ID: 1152822332

View in Genome Browser
Species Human (GRCh38)
Location 17:82443758-82443780
Sequence AGCCAAGGCCACGGGTCCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152822327_1152822332 3 Left 1152822327 17:82443732-82443754 CCAACTCGGCTGGAGGCACCAAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152822332 Original CRISPR AGCCAAGGCCACGGGTCCTG TGG Exonic