ID: 1152828315

View in Genome Browser
Species Human (GRCh38)
Location 17:82481272-82481294
Sequence GACACAGATCTGCCTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 397}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152828315_1152828320 7 Left 1152828315 17:82481272-82481294 CCAGAGCCAGGCAGATCTGTGTC 0: 1
1: 0
2: 1
3: 23
4: 397
Right 1152828320 17:82481302-82481324 CATCTCAGTGCCTGCCAATGTGG 0: 1
1: 0
2: 3
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152828315 Original CRISPR GACACAGATCTGCCTGGCTC TGG (reversed) Intronic
901238281 1:7679106-7679128 ATCACAGCTCTGCCTGGCTCCGG - Intronic
901461696 1:9395781-9395803 GACACAGTTCCCCCTGGGTCTGG - Intergenic
902096270 1:13948472-13948494 GACACAGTTCTTCATGGCTGGGG - Intergenic
904131403 1:28278250-28278272 AACCCAGCTCTGCCTAGCTCAGG - Intronic
904390701 1:30184026-30184048 GAAACAGCTCCGCCTGACTCAGG - Intergenic
904425161 1:30418132-30418154 AACCCAGCTCTGCCTGGCTGGGG - Intergenic
904802614 1:33105459-33105481 GACACAGTTCTGCATGGATAGGG + Intronic
905465772 1:38152063-38152085 GATGCAGAGCTGCCTGGCTGAGG - Intergenic
905867906 1:41386252-41386274 GACCGAGCTCTGCCTGGCTCAGG + Intergenic
905955214 1:41987782-41987804 GACTCAGTTCTGCATGGCTGGGG + Intronic
906294855 1:44643433-44643455 GACCCAGATCTTCATGGATCTGG + Intronic
906894828 1:49759138-49759160 CTCACAGATCTGCCTGGCTTGGG - Intronic
908150685 1:61298312-61298334 GTCACAGTTCTGCATGGCTGGGG - Intronic
908392830 1:63698975-63698997 GACACAGTCCTGCCTGGAGCTGG - Intergenic
908863675 1:68520898-68520920 CTCACAGATCTGCATGGCTGGGG + Intergenic
909900140 1:81123927-81123949 GACTCAGTTCTGCTTGGCTGGGG - Intergenic
910699001 1:90051891-90051913 GACTCAGTTCTGCATGGCTGGGG - Intergenic
911554942 1:99332059-99332081 CTCACAGTTCTGCATGGCTCAGG - Intergenic
911944137 1:104084471-104084493 GAAAGAGAGCTGCCTTGCTCAGG + Intergenic
911972044 1:104451489-104451511 GACACAGTTGTGCATGGCTGGGG - Intergenic
912507667 1:110167220-110167242 GAGACAGCTCTGCCTGCATCAGG + Intronic
914962791 1:152220952-152220974 GACACACATGGGTCTGGCTCAGG - Exonic
915069467 1:153254226-153254248 GACACAAACCAGCCTGGCTGGGG + Intergenic
915108885 1:153550430-153550452 GACACACTTCTGCCTCGCTCAGG + Intergenic
915885554 1:159717408-159717430 CTCACAGTTCTGCATGGCTCGGG - Intergenic
915923908 1:160001737-160001759 GACATAGATTTTCCTGGCTCTGG + Intergenic
917426532 1:174920238-174920260 GTCACAGTTCTACCTGGCTGGGG + Intronic
919277348 1:195438720-195438742 GACTCAGTTCTGCATGGCTGGGG + Intergenic
919551348 1:198992396-198992418 AAGGAAGATCTGCCTGGCTCAGG + Intergenic
920311820 1:205053029-205053051 GACCCAGATGTGCCTGGAGCTGG + Intronic
922051913 1:221998861-221998883 CTCACAGTTCTGCCTGGCTGGGG - Intergenic
923107284 1:230864550-230864572 GGGACAGAGCTGTCTGGCTCCGG + Intronic
1062770294 10:94699-94721 GTCACAGCTCTGCATGGCTAGGG + Intergenic
1062860119 10:804403-804425 GACACAGATGAGCCCGGCCCTGG + Intergenic
1062862631 10:822444-822466 GACACAGACCTGCCTGCCATGGG + Intronic
1063048257 10:2416270-2416292 GACTCAAATCTGGCTGGCTGGGG + Intergenic
1063353756 10:5379339-5379361 GACACAGTTCCGCATGGCTGAGG + Intergenic
1063375320 10:5551150-5551172 GACACCCATCAGACTGGCTCAGG + Intergenic
1063639872 10:7818751-7818773 GGCGCAGATCTGCCAGGCGCTGG + Exonic
1064639701 10:17403135-17403157 GAAACAGATGGACCTGGCTCAGG + Intronic
1064903563 10:20319234-20319256 GACTCTGATCTTCCTGACTCTGG + Intergenic
1065272226 10:24046466-24046488 GACTCAGTTCTGCATGGCTGAGG + Intronic
1065833203 10:29633287-29633309 AGCACACATCTGCCTGGCACTGG + Intronic
1066634697 10:37489176-37489198 GTCACAGATCTCCCTGGTGCAGG + Intergenic
1067249866 10:44577048-44577070 GCCACAGAGCTGCCTGTCCCTGG - Intergenic
1069580111 10:69560016-69560038 GGCCCAGGTGTGCCTGGCTCTGG - Intergenic
1070445009 10:76489932-76489954 CTCACAGATCTGCATGGCTGAGG - Intronic
1070993052 10:80749968-80749990 GACTCAGTTCTGCATGGCTTGGG + Intergenic
1071042726 10:81334120-81334142 GACTCAGAACTGCCAGGCTTGGG + Intergenic
1072160107 10:92758140-92758162 GAAACAGATCTGAGTGGCTGTGG - Intergenic
1073929141 10:108554568-108554590 AACACAGTTCTGCATGGCTGGGG - Intergenic
1074211587 10:111340284-111340306 GTCACAGTTCTGCATGGCTGGGG + Intergenic
1074419034 10:113293103-113293125 CAAAGAGAGCTGCCTGGCTCAGG + Intergenic
1074781093 10:116802882-116802904 GACACAGATCTGGCTGACCCAGG - Intergenic
1075423983 10:122327552-122327574 GACCCTGGTCTGCCTGCCTCGGG + Intronic
1076248012 10:128962416-128962438 GACCCAGATGGGCCTGGCTGTGG - Intergenic
1076300408 10:129421463-129421485 GACACAGAGGGGCCTGGTTCAGG - Intergenic
1076814016 10:132905779-132905801 AAAATACATCTGCCTGGCTCTGG - Intronic
1077193186 11:1264479-1264501 CTCACAGTTCTGCCTGGCTGAGG + Intergenic
1079625465 11:22611840-22611862 GACTCAGATCCGCATGGCTGGGG + Intergenic
1079765049 11:24381646-24381668 GTCACAGTTCTGCATGGCTGGGG - Intergenic
1081059697 11:38458818-38458840 GACTCAGTTCAGCATGGCTCAGG + Intergenic
1081271591 11:41090882-41090904 CTCACAGTTCTGCCTGGCTGAGG - Intronic
1081858614 11:46319311-46319333 AACCCAGGTCTGCCTGGCCCTGG - Intronic
1083631367 11:64097176-64097198 GGCCCAGTTCTGCCAGGCTCAGG - Intronic
1086436961 11:86791174-86791196 GACACAGATTTGCCTTCATCTGG + Intronic
1087694248 11:101357656-101357678 GTCACAGTTCTGCATGGCTGGGG + Intergenic
1088599647 11:111463089-111463111 GAGACAGAACTTCCTGGCTAAGG + Intergenic
1091832458 12:3559707-3559729 GACAGACATCTGCCTGGGGCAGG - Intronic
1092052530 12:5482342-5482364 CACACAGCGCTTCCTGGCTCAGG - Intronic
1092139514 12:6173182-6173204 GTCACAGCTCTGCCTGGTTGGGG - Intergenic
1092250734 12:6894583-6894605 GTCACAGTTCTGCATGGCTGGGG - Intronic
1094504559 12:31050704-31050726 GAAACTGATCTGGCTGGTTCTGG - Intergenic
1095750972 12:45710990-45711012 TACACAAATGTGCCTGGCACAGG + Intergenic
1095876726 12:47087389-47087411 CACAGAAATCTGCCTTGCTCTGG + Intronic
1098010714 12:66048203-66048225 TACACATATCTACCAGGCTCTGG + Intergenic
1100617457 12:96242058-96242080 GACACAGACCAGCATCGCTCAGG + Intronic
1102134028 12:110557786-110557808 GTCACAGTTCTGCATGGCTGGGG + Intronic
1102767950 12:115449899-115449921 GTCTCTGACCTGCCTGGCTCTGG + Intergenic
1103830578 12:123775882-123775904 GTCACAGTTCTGCATGGCTGTGG + Intronic
1104025605 12:125024115-125024137 CTCACAGTTCTGCGTGGCTCAGG + Intronic
1104742134 12:131185363-131185385 CTCACAGTTCTGCCTGGCTGGGG + Intergenic
1107077387 13:36337609-36337631 GACTCAGTTCTGCGTGGCTGGGG - Intronic
1107200878 13:37715420-37715442 AAGACAGATCTTTCTGGCTCTGG - Intronic
1107983177 13:45752813-45752835 GACACAGTTCTGCATGGCTGGGG + Intergenic
1109134382 13:58627843-58627865 CTCACAGTTCTGCATGGCTCGGG - Intergenic
1109924317 13:69114539-69114561 GACACAGTTCTGCATGGCTGGGG - Intergenic
1111655755 13:91150148-91150170 GACTCAGTTCTGCATGGCTGGGG - Intergenic
1112434865 13:99384651-99384673 GCCACAGAACTGCCTGCCTTTGG - Intronic
1112658176 13:101474701-101474723 CACACTGATCTGCCTGGAACTGG - Intronic
1113035002 13:106038664-106038686 ATCACAGTTCTGCATGGCTCTGG - Intergenic
1113416385 13:110131646-110131668 GACACCGTTGTGCCTGGGTCCGG - Intergenic
1113588950 13:111484696-111484718 GAAACTGCTCTGCCTGGCCCTGG + Intergenic
1113632321 13:111896763-111896785 GACACAGTTCCGCATGGCTGGGG + Intergenic
1114789531 14:25641105-25641127 GACACGGTTCTCACTGGCTCAGG + Intergenic
1114930721 14:27464745-27464767 GTCACAGATCAGCATGGCTGGGG - Intergenic
1115859839 14:37671966-37671988 GACACAGTTCTGCATGGCTGGGG - Intronic
1117952843 14:61100027-61100049 GACACAATTCTGCATGGCTTTGG - Intergenic
1118900637 14:69982606-69982628 AACACGGCTCTGCCAGGCTCAGG - Intronic
1119947803 14:78713318-78713340 GCCACACATCTGCCTACCTCAGG + Intronic
1120575823 14:86179975-86179997 GACAAAGATTTACCTAGCTCTGG - Intergenic
1120636567 14:86959617-86959639 GACTCAGTTCTGCATGGCTGGGG + Intergenic
1120948359 14:90019280-90019302 GACACAGATAGGGCTGACTCAGG - Intronic
1121509119 14:94499288-94499310 CAGCCAGGTCTGCCTGGCTCTGG + Intronic
1121697124 14:95922707-95922729 ACTACAGATCTGCCTGGCTATGG + Intergenic
1121865786 14:97361356-97361378 CACACACATATGCCTGCCTCCGG + Intergenic
1121884666 14:97532508-97532530 GAAACAGACCTGCCTTGCTTTGG - Intergenic
1124639466 15:31387861-31387883 GACAAAGCTCTGCCTGGTCCAGG - Intronic
1125364406 15:38898670-38898692 GACTCAGTTCTGCATGGCTGGGG + Intergenic
1125759951 15:42089476-42089498 GAAACAAATCTACCTTGCTCGGG - Intronic
1127829321 15:62736693-62736715 GAAACATATCCCCCTGGCTCTGG - Intronic
1128429017 15:67573291-67573313 GACACAGTTCTGCATGGCTGGGG + Intronic
1128466509 15:67917194-67917216 GACTCAGAGCTGCCTGGCCAGGG - Intergenic
1128880271 15:71236201-71236223 AACACAAAACAGCCTGGCTCCGG + Intronic
1130521325 15:84663120-84663142 GACACAACAGTGCCTGGCTCTGG + Intergenic
1132233907 15:100205108-100205130 GACACAGATGTCCTTGGCTTCGG + Intronic
1132282377 15:100631371-100631393 CACACAGATCTGCCTGCCTTGGG + Intronic
1132987114 16:2773160-2773182 GACCCATCTCTGCTTGGCTCAGG + Intronic
1133186168 16:4100259-4100281 GGCACAGTTCTGCATGGCTGGGG - Intronic
1133234028 16:4379384-4379406 GCCACAGACCTGCCTGACTTGGG + Intronic
1133272189 16:4615656-4615678 GACATGGACGTGCCTGGCTCTGG - Intergenic
1135648960 16:24188738-24188760 TGAACAGCTCTGCCTGGCTCAGG - Intronic
1136032775 16:27515633-27515655 AACACTTCTCTGCCTGGCTCTGG - Intronic
1136087962 16:27899057-27899079 GACACAGATGGGCAAGGCTCGGG + Intronic
1138344577 16:56312053-56312075 GAGACAGGGCTGCCGGGCTCTGG + Intronic
1138850429 16:60622475-60622497 TAGACAGGTCTGCCAGGCTCAGG + Intergenic
1139126916 16:64089269-64089291 CTCACAGTTCTGCATGGCTCGGG + Intergenic
1140453018 16:75086893-75086915 GCCCCAGTTCTGCCTGTCTCTGG - Intronic
1142011931 16:87719868-87719890 GGCACAGCTCTGCTGGGCTCTGG - Intronic
1142382820 16:89743312-89743334 AACAAAGGACTGCCTGGCTCTGG + Intronic
1142483523 17:232710-232732 GACTCAGATCTCCCTGGTGCAGG - Intronic
1143599975 17:7938708-7938730 AACCCAGGTCTACCTGGCTCTGG + Intronic
1143903628 17:10193183-10193205 AAATCAGATTTGCCTGGCTCTGG - Intronic
1146840883 17:36153384-36153406 GCCACCCATCTCCCTGGCTCTGG + Intergenic
1148156476 17:45427743-45427765 GCCAGAGAGCTGCCTGTCTCTGG + Intronic
1150012318 17:61516100-61516122 GACTGAGCTCTGACTGGCTCAGG - Intergenic
1150933426 17:69610168-69610190 GACTCAGTTCTGCATGGCTGCGG + Intergenic
1151474242 17:74336635-74336657 GACAAACAGCTGCCTGGCTGGGG - Intronic
1151485921 17:74399829-74399851 CTCACAGTTCTGCATGGCTCGGG - Intergenic
1151725606 17:75882043-75882065 GCCACAAACCTGCCTGGTTCTGG + Intronic
1151957661 17:77388467-77388489 TACACGGATCTGCCTGGTTTAGG - Intronic
1152512000 17:80796381-80796403 GTCACAGTTCTGCATGGCTAGGG + Intronic
1152828315 17:82481272-82481294 GACACAGATCTGCCTGGCTCTGG - Intronic
1153022914 18:647455-647477 GACCCGTTTCTGCCTGGCTCTGG - Intronic
1155045888 18:22102713-22102735 CACTCAGATCTGCCTGTCACTGG - Intergenic
1155251556 18:23958025-23958047 GGCTCAGATCAGCCTGGATCAGG - Intergenic
1155671998 18:28382778-28382800 GACTCAGTTCTGCATGGCTGGGG - Intergenic
1156073617 18:33244616-33244638 GACTCAGTTCTGCATGGCTGGGG - Intronic
1156446161 18:37238448-37238470 GGCACATCACTGCCTGGCTCTGG + Intergenic
1157917888 18:51686806-51686828 GCCACAAATCTTCCTTGCTCTGG + Intergenic
1158037875 18:53056138-53056160 GACTCAGTTCTGCATGGCTGGGG + Intronic
1159522138 18:69539911-69539933 GACACAATTCTGCATGGCTGGGG + Intronic
1159930622 18:74309737-74309759 GACTCAGTTCTGCATGGCTGGGG + Intergenic
1163681554 19:18685067-18685089 GCCACTGATGTGACTGGCTCAGG + Intronic
1164540313 19:29117084-29117106 CTCACAGTTCTGCATGGCTCGGG - Intergenic
1165416828 19:35699600-35699622 GACCCAGATCTGCCTGACCCAGG - Intergenic
1166037941 19:40182809-40182831 CTCACAGAGCTGCTTGGCTCTGG - Intergenic
1166699607 19:44874589-44874611 GATGCAGACCTGCCTGGCTGAGG + Intronic
1167152814 19:47719512-47719534 GACACAGATCTGTGGGGCTGGGG - Intronic
1167408896 19:49333527-49333549 GATACAGAACTGTGTGGCTCAGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
1168666785 19:58210362-58210384 GATACAGATGTGCCTGCCTGTGG - Intronic
925274429 2:2638654-2638676 GACCCAGCTCTGTGTGGCTCTGG + Intergenic
925469356 2:4142528-4142550 GACCCAGTTCGCCCTGGCTCAGG - Intergenic
925532481 2:4880092-4880114 GACACAGCTCTGCCTCTCTCAGG + Intergenic
925735630 2:6960778-6960800 GCCACAGACCTGCCTGTCTGCGG - Intronic
927150029 2:20190185-20190207 GACACGGAGCTGCCTGGGGCTGG + Intergenic
927350084 2:22100773-22100795 CTCACAGTTCTGCATGGCTCAGG - Intergenic
927991092 2:27447645-27447667 GAGACAGCACAGCCTGGCTCAGG + Intronic
932268589 2:70389296-70389318 GTCACAGTTCTGACTGACTCAGG - Intergenic
932269695 2:70398675-70398697 GACATGGATCTGACTGGATCTGG - Intergenic
932648360 2:73529774-73529796 GACTCAGTTCTGCATGGCTGGGG + Intronic
933470036 2:82710484-82710506 GAAACAGATTTGCCTTTCTCTGG - Intergenic
933910592 2:86937611-86937633 GACACTGATCTCCCTGGATGGGG - Intronic
933933714 2:87181954-87181976 CTCACAGTTCTGCCTGGCTGGGG + Intergenic
934022136 2:87965791-87965813 GACACTGATCTCCCTGGATGGGG + Intergenic
935149715 2:100422812-100422834 AACACAGAGATGCCTGGCTGCGG - Intergenic
935978044 2:108598625-108598647 GGCACACATCTGCCTGGCCAGGG - Intronic
936135662 2:109891219-109891241 GGCACACATCTGCCTGGCCAGGG - Intergenic
936209035 2:110480266-110480288 GGCACACATCTGCCTGGCCAGGG + Intergenic
936359396 2:111783490-111783512 CTCACAGTTCTGCCTGGCTGGGG - Intronic
936405232 2:112196835-112196857 CTCACAGTTCTGCCTGGCTGGGG + Intergenic
936414548 2:112292838-112292860 GACACTGATCTCCCTGGATGGGG - Intronic
937857299 2:126681950-126681972 GTCACCCATCTGCCAGGCTCAGG - Intronic
938072621 2:128316606-128316628 GTCACAGAGCTGCCTGTCTAGGG - Intronic
938241561 2:129746151-129746173 GACTCAGTTCTGCATGACTCGGG - Intergenic
938480569 2:131658560-131658582 GACCCCGATCTGCCGGGCACTGG - Intergenic
939557558 2:143694539-143694561 TAAACACCTCTGCCTGGCTCTGG - Intronic
939669377 2:144991374-144991396 CTCACAGATCTGCATGGCTGAGG + Intergenic
939895976 2:147791729-147791751 CTCACAGTTCTGCCTGGCTGGGG - Intergenic
940273785 2:151918394-151918416 GAGACAAATCTGGGTGGCTCCGG + Intronic
940403174 2:153269731-153269753 GACACACTTCTTCATGGCTCAGG + Intergenic
941264786 2:163348159-163348181 GGCCCAGGTCTGGCTGGCTCAGG + Intergenic
942035171 2:172003647-172003669 CTCACAGTTCTGCATGGCTCGGG - Intronic
942796903 2:179831806-179831828 GAGACAGATGTGCTTGGCACAGG - Intronic
942885473 2:180918686-180918708 CACACAGTTCAGCATGGCTCGGG + Intergenic
943134885 2:183897694-183897716 GAGACAGCCCTGACTGGCTCTGG + Intergenic
943566641 2:189524313-189524335 CTCACAGATCTGCATGGCTGGGG + Intergenic
945957542 2:216100137-216100159 GACGCTGATCTGCCTGCCTGTGG + Exonic
946072021 2:217042141-217042163 GACACTGTTCTGCATGGCTGGGG - Intergenic
946510553 2:220350897-220350919 CTCACAGTTCTGCCTGGCTTGGG - Intergenic
946755112 2:222936743-222936765 CTCACAGTTCTGCATGGCTCGGG + Intronic
947464504 2:230329709-230329731 CACACAGTTCTGCATGGCTGGGG - Intronic
947518934 2:230829146-230829168 GACTCAGCTCTTCCTGGCTTGGG + Intergenic
948923944 2:241082045-241082067 GACACCGCTCTGGCTGGGTCAGG - Intronic
949052960 2:241907283-241907305 CACACAGGTCCACCTGGCTCTGG - Intergenic
1169116505 20:3069651-3069673 TGCAGAGAGCTGCCTGGCTCAGG - Intergenic
1172001032 20:31777015-31777037 GTCACAGTTCTGCTTTGCTCGGG + Intronic
1172388043 20:34547724-34547746 GGCACAGTTCTGCATGGCTGGGG - Intronic
1173056872 20:39623060-39623082 GTCACAGTTCTGCATGGCTGGGG - Intergenic
1174701777 20:52616692-52616714 GGCTCAGATCTCCCTGGCTGGGG + Intergenic
1175550998 20:59817613-59817635 GCCACAGCCCTGCCTGGCCCAGG - Intronic
1175730512 20:61350622-61350644 GGCAGGGATCTGCCTGACTCTGG - Intronic
1177522232 21:22240173-22240195 CTCACAGTTCTGCCTGGCTTGGG - Intergenic
1177531821 21:22370728-22370750 GACTCAGTTCTGCATGGCTGAGG + Intergenic
1177594215 21:23214195-23214217 CTCACAGTTCTGCATGGCTCAGG + Intergenic
1177883812 21:26724512-26724534 CTCACAGATCTGCATGGCTGGGG - Intergenic
1178729059 21:35082505-35082527 GACTCAGTTCTGCATGGCTGGGG + Intronic
1178935035 21:36854358-36854380 GCCCCAGATGTGCCTGTCTCTGG - Intronic
1180056680 21:45362504-45362526 GACACAGCCCTGCCTGTCCCAGG + Intergenic
1183277971 22:36913338-36913360 AACACAGATCTGTCTGGCTCTGG + Intergenic
1183666503 22:39249217-39249239 GAAGCAGAGCTGCCTGGCCCAGG - Intergenic
1183999848 22:41665253-41665275 TTCACATACCTGCCTGGCTCTGG - Intergenic
1184021804 22:41826224-41826246 GTCACAGAGCTGCCTGGCACAGG + Exonic
1184028721 22:41878093-41878115 GATCCAGATCTGCCTGTTTCCGG - Exonic
1184466375 22:44670740-44670762 AACACAGAACTGCCTGGCAGAGG + Intronic
950549557 3:13657967-13657989 GCCCCAGAGCTGCGTGGCTCCGG + Intergenic
952775508 3:37042139-37042161 GAAATAGTTCTGCCTGGCTGTGG - Intronic
953155571 3:40369321-40369343 GACTCAGTTCTGCATGGCTAGGG + Intergenic
954896395 3:53978794-53978816 GACTCAGTTCTGCATGGCTGAGG - Intergenic
956884040 3:73540707-73540729 GACTCAGTTCTGCATGGCTGGGG - Intronic
957017891 3:75091281-75091303 GACTCAGTTCTGCATGGCTTGGG + Intergenic
957184032 3:76918384-76918406 GACTCAGTTCTGCATGGCTAGGG - Intronic
957657472 3:83099272-83099294 GTCACAGTTCTGCCTGTCTGGGG - Intergenic
958083938 3:88781515-88781537 GACACAGTTCTGCTTGGCTGGGG + Intergenic
959277430 3:104294288-104294310 GACACAGTTCTACATGGCTGGGG - Intergenic
959338655 3:105099178-105099200 GACACTAATCTTCCTGGATCAGG - Intergenic
960135824 3:114103838-114103860 GCCACAGATCTCCTGGGCTCTGG + Intergenic
961029868 3:123592250-123592272 GACACAGTTCTGCATGGCTGGGG - Intergenic
961176058 3:124835842-124835864 GACAAAGTTGTGCCTGACTCTGG + Intronic
961378435 3:126482139-126482161 GACAGAGAGCTGCATGTCTCTGG + Exonic
963064972 3:141256366-141256388 AACACAGATCTGCCTATCTTTGG + Intronic
963878438 3:150502137-150502159 CTCACAGATCTGCATGGCTGTGG + Intergenic
964141061 3:153400169-153400191 GAGAAAGATCTTCCTGGCTCTGG + Intergenic
964571811 3:158115314-158115336 GACACAGATCTATCTGTCTTGGG - Intronic
965691972 3:171366986-171367008 CTCACAGTTCTGCCTGGCTGAGG - Intronic
966016894 3:175151160-175151182 GACACAGATCTCACAGTCTCTGG - Intronic
966876357 3:184324106-184324128 GCCAGAGATCTTCCTGGGTCAGG + Intronic
967927484 3:194662786-194662808 CACACAAAACTGACTGGCTCTGG + Intronic
967963855 3:194945415-194945437 GAAACAGATCTTCCAGGCCCTGG - Intergenic
968006681 3:195247767-195247789 CTCACAGTTCTGCCTGGCTGGGG + Intronic
968889772 4:3362230-3362252 GACCCAGTCCTGCCTGGCTTGGG - Intronic
969677143 4:8620388-8620410 GACACAGCCCTGGCCGGCTCAGG - Intergenic
969678096 4:8626027-8626049 GACACAGCCCTGGCCGGCTCAGG - Intergenic
969679051 4:8631664-8631686 GACACAGCCCTGGCCGGCTCAGG - Intergenic
970008770 4:11435850-11435872 GAGAGAGATCTACCTGGGTCTGG + Intergenic
970030905 4:11673586-11673608 GACACAGTTCTGCATGTCTGGGG + Intergenic
970576968 4:17437244-17437266 GCCACTGAGCTGCCTGACTCCGG - Intergenic
970785003 4:19784768-19784790 CTCACAGTTCTGCCTGGCTGAGG + Intergenic
971330453 4:25677231-25677253 GCCCCAGATCAGCCTGGGTCAGG + Exonic
971683421 4:29732097-29732119 GGCATAGATTTGCCTGTCTCTGG - Intergenic
972896048 4:43621196-43621218 GTCACAGTTCTGCATGGCTGGGG + Intergenic
973933296 4:55815694-55815716 GACTCAGTTCTGCGTGGCTGGGG - Intergenic
974177547 4:58344073-58344095 CACACAGTTCTGCATGGCTGGGG - Intergenic
975952165 4:79787422-79787444 GACACAAATCTCTCTGGGTCTGG + Intergenic
976205498 4:82619712-82619734 GAAACATCTCTGCCTGTCTCAGG - Intergenic
976853572 4:89576821-89576843 GACTCAGTTCTGCATGGCTGGGG - Intergenic
977264127 4:94834169-94834191 GGCACAGTTCTGCCTGTCTGCGG + Intronic
977477867 4:97536504-97536526 GACTCAGTTCTGCATGGCTGGGG - Intronic
980292997 4:130869729-130869751 CTCACAGATCTGCATGGCTGGGG - Intergenic
980758955 4:137202937-137202959 GTCACAGTTCTGCATGGCTAGGG + Intergenic
980797315 4:137701246-137701268 GAAACAGATCTCCCAGGCTAGGG + Intergenic
981370537 4:143953673-143953695 CACACAGTTCTGCATGGCTGGGG - Intergenic
981912082 4:149993641-149993663 GACAGAATTCTGGCTGGCTCTGG - Intergenic
982904148 4:161047605-161047627 GACTCAGTTCTGCATGGCTGGGG + Intergenic
983022353 4:162693509-162693531 CTCACAGATTTGCCTGGCTTGGG + Intergenic
983494206 4:168425127-168425149 GACACTGAACTGCCTATCTCTGG + Intronic
985003829 4:185512933-185512955 GACACAGAGCTGCCAGCATCGGG + Intronic
986141193 5:5032000-5032022 CTCACAGATCTGCGTGGCTGGGG - Intergenic
987011551 5:13771096-13771118 GACACAGATCTACCTAGCTGGGG - Intronic
987069438 5:14321950-14321972 GTCACAGATCAGCATGGCTAGGG - Intronic
987382714 5:17300617-17300639 CACACAGCCCTACCTGGCTCCGG - Intergenic
987539149 5:19231180-19231202 GACACAGCTCTACATGGCTGGGG + Intergenic
987744234 5:21948997-21949019 GTCACAGTTCTGCATGGCTGAGG - Intronic
987882700 5:23769931-23769953 GACACAGTTCTGTGTGGCTGTGG + Intergenic
987890498 5:23870011-23870033 CTCACAGATCTGCATGGCTGGGG - Intergenic
988569880 5:32353745-32353767 CAAGCAGATCTGCCTGCCTCGGG + Intergenic
989386102 5:40855964-40855986 CTCACAGATCTGCATGGCTGGGG - Intronic
989426967 5:41307126-41307148 GGCACAGATCTGTCTCTCTCTGG + Exonic
989501993 5:42178324-42178346 GACACAGTTCTGCAGGGCTGGGG + Intergenic
990199163 5:53351954-53351976 GACTCAGTTCTGCTTGGCTGGGG + Intergenic
990877147 5:60498556-60498578 GACATGGATCTGACTGGCTGTGG + Intronic
991032596 5:62098094-62098116 GACTCAGTTCTGCATGGCTGGGG - Intergenic
991764436 5:69959134-69959156 GTCACAGTTCTGCATGGCTGAGG - Intergenic
991782888 5:70159013-70159035 GTCACAGTTCTGCATGGCTGAGG + Intergenic
991843668 5:70834206-70834228 GTCACAGTTCTGCATGGCTGAGG - Intergenic
991875331 5:71159340-71159362 GTCACAGTTCTGCATGGCTGAGG + Intergenic
995044977 5:107635431-107635453 GACACAGAGCTGGCTGCCTCTGG + Intronic
995049056 5:107681796-107681818 CAGACAGAGCTGCCTTGCTCTGG + Intergenic
995249749 5:109978904-109978926 GACTCAGTTCTGCATGGCTGGGG - Intergenic
996405554 5:123099428-123099450 CACCCAGATCTGCCTGGTACCGG - Intronic
998102648 5:139447050-139447072 GACTCAGTTCTGCATGGCTGGGG - Intergenic
999292402 5:150434803-150434825 AACTTAGCTCTGCCTGGCTCCGG - Intergenic
1000338980 5:160262429-160262451 GACCCAGCACTGCCTGGCTGTGG - Intronic
1001605352 5:172955876-172955898 TACCCAGGTCTGCCTGACTCTGG + Intergenic
1001995638 5:176155289-176155311 GACTCAGACCTGACTTGCTCAGG + Intergenic
1002995883 6:2284538-2284560 GACTCAGTTCTGCATGGCTGGGG + Intergenic
1003043288 6:2709426-2709448 GGCACAGATCTGTCTGTGTCTGG - Intronic
1003985386 6:11429846-11429868 GACACAGCTCTTCCTGGCATGGG - Intergenic
1004151861 6:13127915-13127937 GACTCAGTTCTGCATGGCTAGGG + Intronic
1005122187 6:22401956-22401978 GACTCAGTTCTGCATGGCTGGGG - Intergenic
1005499444 6:26417318-26417340 CTCACAGTTCTGCCTGGCTGGGG + Intergenic
1005859170 6:29888142-29888164 CACACAGATCTGCAAGGCCCAGG + Intergenic
1006428044 6:33978407-33978429 AACACAGATGCGCCTTGCTCAGG + Intergenic
1006500390 6:34455205-34455227 GACACTGAACAGCCTGGCTGGGG + Intergenic
1006805743 6:36787920-36787942 CACCCAGACCTGCCTTGCTCTGG - Intronic
1007068338 6:39015620-39015642 GACTCAGTTCTGCATGGCTGGGG - Intronic
1008260851 6:49365541-49365563 GACACAGTTCTGCATGGCTAGGG + Intergenic
1010722275 6:79296928-79296950 GACACAGTTCTGCAGGGCTAGGG + Intergenic
1012065004 6:94538518-94538540 GGCACAGTTCTGCATGGCTGGGG + Intergenic
1013812410 6:114059737-114059759 CACACAGTTCTGCATGGCTGGGG - Intronic
1014629525 6:123771907-123771929 CACACAGTTCTGCATGGCTGGGG - Intergenic
1015693810 6:135957137-135957159 GAGACAGGTGTGCCTGGGTCCGG + Intronic
1016117917 6:140312089-140312111 CTCACAGTTCTGCATGGCTCCGG + Intergenic
1016293701 6:142551554-142551576 GACACACAGCCGCCTGGCTGTGG - Intergenic
1016632707 6:146250547-146250569 GTCACAGTTCTGCATGGCTGGGG - Intronic
1016737785 6:147499058-147499080 TTCACAGTTCTGCATGGCTCAGG + Intergenic
1017165262 6:151401850-151401872 GAAACAGATTTTCCTAGCTCCGG + Intergenic
1019131857 6:169882766-169882788 TACACAGCTCCTCCTGGCTCAGG - Intergenic
1019374345 7:681217-681239 CTCACAGTTCTGCATGGCTCGGG - Intronic
1020046755 7:5046198-5046220 GACCCAGATCCGCCTCCCTCGGG - Exonic
1022327746 7:29347419-29347441 CTCACAGATCTGCATGGCTGGGG + Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023856611 7:44188103-44188125 GTCCCAGATCTGCCTGTCACTGG - Intronic
1024124485 7:46278476-46278498 CTCACAGATCCGCCTGGCTGAGG - Intergenic
1024252751 7:47518861-47518883 AACTCACATCAGCCTGGCTCTGG + Intronic
1025042276 7:55657631-55657653 CTCACAGTTCTGCATGGCTCGGG + Intergenic
1026155765 7:67824292-67824314 CTCACAGTTCTGCCTGGCTGGGG - Intergenic
1026388220 7:69873234-69873256 TTCACAGATCTGTCTGGCTGTGG + Intronic
1027378642 7:77580227-77580249 ACTACAGATCTTCCTGGCTCAGG - Intronic
1028165174 7:87530157-87530179 CACACAGATCAGAGTGGCTCTGG - Intronic
1030162769 7:106525634-106525656 GAGACAGATGTGGCTGGCCCAGG - Intergenic
1031505539 7:122577172-122577194 GACTCAGTTCTGCATGGCTAGGG - Intronic
1031545603 7:123048848-123048870 GTCACAGATCTACATGGCCCAGG + Intergenic
1031628146 7:124014237-124014259 CTCACAGTTCTGCATGGCTCAGG - Intergenic
1031806937 7:126318061-126318083 GACTCAGTTCTGCATGGCTGTGG + Intergenic
1034689409 7:153001996-153002018 GACTCAGTTCTGCATGGCTGGGG + Intergenic
1034736792 7:153436519-153436541 CTCACAGATCTGCATGGCTGGGG - Intergenic
1035056410 7:156039462-156039484 GCCACAGGTCTGCCTGGGTCTGG - Intergenic
1035655167 8:1300039-1300061 GACACTGATCTGAATGGATCAGG - Intergenic
1036576364 8:10031322-10031344 GACACATATCTGCATTACTCAGG + Intergenic
1036750474 8:11440542-11440564 GACCCAGCACTGCCTGCCTCTGG + Intronic
1037015679 8:13903253-13903275 GACACAGATGTGTCTGTCTTGGG - Intergenic
1037108273 8:15136741-15136763 CTCACAGTTCTGCCTGGCTGGGG - Intronic
1038043992 8:23750641-23750663 GACACAGTTCCGCATGGCTGGGG - Intergenic
1038179427 8:25212755-25212777 GACACAGACCTCCCTTGCTGAGG - Intronic
1038388888 8:27176126-27176148 CTCACAGTTCTGCGTGGCTCGGG - Intergenic
1039358814 8:36851490-36851512 CTCACAGTTCTGCATGGCTCGGG - Intronic
1039787447 8:40846448-40846470 GCCGCGGAGCTGCCTGGCTCTGG + Intronic
1039886871 8:41659765-41659787 AACACGGAGCAGCCTGGCTCTGG - Intronic
1040308501 8:46224502-46224524 GAGACAGATCCGAGTGGCTCTGG - Intergenic
1040734668 8:50491083-50491105 GACACAGATGTCCTTGGCCCAGG + Intronic
1041186702 8:55308331-55308353 CTCACAGTTCTGCCTGGCTGGGG + Intronic
1042250332 8:66750381-66750403 GACAAATAGGTGCCTGGCTCAGG - Intronic
1042636081 8:70877050-70877072 GACTCAGTTCTGCATGGCTGGGG + Intergenic
1043030886 8:75131815-75131837 GGCACAGTTCTGCATGGCTGGGG - Intergenic
1043062982 8:75528876-75528898 GACACAGTTCCGCGTGGCTGGGG + Intronic
1043209377 8:77491750-77491772 GACTCAGTTCTGCATGGCTAGGG - Intergenic
1043401222 8:79886219-79886241 ATGACAGAACTGCCTGGCTCTGG - Intergenic
1043759872 8:84054852-84054874 GACTCAGTTCTGCGTGGCTGGGG + Intergenic
1043773028 8:84228722-84228744 CTCACAGATCTGCATGGCTTGGG + Intronic
1043834402 8:85030823-85030845 GAAACAGATCTACCTTTCTCTGG + Intergenic
1044275671 8:90296953-90296975 CTCACAGATCTGCATGGCTGGGG + Intergenic
1044773649 8:95664577-95664599 GACACAGTTCAGCATGGCTGGGG + Intergenic
1045239798 8:100389509-100389531 TACAAAGATGTGCCTGGCCCAGG - Intronic
1046170264 8:110496943-110496965 GTCACAGTTCTGCATGGCTGGGG - Intergenic
1046199387 8:110903179-110903201 GACTCAGTTCTGCATGGCTGGGG + Intergenic
1047594846 8:126368062-126368084 GACTCAGTTCTGCCGGGCTGGGG + Intergenic
1048351877 8:133623239-133623261 GAGACAGAGGTGCCTTGCTCAGG - Intergenic
1048415864 8:134227103-134227125 CACCCAGAGCTGCCTGGCTTGGG - Intergenic
1050428141 9:5533748-5533770 GTCAAACATCTGACTGGCTCTGG + Intronic
1050598253 9:7225485-7225507 GTCACAGTTCTGCATGGCTGGGG + Intergenic
1051107180 9:13593487-13593509 CTCACAGTTCTGCCTGGCTAGGG - Intergenic
1051779203 9:20670409-20670431 GATACAGTTCTGCATGGCTGGGG + Intronic
1051922232 9:22280802-22280824 CTCACAGATCTGCATGGCTGGGG + Intergenic
1052012089 9:23422348-23422370 CTCACAGTTCTGCATGGCTCAGG - Intergenic
1053264092 9:36697974-36697996 CTCACAGATCTGCATGGCTGGGG + Intergenic
1054166120 9:61731048-61731070 TTCACAGATCTGCATGGCTGGGG - Intergenic
1056218270 9:84426059-84426081 GACACAGATCTGGCTGGGCATGG + Intergenic
1056765589 9:89442826-89442848 GACTCACATCTGCCCGGGTCTGG - Intronic
1056793684 9:89641819-89641841 GTCACAGACCAGCCAGGCTCAGG + Intergenic
1057084042 9:92192306-92192328 GACTCAGTTCTGCATGGCTGGGG - Intergenic
1057147388 9:92767560-92767582 GAGTCAGATCAGCCTGGATCAGG - Intergenic
1057515155 9:95714378-95714400 GGCGCAGAGCTGCCTGGCCCTGG - Intergenic
1059382375 9:113936194-113936216 GACCCAGGTCTGTCTGCCTCTGG - Intronic
1061439505 9:130590946-130590968 AACCCAGGTCTGCCTGACTCTGG - Intronic
1061874462 9:133536947-133536969 GAGGCTGATCTGACTGGCTCTGG - Intronic
1062010423 9:134264002-134264024 GACCCTGGTCTGCCTGGCTGGGG + Intergenic
1062140630 9:134956032-134956054 GGCACAGATGTCCCTGGCCCAGG - Intergenic
1185938744 X:4289076-4289098 CTCACAGATCTGCCTGGCTGGGG - Intergenic
1186989809 X:15055303-15055325 CTCACAGTTCTGCCTGGCTGAGG - Intergenic
1189553217 X:42114539-42114561 CTCACAGTTCTGCCTGGCTGGGG + Intergenic
1191680169 X:63832213-63832235 GACTCAGTTCTGCATGGCTTGGG - Intergenic
1191736114 X:64389651-64389673 GTCAAAGATCAGCCTGTCTCAGG - Intronic
1192616956 X:72635266-72635288 GCAACAGTTCTACCTGGCTCTGG - Exonic
1194435224 X:93860987-93861009 CTCACAGTTCTGCCTGGCTGGGG - Intergenic
1196129328 X:112137394-112137416 CTCACAGTTCTGCATGGCTCTGG + Intergenic
1196246437 X:113404979-113405001 GACACAGTGCTGCATGGCTGGGG - Intergenic
1196309944 X:114151848-114151870 CTCACAGTTCTGCCTGGCTAGGG - Intergenic
1196413986 X:115451605-115451627 GACTCAGTTCTGCATGGCTGGGG + Intergenic
1196694230 X:118594051-118594073 CTCACAGATGTCCCTGGCTCTGG - Intronic
1197264095 X:124347544-124347566 GTCTCAGATCTGCCTGACTCCGG - Intronic
1197381765 X:125752591-125752613 CACACAGTTCTGCGTGGCTGGGG + Intergenic
1197569655 X:128132743-128132765 CTCACAGTTCTGCATGGCTCGGG - Intergenic
1198457984 X:136836186-136836208 CTCACAGTTCTGCATGGCTCCGG - Intergenic
1198477018 X:137004966-137004988 GACTCAGCTCTGCATGGCTGGGG + Intergenic
1199231651 X:145443553-145443575 GACTCAGCTCTGCATGGCTGGGG - Intergenic
1199306341 X:146270866-146270888 GACTCCGATCTGCATGGCTGGGG - Intergenic
1199435689 X:147810118-147810140 CTCACAGTTCTGCCTGGCTGAGG - Intergenic
1200057027 X:153467075-153467097 GGCGCAGATTTGCCTGACTCAGG - Intronic
1200277997 X:154751992-154752014 GACACAGCTCTGGCTGCCTATGG - Intergenic
1200919549 Y:8601142-8601164 GAGACAGATCTGCCTTTTTCTGG - Intergenic