ID: 1152826530

View in Genome Browser
Species Human (GRCh38)
Location 17:82469473-82469495
Sequence CTCTATAAGCAAATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152826530_1152826538 15 Left 1152826530 17:82469473-82469495 CCTCCCTCCATTTGCTTATAGAG 0: 1
1: 0
2: 2
3: 15
4: 161
Right 1152826538 17:82469511-82469533 TGAGCATCCTCATAGCATGATGG 0: 1
1: 0
2: 9
3: 66
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152826530 Original CRISPR CTCTATAAGCAAATGGAGGG AGG (reversed) Intronic
900199190 1:1395715-1395737 ATCTATAAGGAAAAGCAGGGAGG - Intronic
903514787 1:23903003-23903025 CTCTGCAAGCAAAAGCAGGGAGG + Intronic
903756122 1:25662244-25662266 TTGAATAAGCAAATGCAGGGAGG + Intronic
904345926 1:29869452-29869474 CTTTCTAAGGATATGGAGGGTGG - Intergenic
904926725 1:34055259-34055281 TTCTGTAACCAAATGGAGGTGGG + Intronic
905543879 1:38782165-38782187 CTAAGTAAGGAAATGGAGGGTGG + Intergenic
908313296 1:62907242-62907264 CTCCATAAGCACAAGGAGAGGGG + Intergenic
908821491 1:68091923-68091945 CTCTATAAGCCAAAAGAGAGTGG - Intergenic
909537652 1:76756148-76756170 CTTTATAATGTAATGGAGGGTGG + Intergenic
910104437 1:83616300-83616322 CTCTATAAGCAAAGGGAGTGGGG - Intergenic
910786864 1:91008425-91008447 ATCTACAAACAAATGGAGGTAGG + Intronic
911245303 1:95510254-95510276 CTCTGTGAGCAAACCGAGGGGGG - Intergenic
912152708 1:106879828-106879850 CTCCTTAAGCAAAAGGAAGGAGG - Intergenic
914337876 1:146732167-146732189 GTCTGTAAGTAAATGGTGGGAGG + Intergenic
914756293 1:150563245-150563267 CTCTAGATGGACATGGAGGGTGG + Intergenic
916896935 1:169173695-169173717 ATCCATCAGGAAATGGAGGGGGG - Intronic
917308627 1:173654426-173654448 CTCTATAAGCCAGTAGAGAGTGG - Intronic
917972505 1:180217809-180217831 GTCTATCAGGAAATGGAGGGTGG - Intergenic
922322619 1:224501991-224502013 CTTCATGAGCAACTGGAGGGAGG + Intronic
922643002 1:227254914-227254936 CAATATAAGCAAATGAAGAGAGG + Intronic
923821935 1:237454426-237454448 CTCTATAGGCAAATCGACTGTGG - Exonic
924359587 1:243223549-243223571 CACCATAAGCAGTTGGAGGGCGG - Intronic
1063693171 10:8306416-8306438 CACTATAAGCAGCTGGGGGGTGG + Intergenic
1064516683 10:16157045-16157067 TTTTATAAGCAAATGGAAAGAGG - Intergenic
1069094716 10:64244645-64244667 ATCTATAAGAAAATGCAGGCCGG - Intergenic
1069618662 10:69822631-69822653 CTCTATGAACAAATGAATGGTGG - Intronic
1070357073 10:75650702-75650724 CTTTAAAAGGAAAGGGAGGGAGG + Intronic
1071585966 10:86821804-86821826 CTCAAGAAACAAAAGGAGGGAGG - Intronic
1072516985 10:96194395-96194417 TTCTAGAAGAAAATGTAGGGGGG + Intronic
1072754128 10:98006805-98006827 GTCTATAAGGTAATAGAGGGTGG + Intronic
1073492486 10:103862880-103862902 CTCTATAAGCACATAGATGTTGG + Intergenic
1073904491 10:108262115-108262137 GTCTATCAGAAGATGGAGGGTGG - Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078477683 11:11645713-11645735 CTCTTTAAGCAAATGGGGGATGG - Intergenic
1079668649 11:23137929-23137951 CTCTATCAGCGAATGGAGAAGGG + Intergenic
1080252621 11:30251831-30251853 CACTATAAGTAAATAGAGGTTGG - Intergenic
1080896566 11:36453220-36453242 GCCTTTAAGCAAATAGAGGGAGG + Intronic
1081726170 11:45330957-45330979 CTATATGAGCAAATGGGTGGAGG + Intergenic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1086721349 11:90125211-90125233 CTCTATATGCAATAGGAGGCTGG - Intergenic
1087023771 11:93629399-93629421 CTCTATGACCAAATGTATGGGGG - Intergenic
1087239378 11:95757765-95757787 CTATAAAAGCAAATGTATGGGGG - Intergenic
1088437832 11:109834858-109834880 CTCTATAAGCTAAGGGAAGTAGG - Intergenic
1089118538 11:116115110-116115132 CTATATAAGCAATTTGAGTGAGG - Intergenic
1090661649 11:128886514-128886536 CTCTTTGAGCAGGTGGAGGGTGG + Intergenic
1092387450 12:8047103-8047125 CTCTATAAACAAATGTAGCTTGG - Intronic
1094336065 12:29355490-29355512 CTCTATATGGAAAAGAAGGGAGG + Intronic
1097360096 12:58649990-58650012 GTGAATAAGCAAATGGAGTGGGG + Intronic
1101217540 12:102599608-102599630 CTCTATAAGCCAATAGAGTTGGG + Intergenic
1103107024 12:118237408-118237430 CTCTAGAAGTTAATGGAGGGAGG + Intronic
1107675009 13:42786577-42786599 CTGTTTAAGCAAATGAAGAGAGG + Intronic
1108357073 13:49637740-49637762 ATCTCTAAGAAAAGGGAGGGAGG - Intergenic
1110595097 13:77311652-77311674 CTCAATAAGAAAATGGAGATGGG + Intronic
1112501188 13:99944678-99944700 CTCTGTAAGCAGGTGGAGGCAGG - Intergenic
1112629815 13:101148404-101148426 ATCTATAAGGAAAAGGAGAGGGG - Intronic
1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG + Intergenic
1115288682 14:31745966-31745988 TTCTATAAGTAATTGGTGGGCGG + Intronic
1118566093 14:67142673-67142695 ATCTAATAGGAAATGGAGGGGGG - Intronic
1124361128 15:29037311-29037333 GTCCATAAGCCAATGGAGGCAGG - Intronic
1125777023 15:42225287-42225309 GTCTAAATGCAAATGGGGGGGGG + Intronic
1126267826 15:46775043-46775065 TTCTCTAAGCAAAGGGAGGGAGG + Intergenic
1128256187 15:66198778-66198800 CTCTAGAAACAAAAGGAGGCTGG - Intronic
1128350836 15:66887298-66887320 GCCTATAAGCAAATGGGGTGGGG - Intergenic
1128933105 15:71723412-71723434 CTCCATAAGCAAATGAAAAGAGG - Intronic
1138080176 16:54083274-54083296 CACTATAATAAAATGGGGGGAGG - Intronic
1138239817 16:55418410-55418432 CTCTAAAAGGGAATGGAGGGAGG + Intronic
1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG + Intronic
1139471249 16:67179261-67179283 CTCTGTAAGCAGAGGGCGGGAGG + Intronic
1139996404 16:70985166-70985188 GTCTGTAAGTAAATGGTGGGAGG - Exonic
1142907361 17:3053133-3053155 CTCTCTAAGCAAAGGGAGGAGGG - Intergenic
1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG + Intergenic
1146012481 17:29206993-29207015 TTATATAACCAAATGGTGGGGGG + Intergenic
1146500800 17:33362827-33362849 CTGAATAAGCAAATGAATGGAGG + Intronic
1152260452 17:79263930-79263952 CTTTATAAGAGAAAGGAGGGAGG + Intronic
1152826530 17:82469473-82469495 CTCTATAAGCAAATGGAGGGAGG - Intronic
1152894311 17:82901774-82901796 CTCTGTAAGCGAATGAAGGGAGG - Intronic
1153261121 18:3225484-3225506 CCCTATAAGCCAAAGGAGGGGGG + Intergenic
1154990627 18:21595207-21595229 CTCCATAAGCTATTTGAGGGTGG - Intronic
1157722510 18:49936320-49936342 CTCCATGAGCAGATGCAGGGAGG + Exonic
1158130259 18:54145203-54145225 CTCCAGAAGTGAATGGAGGGTGG - Intergenic
1159723258 18:71919816-71919838 CTCTATAGTCATATGGAGGGGGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1159811039 18:73018201-73018223 CTCTATAAGCCAAAAGAGAGTGG + Intergenic
1160917129 19:1502375-1502397 GTCTTTAAACAAATGGAGGCCGG + Intergenic
1164716708 19:30396561-30396583 CTCTCATAGCAAATGGAGGCAGG - Intronic
1165416718 19:35698776-35698798 CTCAATAAGCAACTGAAGGCAGG + Intergenic
925434713 2:3826968-3826990 CTTAATAAACAATTGGAGGGAGG - Intronic
925959396 2:9001978-9002000 GTATATCAGCAAATGCAGGGTGG - Intronic
926571919 2:14538308-14538330 TTAAATAAGCAAATAGAGGGAGG - Intergenic
926663982 2:15499604-15499626 GTCTATGAGCAGGTGGAGGGTGG + Intronic
927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG + Intergenic
929131245 2:38574962-38574984 CTGTACAAGCAAATGGTAGGTGG - Intronic
930243450 2:48959426-48959448 CTGCAAGAGCAAATGGAGGGAGG - Intergenic
930269913 2:49243974-49243996 CTCTAGAAGCAAGTAGAGAGTGG + Intergenic
931835389 2:66093674-66093696 CCCTATTAGCAAATGCAGGGAGG + Intergenic
937080661 2:119137424-119137446 ATCTATAAGCAAATGGGGGGAGG - Intergenic
939927899 2:148196813-148196835 TTTTATAAGCAAAGGGAGTGGGG + Intronic
940012989 2:149073973-149073995 CTCCATAAGCCAATGGAGCACGG - Intronic
940947676 2:159636782-159636804 CTCCTTAAGCAAAAGGAGGGAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
944227759 2:197365229-197365251 CTCTACAACCAAAGGGTGGGGGG - Intergenic
947189182 2:227484061-227484083 CCATAAAAGAAAATGGAGGGTGG - Intronic
948169256 2:235888070-235888092 CATGATAAGCAAATGGAAGGAGG - Intronic
948170539 2:235898259-235898281 CTCAATAAGCAAAGGGAACGGGG + Intronic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1171517916 20:25752116-25752138 CTCTGAAAGGGAATGGAGGGTGG + Intergenic
1177300326 21:19236048-19236070 TTCTGTAAGAAAATGGATGGAGG - Intergenic
1177877827 21:26656093-26656115 ATCTTAAAGCAAATGGAAGGTGG + Intergenic
1179450378 21:41464492-41464514 CCTTATAAGGAAATGGAGGCTGG + Intergenic
954792519 3:53143786-53143808 CTGTAGAGGAAAATGGAGGGAGG - Intergenic
959722888 3:109512553-109512575 CTCTACAAGCCAATAGAGAGTGG - Intergenic
963545991 3:146658891-146658913 CTCCATGATCAAATGGAGGTGGG - Intergenic
963985330 3:151586849-151586871 CATTATAAGAAAATGGAGAGGGG + Intergenic
964033418 3:152166626-152166648 CTCTATAAGCCAAAAGAGAGTGG - Intergenic
964626418 3:158764263-158764285 CTCTGTAACCAAGTGGAGAGAGG + Intronic
967084280 3:186079918-186079940 CTCTGGAAGCGAATGGGGGGCGG + Exonic
967598173 3:191352332-191352354 TTCTTTAAGGAAATGGATGGGGG + Intronic
970540864 4:17077458-17077480 CTCTAGAAGCAGATGCTGGGAGG - Intergenic
972132371 4:35854353-35854375 CACTATGATCAAATGGTGGGTGG + Intergenic
972187380 4:36547050-36547072 CTCAGTAAGTAAATGGTGGGTGG + Intergenic
972187530 4:36549399-36549421 CTCTATCAGCAAATGCAGCTTGG + Intergenic
972458240 4:39275037-39275059 CTCAATAAGAAAACGGTGGGGGG + Intronic
972958629 4:44423618-44423640 TTCTAAAGACAAATGGAGGGTGG + Intronic
974172822 4:58290008-58290030 CTATATAAACAAATGATGGGAGG - Intergenic
979906733 4:126302683-126302705 CTCTACAAGAAAATGGAGTTTGG - Intergenic
980495650 4:133585654-133585676 CTCTATGGGCACATGGTGGGAGG - Intergenic
981846715 4:149177657-149177679 CTCTATAAGCCAGAGGAGAGTGG + Intergenic
982418786 4:155168956-155168978 CTATATAAGAAAATGTAGGTAGG - Intergenic
983178069 4:164615036-164615058 CACTGTAAGCAACTGGAGGATGG - Intergenic
984031859 4:174613740-174613762 ATTTATAAACCAATGGAGGGTGG - Intergenic
985101672 4:186464226-186464248 GTCTTTAAGAAAAAGGAGGGGGG + Intronic
987311091 5:16681808-16681830 GTCTATATGCAAATGGAAAGGGG + Intronic
992473308 5:77077977-77077999 ATCGGTAAGAAAATGGAGGGCGG - Intronic
993874769 5:93293407-93293429 TTTTATAAGCAAATAGAGGCTGG - Intergenic
994673043 5:102785252-102785274 CTTAATAAGAAAAGGGAGGGGGG + Intronic
994729739 5:103477498-103477520 CTCTAAAAGTAAATGGAGATAGG - Intergenic
995345917 5:111117331-111117353 CTCTTTTAGCAAATTGAGAGAGG + Intronic
996520961 5:124424947-124424969 CTCTATAAGCCAAAAGAGAGTGG + Intergenic
999376841 5:151092617-151092639 TTCTATAAGCAATGGGGGGGGGG + Intronic
1000009958 5:157221753-157221775 CTCTAAGAGCTTATGGAGGGAGG - Intronic
1000976798 5:167774131-167774153 CTCAATAATAAAAGGGAGGGAGG + Intronic
1001435145 5:171694170-171694192 CTGTATAAGCCAAGGCAGGGAGG + Intergenic
1003963094 6:11227647-11227669 CTCTACATACAAATAGAGGGTGG + Intronic
1008140845 6:47830400-47830422 CTCTATAAGCAAAATGAAAGAGG - Intronic
1008468059 6:51853236-51853258 CTCTATAAGCCAGTGGAGATTGG - Intronic
1010819222 6:80394021-80394043 TTCTATAAGTAAATGGAGTAAGG - Intergenic
1011245619 6:85318306-85318328 CTCTATATGGAAGTGCAGGGGGG + Intergenic
1016102717 6:140122442-140122464 CTCCATAAAGAAATGGAGGCTGG - Intergenic
1021839187 7:24708432-24708454 TTCAATAACCAAAGGGAGGGAGG + Intronic
1027418775 7:77999767-77999789 CTCTATAAGAAACTGCAGGCTGG + Intergenic
1031020488 7:116622234-116622256 CTGTATAAGGGAATGGAGTGAGG + Intergenic
1034422750 7:150997951-150997973 CTCTTTGAGCACATGGATGGTGG - Intronic
1035630071 8:1100600-1100622 CTCTATAAGAAAATGAAGGTAGG + Intergenic
1040815333 8:51502244-51502266 CTCTAGCAGCAAGTGGGGGGCGG + Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1042682105 8:71397618-71397640 CTCTATAAGCCAAAAGAGAGTGG - Intergenic
1043963952 8:86450789-86450811 ATCTATAAGTAAATGAATGGTGG + Intronic
1045319108 8:101068228-101068250 CTCCACAAGCAAATGGAAGGTGG + Intergenic
1048912724 8:139151499-139151521 CTCTATAAACAAATGGCTGTAGG + Intergenic
1049058860 8:140260204-140260226 CTCTATACTAAATTGGAGGGTGG - Intronic
1052577431 9:30307620-30307642 TTCTATAAGCTCATGGATGGTGG - Intergenic
1055571966 9:77625547-77625569 CTCTATAAGCCAAAAGAGAGTGG + Intronic
1056724744 9:89104790-89104812 CTCAAATAGCAAATGAAGGGTGG - Intronic
1058823568 9:108754851-108754873 TTCTTTAAGCATATGCAGGGAGG - Intergenic
1060010335 9:120038186-120038208 CTATATAAACAAATGGATGGTGG - Intergenic
1060928269 9:127471040-127471062 CTTTAAAAGAAAGTGGAGGGGGG + Intronic
1061252940 9:129437257-129437279 CTCTATCAGCCCACGGAGGGAGG + Intergenic
1185667875 X:1781842-1781864 ATCTATCAGGAAACGGAGGGAGG + Intergenic
1186192198 X:7076792-7076814 CTCTATAAGCAGTTGGGGAGGGG + Intronic
1188315181 X:28664975-28664997 CTCTAAAAGCAAATGGAAACAGG - Intronic
1188636269 X:32435842-32435864 CCCAATAAGCAAATTGAGGATGG + Intronic
1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG + Intergenic
1192825460 X:74691666-74691688 CTCTATAAGCCAAAAGAGCGTGG - Intergenic
1196267485 X:113667429-113667451 CATTATTAGCAAAAGGAGGGTGG + Intergenic
1196621686 X:117831768-117831790 CTCTACAAGCCAAAGGAGAGTGG - Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1199508106 X:148589098-148589120 CTCTTTCAGCATAAGGAGGGAGG + Intronic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1201564153 Y:15348241-15348263 CTCTATAAGCAGTTGGGGAGGGG + Intergenic