAGG - Intronic
1014117754 6:117685521-117685543 GCTAATTCTTTTATAAAGACAGG + Intronic
1014462183 6:121709219-121709241 TTTATTTATTTTATAAAGACGGG - Intergenic
1014472923 6:121838185-121838207 TTTATTTTTTTGACAAAAACAGG - Intergenic
1016484648 6:144523744-144523766 TTTAGTTTTTTTAAAGAGAATGG - Intronic
1016620612 6:146104839-146104861 GTTAGATCTTCTACAAAGATGGG + Intronic
1016835714 6:148474741-148474763 TTTAAATTTTTTACAGAGACAGG + Intronic
1016859186 6:148699455-148699477 TTTTTTTTTTTTTCAAAGACAGG + Intergenic
1017096685 6:150811273-150811295 GTTTTTTTTTTTTTAAAGACAGG + Intronic
1017367017 6:153655040-153655062 GTCAGTGGTTTTCCAAAGACAGG + Intergenic
1017498448 6:155002235-155002257 TGTATTTTTTTTACAGAGACAGG - Intronic
1017578019 6:155827814-155827836 TTTATTTTTTTTGCAAATACTGG - Intergenic
1017731247 6:157318392-157318414 GCTAATTTTTTTATAGAGACAGG + Intronic
1018176936 6:161185294-161185316 TTTTTTTTTTTTCCAAAGACAGG + Intronic
1019566919 7:1687900-1687922 TTTATTTTTTTTATAGAGACAGG + Intergenic
1019721018 7:2571188-2571210 TTTAGATTTTTTATAGAGACAGG + Intronic
1020065175 7:5182881-5182903 ATTAGTTTCTTTAAAAAGAAGGG - Intergenic
1020549256 7:9579682-9579704 ATTAGTTTTTTGACAAATAAGGG - Intergenic
1020831013 7:13095671-13095693 GTTAATTTTTTTAAAAAGGTGGG + Intergenic
1020905141 7:14054600-14054622 GTTAATTTTTTTAAAGAGATGGG + Intergenic
1021437831 7:20641509-20641531 ATTTGCTTTTTTAAAAAGACGGG - Intronic
1021519225 7:21522546-21522568 TTTAATTTTTTTGTAAAGACAGG + Intergenic
1021688320 7:23209128-23209150 ATTATTATTTTTAAAAAGACGGG - Intergenic
1021993008 7:26154554-26154576 GTTTGTTTTGTTTTAAAGACAGG + Intronic
1022074781 7:26956591-26956613 TTTTGTTTTTTTCCAAAGACTGG - Intronic
1022264016 7:28735973-28735995 TTTAAATTTTTTACAGAGACAGG + Intronic
1023430573 7:40086975-40086997 GCTAATTTTTTTATAGAGACAGG + Intronic
1024029441 7:45445588-45445610 TTTTGTATTTTAACAAAGACAGG - Intergenic
1024321505 7:48075760-48075782 TTTAATTTTTTTATACAGACAGG - Intergenic
1024907027 7:54394788-54394810 TGTAGTTTTTTTACAAAACCTGG - Intergenic
1025019474 7:55469409-55469431 GTTAGTTTTATCACAAAAATGGG + Intronic
1025899654 7:65733352-65733374 TTTAGTTTTATAATAAAGACAGG - Intergenic
1025901553 7:65749175-65749197 GTTTGTATTTTTACAGAGACAGG + Intergenic
1025997746 7:66538845-66538867 GTTTGTTTTTTTGTAGAGACAGG + Intergenic
1025999787 7:66551843-66551865 TTTAATTTTTTTGCAGAGACGGG - Intergenic
1026051066 7:66947039-66947061 TTTAATTTTTTCATAAAGACAGG - Intronic
1026261134 7:68756433-68756455 CTTATTTTTTTTAAAGAGACAGG + Intergenic
1026579455 7:71601777-71601799 TTTATTTTTTTCCCAAAGACAGG - Intronic
1026662921 7:72317743-72317765 GTTCTTTTTCTTAGAAAGACTGG - Intronic
1026931886 7:74227524-74227546 GGAAGGTTTTGTACAAAGACTGG + Intronic
1027162951 7:75815468-75815490 TTTATTTTTTTTTTAAAGACGGG - Intronic
1027423114 7:78036622-78036644 TTTAGTTTTTTTTTTAAGACAGG + Intronic
1027739343 7:81980339-81980361 GCTGCTTTTTCTACAAAGACAGG - Intronic
1028610607 7:92706394-92706416 ATTAGCTTTTTTAAAAAGACAGG - Intronic
1028641023 7:93042202-93042224 GTTTGTGTGTTTAAAAAGACTGG + Intergenic
1029336517 7:99904670-99904692 GTTCATTTTTTTAAAAAAACTGG + Intronic
1029415561 7:100441058-100441080 TTTAATTTTTTTATAGAGACTGG - Intergenic
1029571320 7:101371475-101371497 TTTTTTTTTTTTACAGAGACAGG - Intronic
1030850485 7:114478763-114478785 GTTAGTTCATTTACAAGGAAAGG - Intronic
1031406490 7:121393430-121393452 TTTAAATTATTTACAAAGACAGG - Intronic
1031460783 7:122046242-122046264 GCTAATTTTTTTATAGAGACAGG - Intronic
1031714319 7:125088934-125088956 GTTAATTTTTGTATAAAGAAGGG + Intergenic
1031848550 7:126834901-126834923 TTTAGTTATTTTTCAGAGACCGG - Intronic
1032815815 7:135472866-135472888 TTTGGTTTTTTTATAGAGACAGG - Intronic
1033053014 7:138023425-138023447 AGTATTTTTTTTACAGAGACAGG + Intronic
1033417041 7:141171279-141171301 TTTGGTTTTTTTCCAGAGACAGG - Intronic
1033602321 7:142897130-142897152 GTTTGTTTTTTGGCAGAGACAGG - Intergenic
1033664868 7:143430765-143430787 GTTTGTTTTTTTAAAAATAGAGG + Intergenic
1033839128 7:145352685-145352707 GTTAGAGGTTTTACAAAGAAAGG + Intergenic
1033921095 7:146393121-146393143 GTTAGTATTTTTCCACAGAATGG + Intronic
1034228197 7:149498466-149498488 GTTATTTTTAAAACAAAGACAGG - Intergenic
1034243293 7:149625412-149625434 GTTAATTTTAAAACAAAGACAGG - Intergenic
1034761033 7:153671989-153672011 TTTTGTTTTTTCACAAAGTCAGG + Intergenic
1035402843 7:158578527-158578549 TTTTTTTTTTTTACAGAGACAGG - Intronic
1035551679 8:532799-532821 GTGACTTTATTTACAAACACAGG - Intronic
1036074879 8:5485920-5485942 GTTACTTTTTTTAGTAATACAGG - Intergenic
1036196554 8:6721808-6721830 GTTAGTATTTTTACATGCACAGG + Intronic
1036609438 8:10336884-10336906 ATTAACATTTTTACAAAGACAGG + Intronic
1036786393 8:11690696-11690718 GTTTGTTTGTTTGTAAAGACGGG - Intronic
1037052099 8:14387068-14387090 GTTTGCTTTTTTATAGAGACAGG + Intronic
1037536724 8:19831511-19831533 TTTTGTTTTTTTATAGAGACGGG - Intronic
1037777528 8:21845548-21845570 TTTATTTATTTTACAAAGGCAGG - Intergenic
1037796671 8:22001139-22001161 GCTAATTTTTGTACAGAGACAGG - Intronic
1037852226 8:22340882-22340904 TTTAATTTTTTTGTAAAGACAGG + Intronic
1038792939 8:30684753-30684775 TTTAGTTTTTTTTTAGAGACAGG + Intronic
1038808901 8:30819971-30819993 TTTAATTTTTTTATAGAGACAGG + Intergenic
1039210507 8:35207335-35207357 TTTAATTTTTTTTCAGAGACAGG - Intergenic
1039484976 8:37903325-37903347 GTTTGTTTGTTTTTAAAGACAGG - Intergenic
1039697122 8:39924961-39924983 GCTAGTTATTTTAAAAAGAGTGG + Intronic
1039764130 8:40610115-40610137 TTTTGTTTGTTTTCAAAGACTGG - Intronic
1039988819 8:42470388-42470410 TTTAGTTTTTTTGTACAGACAGG + Intronic
1039997122 8:42542972-42542994 TTTTTTTTTTTTACAAAAACAGG - Intronic
1040046773 8:42972415-42972437 CTTACTTTTTTTTTAAAGACAGG + Intronic
1040425181 8:47278323-47278345 TTTTTTTTTTTTTCAAAGACAGG + Intronic
1040935135 8:52774380-52774402 TTTTATTTTTTTACAGAGACAGG + Intergenic
1041685271 8:60638866-60638888 GTTATTGTTTTTACAAAAATGGG - Intergenic
1042269835 8:66943536-66943558 TTTAATTTTTTTGTAAAGACGGG + Intergenic
1042547210 8:69961426-69961448 GTTAATTTTTTTGTAGAGACGGG - Intergenic
1042901484 8:73732637-73732659 GTTACTTTTCTTTCCAAGACTGG - Intronic
1042909869 8:73815366-73815388 TTTTGTTTTTTTTCCAAGACAGG - Intronic
1043430921 8:80194420-80194442 GTTATTTTCTTTGCAGAGACAGG - Intronic
1043759768 8:84053601-84053623 GTTGGTTTTTTTCCAAGCACTGG + Intergenic
1044056594 8:87578416-87578438 GTTCCTTTATTCACAAAGACAGG + Intronic
1044172859 8:89077902-89077924 GTTAATTTTTTTTTAAAGACAGG + Intergenic
1044327679 8:90878040-90878062 CTTTTTTTTTTTTCAAAGACAGG + Intronic
1044734007 8:95259090-95259112 GTTAATTTTTTAAGAAAGAATGG - Intronic
1044986914 8:97763958-97763980 GTGAGTTTTTTGATAGAGACAGG - Intergenic
1045003000 8:97894491-97894513 TTTAATTTTTTTGCAGAGACAGG + Intronic
1045088984 8:98719212-98719234 TTTAGTCTTTATACAAAGAGTGG - Intronic
1045457202 8:102392696-102392718 ACTAGTTTTTATAAAAAGACAGG + Intronic
1045537558 8:103046212-103046234 TTTATTTTTTTTTCAGAGACAGG + Intronic
1045598547 8:103686240-103686262 TTGAGATTTTATACAAAGACAGG + Intronic
1046018506 8:108635131-108635153 GTTACTTTTTTAACAGATACAGG - Intronic
1046055786 8:109076512-109076534 GTTAGTTTTTTTCTAAATCCTGG + Intergenic
1047224782 8:122947082-122947104 TTTTTTTTTTTTGCAAAGACAGG - Intronic
1049817286 8:144611842-144611864 GCTAATTTTTTTATAGAGACAGG - Intergenic
1050406965 9:5319661-5319683 GTTAGTTTATTTACAATAATTGG + Intergenic
1050568838 9:6916444-6916466 ATTTGTTTTTTTATAGAGACAGG + Intronic
1050661425 9:7887166-7887188 GTTTGTTTTTTTAGAAGAACAGG + Intronic
1050881996 9:10713035-10713057 GTTAAATTTTTTGCAGAGACAGG - Intergenic
1051064573 9:13087245-13087267 CTTATTTTTTTTTCAATGACAGG - Intergenic
1051312206 9:15788588-15788610 GTTTTTTTTTTTTTAAAGACAGG + Intronic
1051454175 9:17234439-17234461 GTTAGTTTTTTTTGAGAGACAGG - Intronic
1051558445 9:18411368-18411390 TTTTGTTTTTTTATAGAGACTGG + Intergenic
1051908450 9:22124611-22124633 GTTAGTTTTTTAAAAAATAGAGG - Intergenic
1052232816 9:26175357-26175379 GTTGGTCTTTATAGAAAGACTGG - Intergenic
1052251826 9:26407703-26407725 GTTTGTTTCTTTAGTAAGACTGG - Intergenic
1052370885 9:27663323-27663345 GTCATTTTTTTTTAAAAGACAGG + Intergenic
1052508855 9:29388892-29388914 TTTATTTTTTTTATACAGACAGG + Intergenic
1052544491 9:29857534-29857556 GTTGATTTTTTTACACAGAATGG + Intergenic
1052679346 9:31668975-31668997 GTTAATTTTTTTTCAATGGCAGG + Intergenic
1052808724 9:33037299-33037321 TTTTGTTTTTTTAAAGAGACAGG - Intronic
1053611612 9:39719349-39719371 CCTAGTGTTTTGACAAAGACAGG - Intergenic
1053869645 9:42477397-42477419 CCTAGTGTTTTGACAAAGACAGG - Intergenic
1054086643 9:60751811-60751833 CCTAGTGTTTTGACAAAGACAGG + Intergenic
1054241909 9:62623040-62623062 CCTAGTGTTTTGACAAAGACAGG + Intergenic
1054556033 9:66657554-66657576 CCTAGTGTTTTGACAAAGACAGG + Intergenic
1054768720 9:69065227-69065249 TTTATTTTCTTTACAGAGACAGG - Intronic
1054871940 9:70055042-70055064 TTTTGTTTTTTTAAAGAGACAGG - Intronic
1055044021 9:71906644-71906666 TTTAGATTTTTTACAGAGACAGG - Intronic
1055832570 9:80399094-80399116 GTTAGTTTTTTTTTAACCACAGG - Intergenic
1055844291 9:80542849-80542871 CTTACTTTTTTCACAAAGACAGG + Intergenic
1056251350 9:84751406-84751428 TTAAGTTTTTTTGCAGAGACAGG - Intronic
1057362714 9:94389777-94389799 GTTATTTTTTTTGCAGAGATGGG + Intronic
1057797029 9:98165129-98165151 GCTAATTTTTTTGTAAAGACAGG + Intronic
1057968195 9:99525496-99525518 TTTATTTTTTTTACAAAGAGAGG + Intergenic
1058397851 9:104575875-104575897 TTTAGTTCATTTACAATGACTGG - Intergenic
1058411461 9:104737670-104737692 TTTTGTATTTTTACAGAGACGGG - Intergenic
1058630878 9:106985155-106985177 AAAAGTTTATTTACAAAGACAGG + Intronic
1058892308 9:109371429-109371451 ATTAGTGTCCTTACAAAGACAGG + Intergenic
1059229777 9:112708846-112708868 TTTTTTTTTTTTTCAAAGACAGG + Intronic
1059257153 9:112941306-112941328 TTTTTTTTTTTTAAAAAGACCGG - Intergenic
1059523863 9:114970356-114970378 GTTAATTTTTGTATAAATACAGG + Intergenic
1060063740 9:120484412-120484434 TTTTGTTTTTTTAAAGAGACTGG + Intronic
1060351067 9:122860583-122860605 TTTAGTTTTTTTGTAGAGACGGG + Intronic
1060508551 9:124216041-124216063 TTTTGTATTTTTATAAAGACGGG + Intergenic
1060625072 9:125104745-125104767 GTTTGTTTTTTGACAAACAAAGG - Intronic
1060907890 9:127324243-127324265 TTTTGTTTTTTTAAAGAGACAGG - Intronic
1061143557 9:128783486-128783508 TTAAGATTTTTTACAGAGACGGG + Intergenic
1062724395 9:138063319-138063341 TTTAAATTTTTTACAGAGACAGG - Intronic
1186023307 X:5281285-5281307 TTTATTTTTTTTATAGAGACAGG - Intergenic
1186437222 X:9552969-9552991 TTTAGTTTTTTTCTAGAGACAGG - Intronic
1186583828 X:10850270-10850292 TTTATTTTTTTTTTAAAGACAGG - Intergenic
1186721165 X:12305736-12305758 TTTTTTTTTTTTACAGAGACAGG + Intronic
1186898661 X:14030337-14030359 GTTAATCTATTTTCAAAGACTGG - Intergenic
1187072060 X:15898339-15898361 GTTTTTTTTTTTTTAAAGACAGG - Intergenic
1187360919 X:18626919-18626941 TTTAATTTTTTTATAGAGACGGG + Intronic
1187365772 X:18664886-18664908 GTTAATTTTTTTGTAGAGACGGG + Intronic
1188203765 X:27325732-27325754 GTCACTTTTTTTTAAAAGACAGG - Intergenic
1188225730 X:27594179-27594201 ATAACTTTTTTTACAAAGTCAGG + Intronic
1188550653 X:31361085-31361107 GTTATTTTTTTTTAAGAGACAGG - Intronic
1189349300 X:40265084-40265106 GCTAGGTGTTTTACAAAAACGGG + Intergenic
1189467482 X:41288399-41288421 GTTTGATTTTTTTCAAGGACAGG + Intergenic
1189926911 X:45964810-45964832 GTTCCTTTTTTTTCTAAGACAGG + Intergenic
1190708020 X:53047217-53047239 TTTAAATTTTTTATAAAGACGGG + Intergenic
1191603374 X:63034640-63034662 GGTAGTTTTTTAGTAAAGACGGG - Intergenic
1192172044 X:68861841-68861863 TTTAAATTTTTTACAGAGACAGG - Intergenic
1192275167 X:69621928-69621950 TTTAATTTTTTTATAGAGACAGG + Intronic
1192365485 X:70469182-70469204 CTTATTTTTTTTGCAAAGACAGG + Intronic
1192461117 X:71318424-71318446 TTTTGTATTTTTAGAAAGACGGG + Intergenic
1192487396 X:71540842-71540864 TTTTGTATTTTTACAAAAACAGG + Intronic
1193032792 X:76917762-76917784 GTTATTTTTTTTTTAAAGATGGG + Intergenic
1193347252 X:80418321-80418343 TTAAATTTTTTTTCAAAGACAGG + Intronic
1194826339 X:98567627-98567649 GTTATTTTTTTTCTAGAGACAGG + Intergenic
1195254310 X:103078295-103078317 TTTAGTTTTTTTGTAGAGACAGG + Intronic
1195505531 X:105652191-105652213 GTAGGTTCTTTTACCAAGACAGG - Intronic
1196410596 X:115414227-115414249 GTTAATTTTTTTTCAGAGAAAGG + Intergenic
1196782136 X:119393032-119393054 GTTTGTTTGTTTTCAGAGACAGG - Intergenic
1196912111 X:120494150-120494172 TTTTTTTTTTTTACAAAGATTGG + Intergenic
1197598230 X:128493175-128493197 TTTTTTTTTTTTACAATGACAGG - Intergenic
1197710621 X:129664463-129664485 TTTATTTTTTTTGTAAAGACGGG + Intergenic
1198151646 X:133916268-133916290 GTTAGGTTGTTTACAAAGCAGGG + Intronic
1198325579 X:135568714-135568736 TTTATTTTTTTTATAGAGACAGG + Intronic
1198763390 X:140057398-140057420 GTTTGTTTTATTCCAAAGCCAGG - Intergenic
1199030373 X:142991109-142991131 GTTTGTTATTTTATAGAGACAGG - Intergenic
1199165858 X:144674429-144674451 GTAACTTTATTTTCAAAGACTGG + Intergenic
1199192317 X:144984462-144984484 GTTAGATTGTTTACATAGAGAGG - Intergenic
1199423061 X:147668914-147668936 GTTTGCTTTTTTATAGAGACTGG - Intergenic
1200793326 Y:7318468-7318490 TTTTTTTTTTTTGCAAAGACAGG + Intergenic
1200832924 Y:7704919-7704941 TTTTGTATTTTTATAAAGACAGG - Intergenic
1202582631 Y:26398139-26398161 GTTTGTTTTTTTGTAGAGACGGG + Intergenic