ID: 1152822309

View in Genome Browser
Species Human (GRCh38)
Location 17:82443619-82443641
Sequence ACCTCCGGCTGCAGAAAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152822304_1152822309 4 Left 1152822304 17:82443592-82443614 CCAAAGCAGGAGTCCAGGGCTGG 0: 1
1: 0
2: 4
3: 48
4: 588
Right 1152822309 17:82443619-82443641 ACCTCCGGCTGCAGAAAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 188
1152822299_1152822309 22 Left 1152822299 17:82443574-82443596 CCGAGGTCTTGCTGTGGCCCAAA 0: 1
1: 0
2: 2
3: 20
4: 171
Right 1152822309 17:82443619-82443641 ACCTCCGGCTGCAGAAAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 188
1152822303_1152822309 5 Left 1152822303 17:82443591-82443613 CCCAAAGCAGGAGTCCAGGGCTG 0: 1
1: 0
2: 4
3: 27
4: 270
Right 1152822309 17:82443619-82443641 ACCTCCGGCTGCAGAAAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 188
1152822307_1152822309 -9 Left 1152822307 17:82443605-82443627 CCAGGGCTGGCGAGACCTCCGGC 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1152822309 17:82443619-82443641 ACCTCCGGCTGCAGAAAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 188
1152822296_1152822309 30 Left 1152822296 17:82443566-82443588 CCACTCGCCCGAGGTCTTGCTGT 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1152822309 17:82443619-82443641 ACCTCCGGCTGCAGAAAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 188
1152822298_1152822309 23 Left 1152822298 17:82443573-82443595 CCCGAGGTCTTGCTGTGGCCCAA 0: 1
1: 0
2: 1
3: 10
4: 178
Right 1152822309 17:82443619-82443641 ACCTCCGGCTGCAGAAAGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152822309 Original CRISPR ACCTCCGGCTGCAGAAAGGC AGG Exonic