ID: 1152824969

View in Genome Browser
Species Human (GRCh38)
Location 17:82458865-82458887
Sequence TGCTTGTCCTGTGGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152824963_1152824969 -3 Left 1152824963 17:82458845-82458867 CCGGGGAGGCGCGCGCCTGGTGC 0: 1
1: 0
2: 0
3: 22
4: 170
Right 1152824969 17:82458865-82458887 TGCTTGTCCTGTGGGGCTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 236
1152824961_1152824969 4 Left 1152824961 17:82458838-82458860 CCGCGGGCCGGGGAGGCGCGCGC 0: 1
1: 0
2: 3
3: 54
4: 275
Right 1152824969 17:82458865-82458887 TGCTTGTCCTGTGGGGCTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152824969 Original CRISPR TGCTTGTCCTGTGGGGCTCT GGG Intronic