ID: 1152831717

View in Genome Browser
Species Human (GRCh38)
Location 17:82501359-82501381
Sequence TCTACCTCCACCCCCAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152831709_1152831717 -8 Left 1152831709 17:82501344-82501366 CCTGCCTCCCCACCCTCTACCTC No data
Right 1152831717 17:82501359-82501381 TCTACCTCCACCCCCAGTGGAGG No data
1152831706_1152831717 6 Left 1152831706 17:82501330-82501352 CCTGGGTCCCAGGTCCTGCCTCC No data
Right 1152831717 17:82501359-82501381 TCTACCTCCACCCCCAGTGGAGG No data
1152831708_1152831717 -2 Left 1152831708 17:82501338-82501360 CCAGGTCCTGCCTCCCCACCCTC No data
Right 1152831717 17:82501359-82501381 TCTACCTCCACCCCCAGTGGAGG No data
1152831704_1152831717 16 Left 1152831704 17:82501320-82501342 CCAGTGGAGACCTGGGTCCCAGG No data
Right 1152831717 17:82501359-82501381 TCTACCTCCACCCCCAGTGGAGG No data
1152831707_1152831717 -1 Left 1152831707 17:82501337-82501359 CCCAGGTCCTGCCTCCCCACCCT No data
Right 1152831717 17:82501359-82501381 TCTACCTCCACCCCCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152831717 Original CRISPR TCTACCTCCACCCCCAGTGG AGG Intergenic
No off target data available for this crispr