ID: 1152830140

View in Genome Browser
Species Human (GRCh38)
Location 17:82492083-82492105
Sequence GGGTGCTCACGACTGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152830134_1152830140 24 Left 1152830134 17:82492036-82492058 CCAATAGGCAAAGATTTTTATTA No data
Right 1152830140 17:82492083-82492105 GGGTGCTCACGACTGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152830140 Original CRISPR GGGTGCTCACGACTGCTGGC TGG Intergenic
No off target data available for this crispr