ID: 1152825338

View in Genome Browser
Species Human (GRCh38)
Location 17:82461286-82461308
Sequence TTGGATACATAACCTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152825336_1152825338 6 Left 1152825336 17:82461257-82461279 CCTTAGCTAGTAGCTATGGTCTC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1152825338 17:82461286-82461308 TTGGATACATAACCTGAGCCTGG 0: 1
1: 0
2: 3
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152825338 Original CRISPR TTGGATACATAACCTGAGCC TGG Intronic
901236736 1:7671304-7671326 CTGGATACATCGCCTGGGCCTGG - Intronic
904786690 1:32988214-32988236 TTGTATACATAGCTGGAGCCTGG - Intergenic
909369937 1:74871785-74871807 TTGTATACATAGTCTGAGGCTGG - Intergenic
912527877 1:110298171-110298193 GAGGATACATAACCTGCCCCTGG - Intergenic
917357506 1:174142108-174142130 GTGGGAACATCACCTGAGCCTGG + Intergenic
917896305 1:179491215-179491237 ATGGATGGATCACCTGAGCCTGG + Intronic
918399376 1:184148030-184148052 TTGGAAGCAGAACCTGAGGCAGG - Intergenic
920057821 1:203205689-203205711 TTGGCTCCATAACATGAGCCAGG - Intergenic
920867251 1:209763288-209763310 TGGGATATAGAACCAGAGCCTGG - Intronic
922580039 1:226690270-226690292 TTGAATACATACCATCAGCCAGG + Intronic
922906992 1:229181101-229181123 TTGGGAAGATCACCTGAGCCTGG + Intergenic
923594701 1:235352068-235352090 TTGGATACATGACCTAATCTTGG + Intergenic
923701720 1:236306135-236306157 GTGGAGACAGAATCTGAGCCAGG + Intergenic
924713810 1:246553572-246553594 GTGGAAGCATCACCTGAGCCTGG + Intronic
1067306290 10:45067291-45067313 TTGGATGCATATTCTGAGCCAGG + Intergenic
1073735853 10:106345419-106345441 TTGAGTACATATCATGAGCCAGG + Intergenic
1074603932 10:114941636-114941658 TTGTAAACATAAAGTGAGCCGGG - Intronic
1080654484 11:34248009-34248031 GTGGATCCATAAGCTGAGCAAGG - Intronic
1081286197 11:41273265-41273287 TTGGATACATAACCGGAAGTGGG - Intronic
1085639605 11:78184842-78184864 TTGGGAAAATCACCTGAGCCTGG - Intronic
1087462739 11:98465750-98465772 TTGGATACAGAATATTAGCCTGG + Intergenic
1089047985 11:115520392-115520414 TTGTATATATAATATGAGCCAGG + Intergenic
1091410838 12:238125-238147 TTGTACAGATAACCTTAGCCTGG - Intronic
1092343308 12:7694631-7694653 TTGGATACCTATGGTGAGCCAGG - Intronic
1094014350 12:25846689-25846711 TTGGCTACATGACCTGAGTCAGG - Intergenic
1094766649 12:33603539-33603561 TTGGATAAATTACCTGAAGCTGG + Intergenic
1095680715 12:44972153-44972175 TTGAATGCCTAACTTGAGCCAGG - Intergenic
1098263465 12:68695258-68695280 TTGGATATATACCCAGAGGCAGG - Intronic
1101513364 12:105412207-105412229 TTGGATACCTACTATGAGCCAGG - Intergenic
1101645761 12:106629572-106629594 TAGGAGCCATCACCTGAGCCTGG - Intronic
1101853785 12:108425475-108425497 TTAGAAGCAGAACCTGAGCCAGG + Intergenic
1102463433 12:113114378-113114400 GTGGAAAAATTACCTGAGCCCGG + Intronic
1106707579 13:32298416-32298438 TTGGATACCTATCATGACCCAGG + Exonic
1107663162 13:42660500-42660522 TTGAATACATAGCCTGACACAGG + Intergenic
1109580504 13:64326258-64326280 TAGAATACAGAATCTGAGCCAGG + Intergenic
1110247296 13:73341454-73341476 GTGGAAGGATAACCTGAGCCTGG - Intergenic
1114538177 14:23436113-23436135 TTGGATACAGGACCTGGGCCAGG - Intergenic
1115863734 14:37718842-37718864 GTGGGAAGATAACCTGAGCCTGG + Intronic
1117157060 14:52951356-52951378 TTGGATTCAATTCCTGAGCCGGG - Intronic
1117746261 14:58872648-58872670 ATGGATACCTAACCTGAGCCAGG + Intergenic
1118014982 14:61651233-61651255 CTGGATACATATCCTGGGCCAGG + Intronic
1122545454 14:102519372-102519394 GTGGATGGATCACCTGAGCCTGG + Intergenic
1123788208 15:23693459-23693481 GTGGGAAAATAACCTGAGCCTGG - Intergenic
1123908878 15:24947332-24947354 TTTAAAACATAACCTGAGGCTGG + Intronic
1124911386 15:33924421-33924443 GTGGAAACATCACCTGAACCTGG - Intronic
1126699569 15:51355910-51355932 TAGAATACCTAACCTCAGCCGGG + Intronic
1127368958 15:58318296-58318318 ATGGAAACATAAACAGAGCCAGG + Intronic
1127465749 15:59242823-59242845 TAGAATGCATGACCTGAGCCTGG + Intronic
1127521351 15:59746100-59746122 GTGGAAAGATCACCTGAGCCCGG - Intergenic
1130410515 15:83644256-83644278 TTTGATATTTAATCTGAGCCTGG - Intergenic
1134211896 16:12284525-12284547 CTGGGTACATGACCTGAGCTAGG + Intronic
1135048856 16:19176291-19176313 ATTGGTACATAACCCGAGCCAGG - Intronic
1135545882 16:23366297-23366319 GTGGATTGATCACCTGAGCCTGG - Intronic
1136948212 16:34682208-34682230 TAGGAAACATTAACTGAGCCTGG - Intergenic
1136955601 16:34782083-34782105 TAGGAAACATTAACTGAGCCTGG - Intergenic
1139167376 16:64583302-64583324 TGGGAGAAATCACCTGAGCCCGG + Intergenic
1143380583 17:6493705-6493727 TTGAACACATCACCTTAGCCTGG - Intronic
1144257673 17:13485777-13485799 GTGGAAGGATAACCTGAGCCTGG + Intergenic
1144931125 17:18859599-18859621 TTGGAGAGATAAGCAGAGCCTGG + Intronic
1148896718 17:50843200-50843222 TTGGTTACCTGACCTGAGCAGGG - Intergenic
1149683770 17:58523279-58523301 GTGGGAAGATAACCTGAGCCCGG + Intronic
1149804797 17:59606203-59606225 TTGGATATACAAACTTAGCCAGG - Intronic
1149807408 17:59631874-59631896 GTGGATGGATCACCTGAGCCTGG + Intronic
1152825338 17:82461286-82461308 TTGGATACATAACCTGAGCCTGG + Intronic
1155511184 18:26578988-26579010 TGGGATACATAAAATAAGCCTGG - Intronic
1155793311 18:30001185-30001207 TTGGATACCTACTCTGTGCCTGG + Intergenic
1156185067 18:34652919-34652941 GTGGATACATATTCTGAACCTGG + Intronic
1156264613 18:35475574-35475596 GTAGATGCATCACCTGAGCCTGG + Intronic
1158120390 18:54042368-54042390 TTGTATACTCAACATGAGCCAGG + Intergenic
1159038172 18:63297446-63297468 TTGGCCACATTACGTGAGCCTGG + Intronic
1159648758 18:70952529-70952551 CTGGTTCCAGAACCTGAGCCAGG - Intergenic
1160237940 18:77100643-77100665 GTGGAAAGATCACCTGAGCCTGG - Intronic
1161747205 19:6068304-6068326 TTGGATCCATAGCATGGGCCTGG + Intronic
1166919102 19:46216508-46216530 TTGGTTACAGAACCTTAGCCAGG - Intergenic
1168496798 19:56859501-56859523 TGGGATACTTACCCTGTGCCAGG + Intergenic
927006025 2:18850147-18850169 TTGGATACCTAGTTTGAGCCTGG + Intergenic
931008316 2:57878608-57878630 TTATATACATAAACAGAGCCAGG + Intergenic
942203527 2:173595779-173595801 TTGGATACATATCCTGAAGTGGG - Intergenic
943970467 2:194398576-194398598 TTGGAAAGATTGCCTGAGCCTGG - Intergenic
944830458 2:203529069-203529091 TTGGGAGCATCACCTGAGCCTGG - Intronic
947705646 2:232273478-232273500 TTAGATACATATTATGAGCCAGG + Intronic
1169170529 20:3461138-3461160 TTAGATACACAACCTGGGCTTGG - Intergenic
1169294195 20:4378780-4378802 GTGGAAAGATAACCTGAGCCTGG - Intergenic
1169931515 20:10837968-10837990 TTGGAAACATAACTTCAGTCTGG - Intergenic
1171393412 20:24815795-24815817 TAGGATACAAAACAAGAGCCAGG - Intergenic
1179082652 21:38187410-38187432 TTGGATACCCAACATCAGCCAGG - Intronic
1180078882 21:45477422-45477444 GTGGAGACAGAATCTGAGCCAGG - Exonic
1180814875 22:18783034-18783056 TTGGATGCAGAAACTGAGGCTGG - Intergenic
1181980899 22:26765563-26765585 TTGGATACTTACCCTATGCCAGG - Intergenic
1183123911 22:35756255-35756277 ATGAATACATAACCTGGGCTTGG + Intronic
1184601364 22:45545537-45545559 GTGGATATAGAACCAGAGCCTGG + Intronic
950504910 3:13388671-13388693 TTGGAGACAAAGCCTGGGCCAGG - Intronic
951812357 3:26714827-26714849 TGGGCTACATACCCTCAGCCAGG + Intergenic
955132725 3:56187062-56187084 TAGGAAATCTAACCTGAGCCTGG + Intronic
955604942 3:60691461-60691483 GTGGGTAGATCACCTGAGCCTGG - Intronic
956185011 3:66553926-66553948 GTGGATGCATAGCTTGAGCCTGG + Intergenic
960772409 3:121209273-121209295 TTGGATACATAACCAGAAATGGG + Intronic
961972343 3:130982865-130982887 GTGGATGCATAACCTGAGTGTGG - Intronic
962559901 3:136594862-136594884 TTGGGAAAATCACCTGAGCCCGG - Intronic
966972124 3:185053767-185053789 TTTGATACATAACTTGGGGCAGG - Intergenic
968580892 4:1394438-1394460 TTTGATACAAAATGTGAGCCAGG + Exonic
972530766 4:39959443-39959465 TTGGAAGGATCACCTGAGCCTGG - Intronic
972583642 4:40417146-40417168 GTGGAAAGATCACCTGAGCCTGG + Intergenic
974695191 4:65358781-65358803 TTGTATACCTCACCTGAGACAGG + Intronic
975025639 4:69545050-69545072 TTGGATCAATAACCACAGCCAGG - Intergenic
975456953 4:74602943-74602965 ATGGATACATAACTTGAGGTTGG - Intergenic
977295526 4:95204736-95204758 TGGGACACACACCCTGAGCCAGG - Intronic
978753134 4:112274581-112274603 TTGGAAACATAAAAAGAGCCAGG + Exonic
980470696 4:133247832-133247854 ATGAATGGATAACCTGAGCCAGG - Intergenic
981374562 4:143998989-143999011 TCGGATCCATTGCCTGAGCCTGG - Intronic
987168407 5:15225429-15225451 TTGAATGCATAATATGAGCCAGG - Intergenic
990175147 5:53099603-53099625 TTGGACTCATAACCAGGGCCTGG - Intronic
992935522 5:81699947-81699969 GTGGAAAGATTACCTGAGCCTGG - Intronic
996244711 5:121247615-121247637 TTAGATACATAACCAGAAGCTGG - Intergenic
997299536 5:132792488-132792510 TTAGAAACATCTCCTGAGCCAGG + Intronic
999218512 5:149956080-149956102 GTGGAAAGATCACCTGAGCCTGG + Intergenic
999483315 5:151968940-151968962 TTGGATACATACCCAGAGATTGG + Intergenic
1001903663 5:175452906-175452928 GTAGACACATAACCTGAGACAGG + Intergenic
1003078682 6:3003794-3003816 TTGGACACAAAGCCTGTGCCTGG + Intronic
1003084659 6:3051936-3051958 TTGGACACAAAGCCTGTGCCTGG - Intergenic
1003734196 6:8859026-8859048 TTGGAAACAAAATCAGAGCCAGG + Intergenic
1006287004 6:33104364-33104386 ATGGATACTTAACCTGTGCAGGG - Intergenic
1017189575 6:151637891-151637913 TTGGATACATATCCTGAAGTGGG + Intergenic
1019078825 6:169413417-169413439 TTTAATACATAACCTGGGGCTGG - Intergenic
1020530388 7:9326020-9326042 TTGGATATATATCCAGAGGCGGG - Intergenic
1020655137 7:10920299-10920321 GTGGAAAGATCACCTGAGCCCGG - Intergenic
1021013589 7:15503167-15503189 TTGGATAGATGAGATGAGCCAGG + Intronic
1022465640 7:30651742-30651764 TTGGGAAGATCACCTGAGCCTGG + Intergenic
1023782510 7:43669962-43669984 TTTGGTACTTAACCTCAGCCAGG - Intronic
1024646858 7:51378152-51378174 GTGGAAAGATCACCTGAGCCCGG - Intergenic
1032329718 7:130966622-130966644 TTGGATATATGACCTGAGCCAGG + Intergenic
1033817914 7:145097718-145097740 TTGGATACATACCCTGAAATTGG + Intergenic
1034163706 7:149010397-149010419 GTGGAAAAATCACCTGAGCCTGG + Intronic
1034832588 7:154322151-154322173 GTGGACACATAACTTTAGCCAGG - Intronic
1039831089 8:41215633-41215655 TTGAATACATAAACTCAGCAAGG + Intergenic
1041084975 8:54248308-54248330 TTGGATATATACCCAGAGGCAGG - Intergenic
1042770019 8:72369749-72369771 TTGAGTACATAATCTGAGCAAGG + Intergenic
1044552100 8:93524007-93524029 TTGCCTACAGAACCTCAGCCAGG - Intergenic
1045004443 8:97905754-97905776 GTGGAAAGATCACCTGAGCCAGG - Intronic
1046293471 8:112192890-112192912 ATGGAAAGATCACCTGAGCCTGG + Intergenic
1048301752 8:133256462-133256484 CTGGGTACATAACTTGTGCCAGG - Intronic
1048735014 8:137489467-137489489 TTAGATACATAACCTTGGGCAGG - Intergenic
1049277780 8:141728502-141728524 TTGAAAACATAAACTGAGCGGGG + Intergenic
1051020714 9:12539308-12539330 TTGGAGAGATAACCTCCGCCCGG + Intergenic
1053121209 9:35548447-35548469 CTGGATCCATCAGCTGAGCCAGG - Exonic
1056538352 9:87550931-87550953 TTGGATACATACCCTGACCCCGG + Intronic
1057919563 9:99085861-99085883 TGAGCTACATAACATGAGCCAGG - Intergenic
1059364448 9:113775151-113775173 TTGGCCACATGACCCGAGCCTGG + Intergenic
1061736565 9:132664613-132664635 TTGGGGGCATCACCTGAGCCCGG + Intronic
1186705225 X:12133684-12133706 TTCAAAACATATCCTGAGCCTGG + Intergenic
1187131737 X:16509519-16509541 TTGGGTACCTAATCTGGGCCAGG + Intergenic
1188425465 X:30042021-30042043 TTGAATACATACCATGTGCCAGG - Intergenic
1191767773 X:64718810-64718832 TTGGATATATAACCAGAGGTGGG - Intergenic
1193917824 X:87387832-87387854 GTGGAAAGATCACCTGAGCCTGG - Intergenic
1195124090 X:101787677-101787699 TTGGATACATAAACTGATTAAGG - Intergenic
1195997167 X:110742733-110742755 TTAGTAACATTACCTGAGCCTGG - Intronic
1196027979 X:111062732-111062754 TTGGCTTCATAACCTAAGGCAGG - Intronic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic