ID: 1152824969

View in Genome Browser
Species Human (GRCh38)
Location 17:82458865-82458887
Sequence TGCTTGTCCTGTGGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152824963_1152824969 -3 Left 1152824963 17:82458845-82458867 CCGGGGAGGCGCGCGCCTGGTGC 0: 1
1: 0
2: 0
3: 22
4: 170
Right 1152824969 17:82458865-82458887 TGCTTGTCCTGTGGGGCTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 236
1152824961_1152824969 4 Left 1152824961 17:82458838-82458860 CCGCGGGCCGGGGAGGCGCGCGC 0: 1
1: 0
2: 3
3: 54
4: 275
Right 1152824969 17:82458865-82458887 TGCTTGTCCTGTGGGGCTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152824969 Original CRISPR TGCTTGTCCTGTGGGGCTCT GGG Intronic
901076207 1:6556221-6556243 TACTTGTCATCTGGGACTCTAGG - Intronic
901436365 1:9249530-9249552 TGCCTGCCATATGGGGCTCTAGG + Intronic
901912790 1:12474049-12474071 TCCATGTCATGTGGGGCTTTTGG - Intronic
902831089 1:19013126-19013148 TGCTTGTCATATGGAACTCTGGG + Intergenic
903325924 1:22568482-22568504 AGCTACACCTGTGGGGCTCTTGG + Intronic
904500584 1:30910514-30910536 TACTTGTCCTGCAGGGCCCTTGG + Intergenic
904950618 1:34235723-34235745 TGATTTTCCTCTGGGGCCCTAGG + Intergenic
905930125 1:41780869-41780891 TGCTTGTCTTGGTGGCCTCTGGG - Intronic
907290665 1:53410415-53410437 TGCTTTTGCTGAGGGGCTGTAGG + Intergenic
907811399 1:57874245-57874267 TGCTTGTTCTGTGTTGCACTTGG - Intronic
911227293 1:95319894-95319916 TCCTTGTGCTGTGGTGCTTTTGG + Intergenic
913074099 1:115326557-115326579 TGCTTTTTCTGTGGTGTTCTTGG + Intronic
917678479 1:177342120-177342142 TGCGTGTCCTGTGTGGCTGTTGG - Intergenic
918067661 1:181112507-181112529 TGCTTGGCCTGTTGGCCTCCTGG + Intergenic
919796896 1:201326357-201326379 TCCTTGTCCTGTGGTGACCTTGG + Intronic
920529175 1:206689361-206689383 TGCCTGTACTGTGGGGATGTGGG - Intronic
920707345 1:208263625-208263647 TGCTTCTCATGTGGTGCACTTGG + Intergenic
922231495 1:223690811-223690833 TGGTTGTCCTGTAGGAGTCTAGG + Intergenic
922889666 1:229051674-229051696 TGCATTTCCTTTGGGGTTCTTGG - Intergenic
924129601 1:240892430-240892452 TGGTTGTCCTACGGGGCTTTTGG - Intronic
924507173 1:244696852-244696874 TGCTTTCCCTCTGGGACTCTGGG + Intronic
1063056636 10:2511662-2511684 TGCTTGTTCTCTGCAGCTCTGGG + Intergenic
1067048661 10:42999912-42999934 TGCTTCACCTGCGGGGCTCCTGG + Intergenic
1067077434 10:43196268-43196290 TGCTTGTCCTGTCCCCCTCTAGG - Exonic
1069893908 10:71668594-71668616 TGCTGGTCCTATAGGGCTGTTGG + Intronic
1071301706 10:84261139-84261161 TGTTGATCCTGTGGGCCTCTGGG + Intergenic
1071757515 10:88560449-88560471 TGCCTGGGCTGTGGGGCTCAGGG - Intronic
1072662047 10:97369201-97369223 TGCTTTCCATGTAGGGCTCTGGG + Intronic
1072754597 10:98010782-98010804 TTCTTTACCAGTGGGGCTCTAGG - Intronic
1073124912 10:101143129-101143151 TGTTTGTCCTCTAGAGCTCTGGG + Intergenic
1073704470 10:105967459-105967481 TGCCCTCCCTGTGGGGCTCTAGG - Intergenic
1074123147 10:110508208-110508230 TGCTTGTCCCCTGAGCCTCTGGG + Intronic
1075731428 10:124638947-124638969 AGCAGGTCCTGTGGGGCTCAGGG - Intronic
1075954749 10:126513313-126513335 TACCTGTCTTGTGGGGCTATGGG + Intronic
1076626125 10:131823027-131823049 TGCATCTCCTGTGGGGGTGTAGG - Intergenic
1076626161 10:131823156-131823178 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626185 10:131823242-131823264 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626238 10:131823415-131823437 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626248 10:131823458-131823480 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626284 10:131823586-131823608 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626294 10:131823629-131823651 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626327 10:131823756-131823778 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626408 10:131824052-131824074 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626442 10:131824180-131824202 TGCGTCTCCTGTGGGGGTTTAGG - Intergenic
1077064730 11:636091-636113 ACCTTGTCCTGTGAGGCTCACGG + Intergenic
1077120330 11:904539-904561 TGGGTGGCCTGTGTGGCTCTGGG - Intronic
1077271533 11:1684355-1684377 TGGGGGTCCTGTGGGCCTCTCGG - Intergenic
1077323542 11:1953407-1953429 TACGTATCCTGGGGGGCTCTGGG + Intronic
1077464203 11:2725845-2725867 CGCTTGGCCTGTGGGGCCCCAGG - Intronic
1077658005 11:4040833-4040855 AGCATGTCCTGTTGGGCCCTGGG + Intronic
1078071136 11:8111679-8111701 TGCTTGTCCTTTCGGGATCTTGG - Intronic
1079335356 11:19565916-19565938 TGTTTCTCCTCTGGAGCTCTGGG + Intronic
1082647413 11:55745268-55745290 TGTTTGTTTTGTGGGGCTCAGGG - Intergenic
1083778298 11:64905479-64905501 TGTGTGTCCTCTGGTGCTCTCGG - Intronic
1083820718 11:65169985-65170007 TGCCTGTCCTATGGGGCCTTAGG + Intergenic
1085958085 11:81425633-81425655 TGCTTGTCATGTGTGGTTTTGGG + Intergenic
1087979551 11:104594137-104594159 TTCTTGTGCTCTGGGGCTCGAGG - Intergenic
1088620146 11:111673494-111673516 TGACTTTCCTGTGGGCCTCTTGG + Intronic
1090667378 11:128923760-128923782 TGCTGCTGCTGTGGGGTTCTGGG - Intergenic
1202806529 11_KI270721v1_random:8602-8624 TACGTATCCTGGGGGGCTCTGGG + Intergenic
1091637109 12:2205471-2205493 ATCTTGCCCTGTGGTGCTCTTGG + Intronic
1091752847 12:3033395-3033417 TGCTGGACTTGCGGGGCTCTGGG - Intronic
1091828935 12:3535574-3535596 GCCTTGTCCTGTTGGGTTCTTGG - Intronic
1091998780 12:5016588-5016610 TGCTAGTCCTGTGGGGAGTTGGG + Intergenic
1096215747 12:49796683-49796705 AGCCTGGCCTGTGGGCCTCTGGG + Exonic
1101219509 12:102623193-102623215 TTTTTGTGCTGTGGTGCTCTTGG + Intergenic
1101838912 12:108313891-108313913 GGCTTGTCCTGTGTGACTCCAGG - Intronic
1102050025 12:109855585-109855607 TGGTGGTCCTTTGGGGCTCATGG + Intronic
1102261750 12:111447331-111447353 TGCTTCTCCTGGGGGGCTGCTGG + Exonic
1104841798 12:131829178-131829200 TCCTTGTCCAGTGGGGAGCTGGG - Intronic
1104891165 12:132140830-132140852 TGCCTTTCCTGTTGGGCTCACGG - Exonic
1105465452 13:20635546-20635568 TCTTTGTCCTCTGTGGCTCTTGG + Intronic
1105799540 13:23891663-23891685 TGCTTTCACTGTGGGGCTCACGG - Exonic
1105849506 13:24321372-24321394 TGCTTTCACTGTGGGGCTCACGG + Exonic
1107008803 13:35646828-35646850 TGTTTGCCCTGTCCGGCTCTGGG - Intronic
1107278995 13:38711879-38711901 GGCTTATCTTGTGGGTCTCTGGG + Intronic
1107527084 13:41243505-41243527 TTGTTGCCCTGTGGGACTCTGGG + Intronic
1108441326 13:50456266-50456288 TCCTTGTCCACTGTGGCTCTTGG + Intronic
1112325238 13:98439394-98439416 GGCTTCTCTAGTGGGGCTCTGGG + Intronic
1113657790 13:112079692-112079714 TGCTGAGCTTGTGGGGCTCTGGG - Intergenic
1113830538 13:113292184-113292206 AGTTTGTCCTCTGGGGCTGTCGG - Intergenic
1114181871 14:20374500-20374522 TGATGGCTCTGTGGGGCTCTGGG - Exonic
1118744272 14:68762733-68762755 CACTTGGCCTCTGGGGCTCTGGG - Intergenic
1119017513 14:71074694-71074716 TGCTGATACTGTGTGGCTCTAGG + Intronic
1120526644 14:85584565-85584587 TGTCTGTCCTCTGTGGCTCTGGG - Intronic
1121613811 14:95299396-95299418 TGCGTGTCCCGTGGGGCTGGAGG - Intronic
1121648025 14:95534561-95534583 CGCTTGTCGTGTTGGTCTCTTGG - Intronic
1122198545 14:100107973-100107995 TGCTTGTTCTCTTTGGCTCTTGG + Intronic
1123137739 14:106045218-106045240 TGGTTGTCTTGTGGGCCTTTAGG + Intergenic
1123457754 15:20441361-20441383 AGCAGGTCCTGTGGGGCTGTGGG - Intergenic
1123660316 15:22559056-22559078 AGCAGGTCCTGTGGGGCTGTGGG + Intergenic
1123891723 15:24787652-24787674 TTCTTTTCCTGTAGGGCTTTAGG - Intergenic
1124263900 15:28216515-28216537 AGCAGGTCCTGTGGGGCTGTGGG - Intronic
1124314174 15:28653545-28653567 AGCAGGTCCTGTGGGGCTGTGGG + Intergenic
1124848280 15:33311758-33311780 TCCCTGTCCTGCGGGGCTCGCGG - Intronic
1126190982 15:45878418-45878440 TGCTTTTGCTTTGGGGTTCTTGG - Intergenic
1127871335 15:63076363-63076385 TGCCTTTCCAGTGGGACTCTTGG + Intergenic
1129704667 15:77787410-77787432 TTCTTGTCCTGCTTGGCTCTCGG - Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132629628 16:910961-910983 GGATTGTCCTGTGGGGCTTCCGG - Exonic
1132693709 16:1192935-1192957 TGCTTGTCCTGTGGGTGCCTCGG - Intronic
1132826143 16:1906649-1906671 TTCGTGTCCTCAGGGGCTCTCGG - Intergenic
1136293328 16:29288652-29288674 TGCTTGGTCTGTGGGGATCCAGG - Intergenic
1136702220 16:32154726-32154748 AGCAGGTCCTGTGGGGCTGTGGG - Intergenic
1136765449 16:32772759-32772781 AGCAGGTCCTGTGGGGCTGTGGG + Intergenic
1136802650 16:33097620-33097642 AGCAGGTCCTGTGGGGCTGTGGG - Intergenic
1138445010 16:57058238-57058260 TCCTTGTCCTCTGGTGCTCTGGG - Intronic
1139491089 16:67286430-67286452 TGCTTGTCCTGTGGGCGGATGGG - Exonic
1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG + Intronic
1141595144 16:85092812-85092834 TGCGTGGCCTGTGTGGCTCCGGG - Exonic
1142066795 16:88067472-88067494 GGCTTGTCCTGAGGGGCTCTAGG + Intronic
1203067835 16_KI270728v1_random:1034981-1035003 AGCAGGTCCTGTGGGGCTGTGGG + Intergenic
1143602869 17:7960679-7960701 TGCTGCTCCTGTGGTCCTCTGGG + Intergenic
1143619254 17:8071840-8071862 TGCTTGTTCTGTCTGGCCCTTGG - Intergenic
1144750139 17:17642752-17642774 TCCCTGTCCTGTGGAGCTCATGG - Intergenic
1145309936 17:21695855-21695877 TCCATCTCCTGTGGGGCCCTGGG + Intronic
1146217065 17:30985775-30985797 TGCTGGTCCTGTGAGGATTTGGG - Intronic
1148286693 17:46399731-46399753 TTCTTCTTCTGTGGTGCTCTAGG - Intergenic
1148308859 17:46617321-46617343 TTCTTCTTCTGTGGTGCTCTAGG - Intronic
1150930042 17:69574912-69574934 TGCTCATCCTGTGTGGCTTTGGG + Intergenic
1151631822 17:75316167-75316189 TGCTAGTCCTGTGGTCCACTTGG - Intergenic
1152533681 17:80937897-80937919 TGCTTGTCCTGTGACCCTCGTGG + Intronic
1152801212 17:82331511-82331533 AGCTTGTCCCGTGGGACACTCGG + Intronic
1152824969 17:82458865-82458887 TGCTTGTCCTGTGGGGCTCTGGG + Intronic
1153700259 18:7685661-7685683 TGCTTTTGCTGTGTGGCCCTAGG - Intronic
1153817382 18:8802209-8802231 TGCGTGCCTTGTGGGGGTCTGGG + Intronic
1155158524 18:23177669-23177691 GTCCTGTCCTGTTGGGCTCTGGG + Intronic
1157812677 18:50709035-50709057 AGCTTGTTCTCTGAGGCTCTGGG - Intronic
1158543190 18:58374980-58375002 TGCTTCTCCTGAGAGGCTCACGG + Intronic
1158938152 18:62384164-62384186 TGCTTGTGAGGTGGGACTCTGGG - Intronic
1159252528 18:65898296-65898318 AGCTCTTCCTGTGGAGCTCTTGG - Intergenic
1159938796 18:74389654-74389676 GGCTTATCCTGTGAGGTTCTTGG + Intergenic
1160089935 18:75817556-75817578 TGCTTCTCCTGTGAGCCACTGGG + Intergenic
1160737555 19:670870-670892 AGCGTGTTCTGTGGGGCTCTAGG - Intergenic
1160750314 19:731039-731061 TGCATCCCCGGTGGGGCTCTGGG - Intronic
1161492493 19:4569875-4569897 TTCTTCTTCTGTGGGGCACTGGG - Intergenic
1161704382 19:5812293-5812315 AGCTTGTCTTGAGGGACTCTGGG - Intergenic
1162057639 19:8074258-8074280 TGCTTGTCCCCTGGGGATCTTGG - Intronic
1166291462 19:41866342-41866364 TGGTTGTGCCCTGGGGCTCTGGG - Intronic
1167442181 19:49514647-49514669 AGTTTGTCCTGGGGGGCGCTGGG - Intronic
1167760006 19:51440297-51440319 TGCTTCTCCAGTGGGGATCCAGG + Intergenic
1167919160 19:52768505-52768527 TGCCTGTCCTGTGTGGATATAGG - Intronic
925478948 2:4248742-4248764 TGGTTGTCCTCTGAGGCTCTTGG - Intergenic
925796688 2:7553400-7553422 TGGTGGTCCTGTGGGGCTCAGGG - Intergenic
926375335 2:12222036-12222058 CCCTAGTCCTGTGGGGCTCTTGG - Intergenic
928450999 2:31378562-31378584 TGCATGTCATGTGTGGCTCTGGG + Intronic
931609538 2:64083696-64083718 TCCTTGTCCTGTGGGACTCCTGG - Intergenic
932839693 2:75070626-75070648 TGTTTCTCCTGTGTGTCTCTGGG + Intronic
933462933 2:82612378-82612400 TACATGCCCTCTGGGGCTCTGGG + Intergenic
934717240 2:96551152-96551174 TGCTGTTCCTGGGGGGCTCCTGG - Exonic
935352071 2:102159647-102159669 TGCTTTTGCTGTGGAGCTCTTGG + Intronic
938293599 2:130163179-130163201 TGCTCCTCCCGTGGGGCTCTGGG - Intronic
944966896 2:204945228-204945250 TTGTTTTCCTGAGGGGCTCTGGG + Intronic
947484869 2:230538763-230538785 TTCTTTTCCTGGAGGGCTCTGGG - Intronic
947623624 2:231605792-231605814 TGCTTGGCCTGTTGGGCTGGGGG - Intergenic
947819319 2:233059512-233059534 AGCCTGCCCTGTGGGGCTTTGGG + Intergenic
948163727 2:235845163-235845185 TCCTTGACATGTGTGGCTCTTGG - Intronic
948447385 2:238043478-238043500 TGCTTGGCCAGTGGGGCCCTTGG + Intronic
1170907831 20:20531544-20531566 TGCATGTGCTGTGAGGCTCCCGG - Intronic
1172515385 20:35529335-35529357 TTTTTGTCCTGTGGGTCTTTTGG - Exonic
1174295183 20:49540544-49540566 TGCTTGATCTGAGGGGCTCTGGG + Intronic
1175140196 20:56855293-56855315 TGCTTGTCCTGGTTTGCTCTTGG + Intergenic
1175951494 20:62585945-62585967 TGCATGTCCTGTGTTGCTGTGGG + Intergenic
1176191222 20:63811090-63811112 TGCCCATCCTGTGGGGTTCTGGG - Intronic
1176191265 20:63811216-63811238 TGCCCATCCTGTGGGGTTCTGGG - Intronic
1176262185 20:64187684-64187706 TTCTTCTCCTGTGGCCCTCTTGG - Intronic
1179883059 21:44301388-44301410 GTCCTGTCCTGTGTGGCTCTGGG + Intronic
1179883397 21:44302816-44302838 GTCCTGTCCTGTGTGGCTCTGGG + Intronic
1181876066 22:25941804-25941826 TGCTTGACTTGTGTGCCTCTGGG + Intronic
1182121198 22:27787977-27787999 AGCTTTCCCTGTGGGGCTCGGGG - Intronic
1183230381 22:36578438-36578460 TGCTGTTCCACTGGGGCTCTGGG + Intronic
1183348963 22:37324178-37324200 TCCTGGTGCTGAGGGGCTCTTGG - Intergenic
1183397462 22:37580176-37580198 TGCTTCCCCTCTCGGGCTCTGGG - Intronic
949953685 3:9250128-9250150 TCATTGGCTTGTGGGGCTCTGGG + Intronic
950462498 3:13133849-13133871 TCCTTGTCCTATGGAGGTCTCGG - Intergenic
950689700 3:14646197-14646219 TTCTTGTCTTGCAGGGCTCTGGG - Intergenic
953436493 3:42881396-42881418 TGGTTGTCCTGGGGGGTTTTGGG + Intronic
954124428 3:48520355-48520377 TCCTTGGCCTGTCGGGCTCAGGG + Intronic
954177833 3:48858464-48858486 TGCTTTCCCTCTGGGGCTCAGGG - Intronic
954628836 3:52037442-52037464 TGCCTGTCCTGAGGGTTTCTGGG - Intergenic
957698825 3:83682377-83682399 TTCTTGTTCTGTGAGTCTCTTGG - Intergenic
960189796 3:114689545-114689567 TGCTTGGCCTCTTTGGCTCTTGG - Intronic
961053346 3:123766362-123766384 TGCATGTGCTGTGGGCCTCGAGG - Intronic
961358074 3:126351467-126351489 TACTTACCCTGTGGGGCTGTGGG + Intronic
961452581 3:127009062-127009084 AGCTGGTCCTGGGGGCCTCTCGG + Intronic
961675210 3:128560841-128560863 TCTCTGTCCTGGGGGGCTCTGGG - Intergenic
961928491 3:130508857-130508879 TGCCAGTCCTTTGGGGCTCATGG - Intergenic
963183495 3:142387042-142387064 TGTTTCTCATTTGGGGCTCTTGG - Intronic
964861738 3:161210061-161210083 TCCTTGTCCTCTGGGGCTTATGG + Intronic
968044630 3:195617179-195617201 TGGTTGTCCTGTGGACCTCAGGG - Intergenic
968060418 3:195723230-195723252 TGGTTGTCCTGTGGACCTCAGGG - Intronic
968516685 4:1018503-1018525 TGCCTGTGCTGGGGGCCTCTCGG + Intronic
968784579 4:2610383-2610405 TGCTTGCCCTGTTGGGTTTTAGG + Intronic
977276874 4:94988727-94988749 TGATTTTCCTGTGGGGTCCTGGG + Intronic
977573235 4:98651481-98651503 TGGTTGTACTGTGGTGATCTAGG + Intronic
984521884 4:180811776-180811798 TCCTTGTCATTTGGGGGTCTGGG - Intergenic
986045016 5:4028318-4028340 TGCTGGTCCTGAGAGGCTCCAGG - Intergenic
986140492 5:5025618-5025640 TCCATGCCCTGTGTGGCTCTCGG - Intergenic
989547592 5:42692637-42692659 TGTTTGTCCTGTGGAGTTCATGG + Intronic
990176506 5:53114209-53114231 AGCATGTCCTCTGGGGCTTTGGG - Intergenic
994659418 5:102635653-102635675 TGCATTTGCTTTGGGGCTCTTGG - Intergenic
996228760 5:121034516-121034538 TACTTTTCCTCTGGGTCTCTAGG + Intergenic
997869093 5:137491105-137491127 TACTTGCATTGTGGGGCTCTGGG - Intronic
999104906 5:149062641-149062663 TTCCTGTCCTGGGGGGATCTCGG + Intronic
1001879813 5:175233590-175233612 TATTTGTCCTGTGGGGCTCATGG - Intergenic
1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG + Intronic
1005844947 6:29769923-29769945 TGATTGTGCTGTGGGCATCTGGG - Intergenic
1007711246 6:43825729-43825751 TGCATGTCCTGAGGGGCTGGGGG + Intergenic
1010542853 6:77113548-77113570 TCCCTGTACTGTGGGGCTATGGG + Intergenic
1010580001 6:77584439-77584461 TGCTTGTCCCCTGGGGCATTTGG + Intergenic
1012192127 6:96293054-96293076 TGCATTTCCTTTTGGGCTCTTGG - Intergenic
1017058641 6:150460208-150460230 TGTGTGTCATGTGGGGCTCGAGG - Intergenic
1018659388 6:166071958-166071980 TGCTTGTGTTGTGGTGCTTTGGG + Intergenic
1018793698 6:167170066-167170088 TGCTTGTGCTGTGTGTCACTCGG - Intronic
1018822635 6:167385015-167385037 TGCTTGTGCTGTGTGTCACTCGG + Intergenic
1018938309 6:168289390-168289412 CGCTTGCCCGGTGGGGATCTGGG - Intergenic
1019535877 7:1529795-1529817 TGGGTGTCCTGGGGGGCCCTCGG + Intergenic
1019615727 7:1959514-1959536 GGCTTGTCCTGATGTGCTCTGGG - Intronic
1019811076 7:3165501-3165523 TGCTTGGTCTGGGTGGCTCTGGG + Intronic
1019862337 7:3671042-3671064 TGTTTCTCCTATTGGGCTCTAGG + Intronic
1020697812 7:11437128-11437150 AGCCTGGCCTGAGGGGCTCTGGG + Intronic
1021631027 7:22647522-22647544 TGGTTCTCCTGTGGGGGTCCAGG + Intergenic
1022325979 7:29332281-29332303 TGCCTACCCTGTGGGGTTCTTGG + Intronic
1026869059 7:73839932-73839954 CGCTTAGCCTGAGGGGCTCTGGG + Intronic
1027172342 7:75881640-75881662 TGCCTCTCCTTTGAGGCTCTGGG + Intronic
1030018289 7:105246236-105246258 TGGCTGTCCTTAGGGGCTCTGGG - Intronic
1032708344 7:134441459-134441481 AGCCTGTGCAGTGGGGCTCTGGG + Intergenic
1033884633 7:145930310-145930332 CACTTGTCCTGTGCTGCTCTGGG - Intergenic
1034633030 7:152545423-152545445 TGCTTGTCCTGTTGGGATGCTGG - Intergenic
1035536649 8:396119-396141 TACTAGTCCTGAGGGGCTCTGGG - Intergenic
1037768351 8:21785219-21785241 GGATCATCCTGTGGGGCTCTAGG - Intronic
1038200521 8:25408797-25408819 TGCTTTTCTGGTTGGGCTCTAGG - Exonic
1038281324 8:26167940-26167962 TGCTTGTACTGTGGGGCAGAAGG + Intergenic
1038779076 8:30555813-30555835 TGCTTGTTCTGCTGGGCTTTTGG - Intronic
1042114456 8:65415453-65415475 TCCTTTTCCTGTTTGGCTCTTGG - Intergenic
1044738783 8:95304611-95304633 TCCTTGTCCTTGGGGACTCTTGG + Intergenic
1047330641 8:123884051-123884073 TGCATGCCCTTTGGAGCTCTTGG + Intronic
1052121193 9:24718914-24718936 TGCATTTCCTTTGGGGTTCTTGG + Intergenic
1054885677 9:70195746-70195768 TGCTTGTGCTTTGGGCCACTAGG - Intronic
1056678626 9:88697668-88697690 TGCGAGGCCTGTGGGGATCTTGG + Intergenic
1056999372 9:91493283-91493305 AGCTTGTCCCCTGTGGCTCTGGG - Intergenic
1060302058 9:122380113-122380135 TGCTAGTCCTTTTGGACTCTTGG + Intronic
1060606757 9:124921695-124921717 TGCTTGGTCTGTGGGGCCCTTGG - Intronic
1060889094 9:127176987-127177009 TGCTCATCCTGTTGGGCTCAGGG + Intronic
1061411169 9:130422513-130422535 TGCTTGTGCTGTGGGCCCCGGGG + Intronic
1061857132 9:133448556-133448578 AGCCTGTCCCTTGGGGCTCTGGG + Intronic
1061946588 9:133911871-133911893 ATCCTGACCTGTGGGGCTCTGGG - Intronic
1062389054 9:136326946-136326968 TGCTTGGCCTGTGGGACGGTTGG - Intergenic
1187952632 X:24485797-24485819 TGGGAGCCCTGTGGGGCTCTTGG - Intronic
1189007402 X:37009907-37009929 CGCGTGTCTTGGGGGGCTCTGGG - Exonic
1192772000 X:74202928-74202950 TGCTTGTACCGTCAGGCTCTTGG - Intergenic
1193937928 X:87645005-87645027 TGCATGTGCTTTTGGGCTCTTGG - Intronic
1195938027 X:110143729-110143751 TGCTTGCCCTGTGGGGAACAGGG + Intronic
1195944040 X:110190290-110190312 TGATTGTCCTGTGGGATCCTGGG + Intergenic
1196519795 X:116660474-116660496 TCCTGGTCCTGAGTGGCTCTGGG + Intergenic
1196819557 X:119692353-119692375 TGCTTGTGCTGTGTGCCTCTGGG - Intronic
1199599248 X:149531977-149531999 GGCTTGCCCTGGTGGGCTCTTGG - Intronic
1200967891 Y:9117567-9117589 TGCTTGTCCTTGGGGGTTATAGG + Intergenic