ID: 1152831704

View in Genome Browser
Species Human (GRCh38)
Location 17:82501320-82501342
Sequence CCTGGGACCCAGGTCTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152831704_1152831717 16 Left 1152831704 17:82501320-82501342 CCAGTGGAGACCTGGGTCCCAGG No data
Right 1152831717 17:82501359-82501381 TCTACCTCCACCCCCAGTGGAGG No data
1152831704_1152831715 13 Left 1152831704 17:82501320-82501342 CCAGTGGAGACCTGGGTCCCAGG No data
Right 1152831715 17:82501356-82501378 CCCTCTACCTCCACCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152831704 Original CRISPR CCTGGGACCCAGGTCTCCAC TGG (reversed) Intergenic
No off target data available for this crispr