ID: 1152822332

View in Genome Browser
Species Human (GRCh38)
Location 17:82443758-82443780
Sequence AGCCAAGGCCACGGGTCCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152822327_1152822332 3 Left 1152822327 17:82443732-82443754 CCAACTCGGCTGGAGGCACCAAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152822332 Original CRISPR AGCCAAGGCCACGGGTCCTG TGG Exonic
900279603 1:1857973-1857995 AGACAAGGCCACGGGTACAGGGG + Intronic
900981483 1:6048540-6048562 AGCCAAGGCCCCGGGGCTGGAGG - Intronic
900989157 1:6090147-6090169 AGTCAAGGACACGTGGCCTGTGG + Intronic
901187922 1:7387036-7387058 AGCCAAGGGCAGGGTTCCAGGGG - Intronic
901302977 1:8212964-8212986 ATCCAGAGCCACGGGGCCTGTGG + Intergenic
903889581 1:26560647-26560669 AGCCAAGACCTTAGGTCCTGGGG + Intronic
903907883 1:26698114-26698136 AGCCCAGGCCACTGGGCCGGCGG - Intronic
904675998 1:32199654-32199676 AGCCATGGGCACTGCTCCTGAGG - Intergenic
904866522 1:33583483-33583505 CCCCAAGGCCATGGGACCTGAGG - Intronic
905678245 1:39845597-39845619 AGCCAAGGCCAGGTGTGCTGTGG - Intronic
905918226 1:41700525-41700547 AGCCAAGGCCCTGGGCTCTGGGG - Intronic
906317702 1:44799118-44799140 AGACAAGGCCAGGAGGCCTGTGG + Intergenic
906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG + Intronic
907267972 1:53274342-53274364 AGCCAAGGCCCTGGGCTCTGAGG - Intronic
907302725 1:53498657-53498679 AGCCATCTCCACGGGGCCTGGGG - Intergenic
907471053 1:54673695-54673717 ATCCAAGGCCCCAGGGCCTGTGG - Exonic
908249471 1:62253784-62253806 AGTCAAGGCCACTGGCCCTTTGG - Intronic
908444754 1:64190155-64190177 AGATAAGGCCATGGGGCCTGAGG + Intergenic
912666661 1:111587030-111587052 AGGCAAGGCCACTGGTGTTGAGG - Intronic
913234076 1:116765305-116765327 AGCCAAGGGAACAGGCCCTGGGG + Intronic
913346897 1:117818469-117818491 AGATAAGGCCATGGGGCCTGAGG - Intergenic
913978522 1:143487397-143487419 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
914072933 1:144313045-144313067 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
914106221 1:144653315-144653337 AGCCAAGGTCCAGGGGCCTGAGG - Intergenic
915029143 1:152861132-152861154 AGCCAAGGCCAAGAGGCCTGAGG - Intergenic
915162665 1:153931048-153931070 AGCCAAGGAGATGGGGCCTGGGG + Exonic
915994723 1:160550819-160550841 AGCCACGGCCAAGAGTCCAGAGG - Intronic
916141847 1:161706499-161706521 AGCTCAGGCCACTGATCCTGAGG - Intergenic
916733238 1:167584706-167584728 AACCAATCCCACTGGTCCTGTGG + Intergenic
918414109 1:184289300-184289322 AGATAAGGCCACGGGGCCTGAGG + Intergenic
919303888 1:195805515-195805537 AGCCAGGGACATGGGTCCAGAGG + Intergenic
919356946 1:196536535-196536557 AGATAAGGCCATGGGGCCTGAGG - Intronic
920533819 1:206724182-206724204 AGCCAAGGCCCCTGCTCCTTGGG - Intronic
924005330 1:239603407-239603429 AGGCAAGGTCACGGATTCTGTGG + Intronic
924569472 1:245225280-245225302 AACCAAGGAGAAGGGTCCTGGGG + Intronic
924573371 1:245258087-245258109 AGCCCAGGCCTGGGGTCCTAGGG + Intronic
1063138107 10:3234744-3234766 AGCAAAGCCAACGGGTCCAGGGG - Intergenic
1063373137 10:5534581-5534603 AGCCTGGCCGACGGGTCCTGCGG - Intergenic
1063583366 10:7329652-7329674 AGCCAAGGCCCCGGTTATTGTGG - Intronic
1066136378 10:32450727-32450749 GGCCAAGGCTACTGCTCCTGTGG + Intronic
1066453355 10:35550877-35550899 AGCCAGGGGCAAGGGACCTGGGG - Intronic
1067015300 10:42753675-42753697 GGCCACTGTCACGGGTCCTGTGG - Intergenic
1067015710 10:42755198-42755220 AGCCCTGGCCACCGCTCCTGAGG - Intergenic
1067552783 10:47247055-47247077 AGCCAACGCCACTCCTCCTGGGG - Intergenic
1067802008 10:49365723-49365745 AGCCCATGCCACAGTTCCTGGGG + Exonic
1068569944 10:58617468-58617490 AGATAAGGCCATGGGGCCTGAGG + Intronic
1069801782 10:71086153-71086175 GGCCAAGGCCAACGGTGCTGAGG + Intergenic
1070323723 10:75373945-75373967 AGCCAAAGCCACAGGTCCCCTGG - Intergenic
1072450871 10:95538508-95538530 AGTAAAAGCCAAGGGTCCTGGGG + Intronic
1072802472 10:98402671-98402693 AGCCAAGACCTCGAGTCGTGAGG - Intronic
1073450293 10:103605205-103605227 ATCAAAGGCCAGGGGTCATGTGG + Intronic
1074719284 10:116250762-116250784 AGCTATGGCCAGGGGTCCTGAGG - Intronic
1074772373 10:116742404-116742426 AGCGCAGGCTGCGGGTCCTGCGG - Intronic
1075169549 10:120100884-120100906 AGGTAAGGTCACAGGTCCTGTGG + Intergenic
1075802722 10:125162328-125162350 AGCCAGGGCCAGGGGGCCGGAGG + Intergenic
1076701756 10:132276886-132276908 AGCCACGGCCTCGAGCCCTGGGG - Intronic
1076935408 10:133565470-133565492 AGCCCTGTCCACGGCTCCTGCGG + Exonic
1077315534 11:1917878-1917900 CACCCAGGCCAGGGGTCCTGAGG - Intergenic
1078337808 11:10477616-10477638 TGCCAAGGCAACAGGTCCAGAGG + Intronic
1079024988 11:16940023-16940045 AGCCAGGGCCACTGGTGCTGGGG + Intronic
1079146504 11:17857079-17857101 AGCCAAGTCAAGGGCTCCTGAGG + Intronic
1081788748 11:45767688-45767710 AGACAAGGACACTGGTCCAGGGG + Intergenic
1082027534 11:47583898-47583920 TGCCAAGGGCACCGGGCCTGAGG + Intronic
1083721875 11:64607480-64607502 AGCCAACCCCACAGGGCCTGGGG - Exonic
1083871391 11:65490460-65490482 AGCCCAGGCCAGAGGTCATGGGG - Intergenic
1083945481 11:65920494-65920516 GGCCAAGGCCACAGGGCTTGGGG + Intronic
1084515592 11:69636730-69636752 AGCCACGGCCCAGGGTCCGGCGG + Intergenic
1085181787 11:74542606-74542628 AGACAAGGCCATGGGGCCTGAGG + Intronic
1088000951 11:104879723-104879745 AGCCAGGCCCACCGTTCCTGCGG + Intergenic
1089348034 11:117804131-117804153 GGCCAAAGCCACGGCTCCTGGGG + Intronic
1090673662 11:128969704-128969726 AGCCAAGGCCATCAGTCCCGAGG - Exonic
1090775313 11:129959525-129959547 AGCCAAGGTCAGGGTCCCTGTGG - Intronic
1091295970 11:134474248-134474270 AGCCTAGGGCACGCGGCCTGCGG + Intergenic
1092406507 12:8225103-8225125 TACCTAGGCCACGGGCCCTGTGG - Intronic
1093774803 12:23060949-23060971 AGTCAAGTCCACGAGGCCTGTGG - Intergenic
1095175460 12:39086873-39086895 AGTGAAGGCATCGGGTCCTGGGG + Intergenic
1095953112 12:47792042-47792064 AGCCAAGGCCATGGGGCGTGAGG - Intronic
1096232650 12:49904842-49904864 TGCCAAGGCCACGCGGCCAGTGG - Intergenic
1096551720 12:52377686-52377708 ACCCAAAGCCACGGGTGGTGAGG + Intergenic
1096616197 12:52834692-52834714 AGCCAAGGCTGCAGGGCCTGGGG + Intergenic
1097958713 12:65512091-65512113 ACCCAAGGCCATGCTTCCTGTGG + Intergenic
1099989665 12:89708930-89708952 AGCCGAGGAGGCGGGTCCTGCGG - Intronic
1104545135 12:129704316-129704338 AGCAAAGGCCATGGGCCATGTGG + Intronic
1105220806 13:18323998-18324020 AGCCAAGGTCCAGGGGCCTGAGG - Intergenic
1105454141 13:20525466-20525488 CGCCCAGGCCGCGGGGCCTGCGG - Intronic
1106619915 13:31363116-31363138 AGCCAAGTCCACAGTTTCTGTGG - Intergenic
1107078165 13:36346147-36346169 AGCCGAGTCCGCGGGGCCTGGGG + Intronic
1113298059 13:108984189-108984211 ATCCAATTCCATGGGTCCTGAGG + Intronic
1113533459 13:111045923-111045945 AGCCAAGGCCACGGGGCCCTGGG - Intergenic
1113701508 13:112392314-112392336 AGCCGAGGCCACAGGTCAGGAGG + Intronic
1113894750 13:113756814-113756836 AGCAAAGGCCAGAGGCCCTGCGG + Intergenic
1113971559 13:114195157-114195179 GGCCAATGCCAAGGCTCCTGTGG - Intergenic
1114209551 14:20603441-20603463 AGATAAGGCCATGGGACCTGAGG + Intronic
1114522221 14:23346920-23346942 GGCCCAGGCCACGGCCCCTGGGG + Exonic
1122272266 14:100573551-100573573 AGCCAGGCCCACGGGGCCTGGGG + Intronic
1122607226 14:102954881-102954903 AGCCAAGTGCAGGGGTCCTCAGG - Intronic
1122809785 14:104282231-104282253 CGCCAAGGCCAGGCCTCCTGGGG + Intergenic
1123051301 14:105545446-105545468 AGCCCAGGCCTTGGGACCTGGGG - Intergenic
1123076713 14:105671148-105671170 AGCCCAGGCCTTGGGACCTGGGG - Intergenic
1124215823 15:27806574-27806596 AGCCAAGGGCACGGGTGGAGCGG - Intronic
1128350276 15:66883860-66883882 AGCCAAGGCCAGCCCTCCTGAGG - Intergenic
1129118454 15:73379808-73379830 AGCCAGGGCCAAGGTTCATGGGG - Intergenic
1131551001 15:93356971-93356993 AGACCAAGCCATGGGTCCTGGGG - Intergenic
1133537320 16:6714503-6714525 ACCCAAGGGCAGGGGGCCTGGGG + Intronic
1134135332 16:11673403-11673425 TGCCAAGGCCACTGCTCCGGAGG + Intronic
1137286552 16:47020902-47020924 AGCCAAGGCGATGGATCATGAGG - Intergenic
1138399998 16:56737952-56737974 AGCCAAAGCCACAGGCCCTTTGG + Intronic
1138480468 16:57299490-57299512 ACCCAAGGCCTCCCGTCCTGAGG + Intergenic
1138491366 16:57378905-57378927 AGGCAAGGCCACAGGCCCGGTGG + Intronic
1138499466 16:57430323-57430345 CGGCAAGGCCACAGGTGCTGCGG + Exonic
1139247108 16:65455799-65455821 ACCTGAGGCCAGGGGTCCTGTGG - Intergenic
1139370085 16:66461664-66461686 TGCCATGGCCAGGGGTCATGGGG + Intronic
1139848677 16:69937697-69937719 ACCAAAGGAAACGGGTCCTGAGG + Intronic
1142143853 16:88484519-88484541 AGCCCAGACCCCAGGTCCTGCGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142813156 17:2405633-2405655 GGCCAAGGCCAGGGGACCTCTGG + Intronic
1143341724 17:6216299-6216321 AACCAAGGACACGGGAACTGAGG + Intergenic
1143608488 17:8003987-8004009 GGCCAAGGCCTCCGGGCCTGGGG - Exonic
1145960817 17:28885669-28885691 AGGCAAGGGCAAGGGACCTGGGG + Intronic
1147135843 17:38433874-38433896 AGCCTGGGCCACTGGTCCTGAGG + Intronic
1147318641 17:39633035-39633057 GGCCAAGGCCAGGGGTTCTGGGG - Intronic
1148209455 17:45799575-45799597 GGCCAAGGTCCTGGGTCCTGGGG - Intronic
1151025305 17:70670487-70670509 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1152105174 17:78324509-78324531 TGCCAAGGCAACCGGGCCTGTGG - Intergenic
1152579710 17:81160495-81160517 GGCCAAGGCCGCCGGTCCCGCGG + Intronic
1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG + Exonic
1153444095 18:5152875-5152897 AGCCTGGGCCTGGGGTCCTGGGG + Intronic
1156557765 18:38086776-38086798 AGCCATGGCCCCAGGTCATGGGG - Intergenic
1160028583 18:75239175-75239197 AGCGCAGGCCAGGGGCCCTGAGG + Intronic
1160033077 18:75279061-75279083 ACCCCAGGCCAGGGGCCCTGAGG - Intronic
1160732244 19:646580-646602 AGCCGAGTCCGCGGGTCCTGGGG + Intergenic
1160846628 19:1168880-1168902 GGCCAAGGCCCTGGGTGCTGGGG - Intronic
1160901182 19:1429478-1429500 AGCCAAGCCCAGGGGTTCCGTGG - Intronic
1161428380 19:4216909-4216931 AGCCGAGGCCACGGGAGCTGAGG + Exonic
1161587024 19:5111138-5111160 AGGCAATGGCACGGGGCCTGGGG - Intronic
1163398744 19:17079097-17079119 AGCCATGGCCACGTGTCCCCTGG + Intronic
1164579253 19:29424412-29424434 AGGCAAGGCAGTGGGTCCTGAGG + Intergenic
1165136697 19:33674183-33674205 AGCCAGGGCCAGAGCTCCTGGGG - Intronic
1166304965 19:41932425-41932447 AGCCTAGCCCACAGGGCCTGGGG + Intergenic
930696402 2:54416250-54416272 AGCCAAGACCACAGGACCGGTGG + Intergenic
933818767 2:86090695-86090717 ACTCAAGGCCAGGGCTCCTGGGG - Intronic
933902726 2:86861427-86861449 TGGCCAGGCCATGGGTCCTGTGG - Intronic
933938327 2:87225121-87225143 GGCCAAGGACACTGGCCCTGGGG - Intergenic
934183249 2:89648478-89648500 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
934293530 2:91722648-91722670 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
936354808 2:111740654-111740676 GGCCAAGGACACTGGCCCTGGGG + Intergenic
936721311 2:115255252-115255274 AGCTCAGGCCACGGGTACAGAGG - Intronic
938224799 2:129606490-129606512 ACACAAGTTCACGGGTCCTGTGG - Intergenic
938342789 2:130546630-130546652 ATCCAAGGCCAAGTGTCCTGAGG - Intronic
938347044 2:130574092-130574114 ATCCAAGGCCAAGTGTCCTGAGG + Intronic
941360618 2:164546888-164546910 ACCCATGGCCAGGGGACCTGTGG - Intronic
946227721 2:218273082-218273104 AGCCTAGGCCCCGGGCCCTCGGG + Intronic
946409881 2:219510638-219510660 AGCCAAGGCAACGGGTCCCTGGG - Intergenic
946416673 2:219543482-219543504 GCCCACGGCCACGGGCCCTGCGG + Exonic
947713841 2:232330232-232330254 AGCAGAGGGCAGGGGTCCTGTGG + Intronic
948643734 2:239391053-239391075 AGCCGAGGCCCCTGGCCCTGAGG - Intronic
949012156 2:241686974-241686996 AGCCCAGGACACGGCTCCAGTGG - Exonic
949045472 2:241870794-241870816 AGCCAAAGCCACGGGCGCTGGGG - Intronic
1168892420 20:1303543-1303565 AGACAAGGCAACAGGTACTGAGG - Intronic
1172487518 20:35307254-35307276 AGGCAAGGCAACTGGTCCTTGGG + Intronic
1173975720 20:47185079-47185101 AGTCAAGGCCCCTGGTCCTGCGG - Intronic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1177651579 21:23966462-23966484 AGACAAGGCCACAGGGCCTGAGG - Intergenic
1178019803 21:28395517-28395539 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1180974705 22:19841971-19841993 AGCCAAGGCCATGAGGCCTGAGG + Intronic
1180988647 22:19920250-19920272 ACCCAGGGCCACAGGTTCTGGGG + Intronic
1180993533 22:19953145-19953167 CGCCCAGGCCATGAGTCCTGAGG - Intronic
1181131097 22:20732843-20732865 AGCCAAGGCCAGGGCTCAGGGGG + Intronic
1181470789 22:23138152-23138174 AGCCAAAGCCACAGCCCCTGTGG + Intronic
1182765158 22:32753223-32753245 GTCAAAGGTCACGGGTCCTGTGG + Intronic
1182804310 22:33057853-33057875 ACCCAAGGCAACAGGTCATGAGG + Intronic
1183095482 22:35549498-35549520 TGTCAAGGCCACGAGTCCTCAGG + Intronic
1183292471 22:37011141-37011163 AGCCAAGGCCACGTGGCAGGCGG + Exonic
1183949292 22:41343703-41343725 AGCCACGGCCTAGGCTCCTGGGG + Intronic
1184048486 22:41987406-41987428 AGCCCAGGCCAGGGCCCCTGGGG + Intronic
1185201580 22:49509271-49509293 AGCTTAGGCCCCAGGTCCTGAGG - Intronic
950143022 3:10628173-10628195 AGCCCTGGCCATGGGCCCTGAGG - Intronic
953427060 3:42804219-42804241 AGCCGAGGCCTAGGGTCCTTCGG - Exonic
953845123 3:46420693-46420715 AGAGAAGGCCATGGGGCCTGAGG - Intergenic
954435128 3:50491872-50491894 AGCCAAGGGCAGAGGTCTTGGGG - Intronic
954640173 3:52093149-52093171 GGTCAAGGCCATGGGTCCTCTGG - Intronic
955405647 3:58624101-58624123 CAGCAAGGCCACAGGTCCTGCGG - Intronic
960386870 3:117030963-117030985 AGGCAAGGCCAGGGGACATGTGG + Intronic
960956140 3:123032644-123032666 AGGCAAGGCCTCTGCTCCTGTGG - Intergenic
961713865 3:128846010-128846032 GGCCAAGGCCAAGGGCCCTCTGG + Intergenic
964432755 3:156623403-156623425 AGATAAGGCCATGGGGCCTGAGG + Intergenic
965028738 3:163335802-163335824 AGCCATGGCCATGGCTCCAGAGG - Intergenic
966002365 3:174965884-174965906 AGGCAAGGAGAGGGGTCCTGGGG + Intronic
966913735 3:184573553-184573575 GGCCAAGGGCACGGGGGCTGTGG + Intronic
966922043 3:184618834-184618856 GACCAAGGCCACGGCTCCTAAGG + Intronic
968548927 4:1212669-1212691 TGCCATGGGCACGGGGCCTGTGG - Intronic
968916817 4:3500254-3500276 GTCCACAGCCACGGGTCCTGGGG - Intronic
971168529 4:24209216-24209238 AACCAAGCCCAGGGGTCCTCCGG + Intergenic
972710156 4:41587566-41587588 AACCAAGGCCTCAGGTACTGGGG - Intronic
975762593 4:77633636-77633658 AGATAAGGCCATGGGGCCTGAGG - Intergenic
976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG + Intronic
978016387 4:103751805-103751827 AGATAAGGCCATGGGGCCTGAGG + Intergenic
979082306 4:116359858-116359880 AGATAAGGCCATGGGGCCTGAGG + Intergenic
980463704 4:133149069-133149091 AGCCAGCGCCTCGGGACCTGCGG + Intergenic
982261055 4:153494810-153494832 AACCAAGCCCACTGGTGCTGAGG - Intronic
983239265 4:165213141-165213163 AACCAAGACCACAGTTCCTGGGG - Intronic
984448242 4:179865921-179865943 AGACAAGCCCACGGGAACTGTGG + Intergenic
984879665 4:184399373-184399395 AGCCGAGGCCACAGGACCAGAGG + Intronic
985530190 5:429502-429524 AGCCAAGGACCCGGGGGCTGAGG - Intronic
985610511 5:885322-885344 AGCCAAGGCTGCAGGACCTGAGG + Intronic
985851971 5:2395229-2395251 AGCCTGGGGCACGGGCCCTGTGG - Intergenic
986347179 5:6846206-6846228 ACCCAAGGCCTCGGGGCTTGGGG - Intergenic
986939878 5:12937094-12937116 AGATAAGGCCATGGGGCCTGAGG + Intergenic
988942408 5:36159605-36159627 AACCAAGGGCACGAGTGCTGGGG - Intronic
990281012 5:54250718-54250740 AGCAGAGTCCACAGGTCCTGGGG + Intronic
991658904 5:68930999-68931021 AGATAAGGCCATGGGGCCTGAGG - Intergenic
993158199 5:84254848-84254870 AGCCAAGGCCACGTATTGTGGGG - Intronic
994165246 5:96601377-96601399 TGCCAAGGTCACAGATCCTGCGG - Intronic
996340937 5:122438220-122438242 AGCCAGGGCCACTGTCCCTGTGG + Intronic
1002318556 5:178361565-178361587 AGACAAGGCCAGGGGGCCAGGGG - Intronic
1003592156 6:7445524-7445546 AGCCAAGGCCATGGGAGCTGGGG + Intergenic
1003650078 6:7951390-7951412 AACCAAGGCCACGGATGCCGAGG - Intronic
1005598736 6:27405524-27405546 AGATAAGGCCATGGGGCCTGGGG - Intergenic
1005661414 6:28002637-28002659 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1007262699 6:40575021-40575043 AGCCATGGCAATGGGTCCTTAGG + Intronic
1012373226 6:98531317-98531339 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1013465562 6:110414507-110414529 AGCCCGGGCCAGGTGTCCTGAGG + Intronic
1015596582 6:134872697-134872719 AGAGAAGGCCATGGGACCTGAGG - Intergenic
1015736992 6:136411594-136411616 GGCCATGGACACGGGGCCTGGGG + Intronic
1016699071 6:147033641-147033663 AGCCAAGTTCACGGGCTCTGAGG - Intergenic
1018457971 6:163969765-163969787 GCCCAAGGCCAGGGGTCCCGAGG - Intergenic
1019212587 6:170418586-170418608 AGCACAGGCCACGGGGCCCGAGG - Intergenic
1019317148 7:391975-391997 TGCCAAGCCCAGGGGGCCTGAGG - Intergenic
1019523355 7:1470210-1470232 AGCCAAGGCCAGGGTCCTTGAGG + Intergenic
1020747142 7:12092122-12092144 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1024529929 7:50383223-50383245 AGCCAAGGCCACAGTTACAGAGG + Intronic
1026190698 7:68123627-68123649 AGCCATGGCCACGTTTCATGAGG + Intergenic
1026963736 7:74426120-74426142 AGCCAGGGCCATGGTCCCTGAGG - Intergenic
1027136396 7:75627419-75627441 GGTCAAGGCCTTGGGTCCTGGGG - Intronic
1027152644 7:75743478-75743500 AGCCAAGGGCAAGGGTGATGTGG + Intergenic
1027755273 7:82204015-82204037 AGATAAGGCCATGGGGCCTGAGG + Intronic
1032688671 7:134260746-134260768 AGCCATGCCCACTGCTCCTGTGG + Intronic
1034349755 7:150408170-150408192 AGCCACGGCCACGGGCCCGAGGG + Intronic
1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG + Intronic
1036168491 8:6459969-6459991 AGCCACGGCCACGGGCTCTGGGG + Intronic
1036263218 8:7256611-7256633 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036264521 8:7264233-7264255 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036265820 8:7271855-7271877 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036267122 8:7279477-7279499 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036268425 8:7287099-7287121 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036269729 8:7294721-7294743 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036298161 8:7552333-7552355 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036299466 8:7559983-7560005 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036300771 8:7567631-7567653 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036302078 8:7575277-7575299 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036303373 8:7582924-7582946 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036315263 8:7715150-7715172 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036316565 8:7722798-7722820 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036317872 8:7730446-7730468 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036319181 8:7738094-7738116 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036320488 8:7745741-7745763 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036321798 8:7753389-7753411 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036323107 8:7761037-7761059 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036324409 8:7768684-7768706 TACCTAGGCCACGGGCCCTGTGG + Intergenic
1036351625 8:8015623-8015645 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036352934 8:8023269-8023291 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036354224 8:8030916-8030938 TACCTAGGCCACGGGCCCTGTGG - Intergenic
1036509002 8:9383269-9383291 AGCCAAGGCCATGGGTCACAAGG - Intergenic
1037986353 8:23292960-23292982 AGCCAAGGCCATGGTGTCTGAGG - Intronic
1038707164 8:29905346-29905368 AGCCAAGGACAGTGTTCCTGAGG - Intergenic
1042543515 8:69930639-69930661 AGTTAAGGCCATGGGACCTGGGG + Intergenic
1042804622 8:72757933-72757955 AGCCAAGGCCACATGCCCTGTGG + Intronic
1047180365 8:122582091-122582113 AGCTAAGAGCAAGGGTCCTGGGG - Intergenic
1047437590 8:124847678-124847700 AGGCAAGGCCAACGGTCCTCTGG - Intergenic
1048259981 8:132937126-132937148 AGCCATGGCCTCGGGCCCTCAGG - Intronic
1048278234 8:133083943-133083965 AGCCCAGGCCATGCCTCCTGTGG + Intronic
1049206477 8:141365947-141365969 AGCCAAGGCCAGGGCCCCTGAGG - Intronic
1049361353 8:142213841-142213863 AGCCAAGGCACCTGGTGCTGTGG + Intronic
1049503113 8:142978631-142978653 AGCCCTGGCCCCTGGTCCTGTGG - Intergenic
1049807285 8:144546778-144546800 GGCCCAGGCCACGGCTCCGGTGG + Intronic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1052569347 9:30200229-30200251 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1055336475 9:75237503-75237525 AGATAAGGCCATGGGGCCTGAGG - Intergenic
1059571057 9:115436262-115436284 TGACAAGGCCACGGATGCTGGGG - Intergenic
1060200536 9:121649631-121649653 AGCCAGGTCCACGGGTTCTGGGG - Intronic
1060405428 9:123370693-123370715 AGCCAGGGCCACAGGACCAGAGG - Exonic
1062364869 9:136203738-136203760 AGCCAAGACCTCGGGTCGTGAGG + Intronic
1062390523 9:136331942-136331964 CACCATGGCCACGGGTCCTGGGG - Intronic
1062589181 9:137265792-137265814 AGCCTAGGCCACCCCTCCTGAGG + Intronic
1203771887 EBV:53780-53802 AGCTAAGGCCAGGGCTCCTTCGG + Intergenic
1185453429 X:295266-295288 AGCCACGGCCCCGTGTCCTCCGG + Intronic
1187134007 X:16529454-16529476 AGCCAAGGCCACCTCTCTTGAGG + Intergenic
1190117402 X:47635654-47635676 AGCCCAGGCCTTGGGACCTGGGG - Exonic
1194000916 X:88427681-88427703 AGCCATGGCTACAGCTCCTGAGG - Intergenic
1195410445 X:104564426-104564448 AGCTAAGGCCCAGGGTCCGGGGG + Intergenic
1195762075 X:108257421-108257443 AGCCAAGGCCACGTGTCCAGTGG + Intronic
1196882122 X:120208008-120208030 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1199552852 X:149077087-149077109 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1200215308 X:154365634-154365656 GGCCCAGGCCACAGTTCCTGGGG - Intronic