ID: 1152834533

View in Genome Browser
Species Human (GRCh38)
Location 17:82520426-82520448
Sequence CTGGGTCCCGCTGGTGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152834533_1152834544 12 Left 1152834533 17:82520426-82520448 CCGGGACCACCAGCGGGACCCAG 0: 1
1: 0
2: 0
3: 37
4: 209
Right 1152834544 17:82520461-82520483 TCCCAACCCTCGACAGCCCCTGG 0: 1
1: 0
2: 11
3: 215
4: 1898

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152834533 Original CRISPR CTGGGTCCCGCTGGTGGTCC CGG (reversed) Intronic
900617474 1:3571852-3571874 CTGGGTCCTCCTGGGTGTCCTGG + Intronic
900745811 1:4360143-4360165 GTGGGTGCCGCTGGAGGGCCTGG + Intergenic
901658955 1:10786907-10786929 CTGGGTGTCGCGGGTGGTGCTGG - Intronic
904038223 1:27570080-27570102 CTGAGACCCGCTGGGGGCCCAGG - Intronic
904476955 1:30771410-30771432 CTAGGTCCCCCTGTTGTTCCAGG - Intergenic
905410093 1:37762734-37762756 CAGGGATCCTCTGGTGGTCCAGG - Intronic
906323207 1:44829222-44829244 CGGGGTACTGCTGGTGGCCCTGG - Exonic
906511311 1:46411785-46411807 CTGGGCCCAAGTGGTGGTCCAGG - Intronic
907258317 1:53196977-53196999 CGGGGCCCCGCGGTTGGTCCGGG + Exonic
908401361 1:63774849-63774871 CTGGGGCGCGCTAGAGGTCCAGG - Intronic
909267374 1:73577532-73577554 CTGGCTCCAGCTGCTGTTCCAGG - Intergenic
920107400 1:203563642-203563664 CTGGGTCGGGCTGGTCTTCCAGG - Intergenic
920173723 1:204087348-204087370 CAGGGTCCAGCTGGTGCCCCTGG - Intronic
920681264 1:208074555-208074577 ATGGGTCCCTCGGGTGGGCCTGG + Intronic
922721490 1:227902379-227902401 CTGGGTCTCCCTGGTGGCCTGGG + Intergenic
922725689 1:227922070-227922092 TGGGGTCCCTCTGGGGGTCCAGG - Intronic
923502577 1:234578348-234578370 CTGGGCCACGCTGGTGCTGCTGG - Intergenic
923765664 1:236890351-236890373 CTGGCTCCCACTGCAGGTCCGGG + Intronic
1062834962 10:629432-629454 CTGGGTCCTGCCGCTGGTCTGGG - Intronic
1069915754 10:71785657-71785679 CTGGGATCCGCTCGCGGTCCAGG - Intronic
1070309760 10:75264703-75264725 CTGAGCCCCTGTGGTGGTCCAGG + Intergenic
1072876151 10:99175250-99175272 TTTTGTCTCGCTGGTGGTCCAGG - Intronic
1075133189 10:119758215-119758237 CTGGGTGGAGCTGGTGCTCCTGG + Intronic
1075591271 10:123693346-123693368 CTGGGTCCTACTGATGCTCCTGG - Exonic
1076453124 10:130570657-130570679 CTGGGACACGCAGCTGGTCCTGG + Intergenic
1076601944 10:131663038-131663060 CTGTGTCCTGCTGGGTGTCCAGG - Intergenic
1076647650 10:131964361-131964383 CTGGGTCCCGGTGGTGGTGACGG - Intergenic
1076724020 10:132405074-132405096 CTGGGCGCGGCTGGGGGTCCGGG - Exonic
1076859954 10:133135832-133135854 CTGGGTCCCTGTGGTGGGTCTGG + Intergenic
1076860677 10:133137850-133137872 CTGGGTCCCTGTGGGGGTTCTGG + Intergenic
1076860698 10:133137903-133137925 CTGGGTCCCTGTGGGGGTTCTGG + Intergenic
1076861016 10:133138746-133138768 CTGGGTCCCTGTGGTGGGTCTGG + Intergenic
1076882627 10:133247129-133247151 CTGGGGCCGCCTGGTGGTCGGGG - Intergenic
1077339254 11:2018703-2018725 CAGGGTCCCTCTGGGGGTCTCGG - Intergenic
1083854567 11:65386451-65386473 CTGGGTCACTCTGGTGGTGGCGG + Intergenic
1083882545 11:65555626-65555648 CTGGGTCCCACAGGGGGTTCGGG + Intronic
1084275617 11:68049671-68049693 CCAGGCCACGCTGGTGGTCCTGG + Exonic
1084426323 11:69086270-69086292 CTGGCCCCAGCTGATGGTCCTGG + Intronic
1087831005 11:102819900-102819922 TTCTGTCCCGCTGGTGTTCCAGG + Intergenic
1089712491 11:120325554-120325576 CTGGCTCCGGCTCTTGGTCCGGG + Intronic
1090831643 11:130424798-130424820 CAGGGGCCCGAGGGTGGTCCTGG + Intronic
1202822238 11_KI270721v1_random:73885-73907 CAGGGTCCCTCTGGGGGTCTCGG - Intergenic
1091682500 12:2537112-2537134 GTGGGTGCAGGTGGTGGTCCTGG - Intronic
1091720580 12:2810444-2810466 CTGGGTCCCACAGGTATTCCTGG - Intergenic
1091750909 12:3020746-3020768 CCGGGTCCTGCTGCTGCTCCAGG - Exonic
1091781487 12:3216896-3216918 CTGGGTCCTGGTGAAGGTCCAGG + Intronic
1092152793 12:6262548-6262570 CAGGCTCCCGCTGGGTGTCCTGG - Intergenic
1095984302 12:47989253-47989275 GTCGGTCCTGCTGGTGGTCCTGG - Exonic
1096263545 12:50107171-50107193 CTGGCTCCAGGAGGTGGTCCAGG + Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1099133559 12:78864929-78864951 GTGGGACCAGCTGGTGGCCCTGG + Exonic
1104682569 12:130761647-130761669 CTGGGTGCTGCTTGTGGTGCAGG - Intergenic
1105762328 13:23526248-23526270 CTCGGTCCCCCTTGTGGTCCAGG + Intergenic
1105943460 13:25170842-25170864 CTGGGTCTCGCGGGGCGTCCTGG + Exonic
1107644352 13:42478576-42478598 CTGGGTCCTGCTCCTGTTCCAGG + Intergenic
1108425052 13:50291072-50291094 CTGGCTCCCACTGATGGTCGTGG + Intronic
1109424190 13:62150386-62150408 CTTGGTCCCGTTTGTGGTCTAGG + Intergenic
1113681039 13:112245395-112245417 CTGGGTCACGGTGGTCGTCGTGG - Intergenic
1113781873 13:112981787-112981809 GTGGGTCACGCTGGCGGCCCAGG - Intronic
1115963607 14:38863218-38863240 ATGGGTCAGGCTGTTGGTCCAGG + Intergenic
1121006889 14:90496312-90496334 GTGGGTTCTGCTGGTGGTCTTGG - Intergenic
1121245939 14:92460856-92460878 CTGGGTCCTGCTGATGCTGCCGG - Intronic
1123004597 14:105315123-105315145 CTGGGCTCCGCTGGGGGACCCGG - Exonic
1123144603 14:106116558-106116580 CGGGCGCCCCCTGGTGGTCCTGG + Intergenic
1123156809 14:106234985-106235007 CGGGCGCCCCCTGGTGGTCCTGG + Intergenic
1123207580 14:106728086-106728108 CGGGCGCCCCCTGGTGGTCCTGG + Intergenic
1123212591 14:106775080-106775102 CTGGCGCCCCCTGGTGGTCCTGG + Intergenic
1131355592 15:91743039-91743061 CTGGGTTCCACTGCTAGTCCTGG + Intergenic
1132221807 15:100110765-100110787 GTGGGTCCTTCTGGTGGCCCCGG + Intronic
1132411717 15:101583869-101583891 CTGGGGCCCGTTGGGGGTCGGGG - Intergenic
1132646955 16:1003573-1003595 CAGGAGCCCGGTGGTGGTCCCGG + Intergenic
1132881608 16:2164035-2164057 CTGGGGCATGCTGGGGGTCCTGG - Intronic
1132945135 16:2528232-2528254 CTGGGTCGCGGTGGTGGAACTGG - Exonic
1133072755 16:3257252-3257274 ATGAGTCAGGCTGGTGGTCCAGG - Intergenic
1133348993 16:5089170-5089192 CAGGAGCCCGCTGGTGCTCCCGG + Exonic
1137013161 16:35344461-35344483 CTGGGGCCTGCAGGTGGCCCTGG - Intergenic
1137019867 16:35414648-35414670 CTGGGGCCTGCAGGTGGCCCTGG - Intergenic
1137408080 16:48205683-48205705 CTGGAACTCGCTGGTGGGCCTGG - Intronic
1137671377 16:50281572-50281594 GTGTGTCCCGCAGCTGGTCCTGG - Intronic
1141504339 16:84464768-84464790 CTGGTTCCCTTTGGTGGTTCTGG - Intergenic
1141760630 16:86026418-86026440 CCAGGTCCCGCTGGTGCCCCAGG - Intergenic
1141851017 16:86646169-86646191 CTGTGTCCCGCCTGTGGTCCTGG - Intergenic
1142189838 16:88712730-88712752 CTGGGGGCCGGGGGTGGTCCTGG + Exonic
1142684666 17:1571007-1571029 CTGGGTGCTGCTAGTGGCCCTGG + Intronic
1142884595 17:2904778-2904800 CCAGGTGCCGCTGGTGGTCCAGG + Intronic
1143622975 17:8091533-8091555 CTGGCTCCCGCCCCTGGTCCAGG - Intergenic
1143632714 17:8148054-8148076 CTGGGGCCCCCAGGAGGTCCTGG + Exonic
1144532159 17:16049914-16049936 CAGGGTCCCGCTCGTTGCCCAGG + Intronic
1144960174 17:19040255-19040277 CTGGCTCCAGCTTGTGGCCCTGG + Intronic
1144974986 17:19134269-19134291 CTGGCTCCAGCTTGTGGCCCTGG - Intronic
1146120853 17:30193060-30193082 CTGGGTCCTGCTGCTTTTCCAGG - Intergenic
1147060025 17:37868276-37868298 CAGGGTCTCGCTTGTTGTCCAGG + Intergenic
1148795378 17:50194428-50194450 CAGGGTCCCGCTGGTGAACGTGG - Exonic
1151401881 17:73861162-73861184 CTGGGTCACACAGGAGGTCCTGG - Intergenic
1151698139 17:75728486-75728508 GTGGGTCCCGCAGGTGGGCAAGG + Intronic
1152311950 17:79556886-79556908 CTGTGTCCAGCTGGTGCTCAGGG + Intergenic
1152371694 17:79892296-79892318 GAGGGTCCCGCTGGTGGACGAGG + Intergenic
1152834533 17:82520426-82520448 CTGGGTCCCGCTGGTGGTCCCGG - Intronic
1154457456 18:14543342-14543364 TTGGGTCCCCCTGGTGGGCGTGG - Intronic
1156458128 18:37306129-37306151 CTGGGTCCTGGTGGGGGGCCAGG + Intronic
1156688331 18:39676345-39676367 TTGGATCTGGCTGGTGGTCCTGG - Intergenic
1157298076 18:46460047-46460069 CTGGGTGCCGAAGGGGGTCCTGG - Exonic
1157901979 18:51526716-51526738 CAGGGGCCTGCAGGTGGTCCTGG - Intergenic
1159868634 18:73735547-73735569 ATGGGTCCTGCAGGTGGTCCTGG - Intergenic
1160538725 18:79609241-79609263 CTGGGCCCAGCTGTTGGTGCAGG - Intergenic
1160811528 19:1014966-1014988 GTGGGTCCAGCTGGTGGCCCTGG - Intronic
1160833986 19:1116184-1116206 CTGGGTCCCTGTGGGGGTCCCGG + Intronic
1161609117 19:5231268-5231290 CTGGGGCCTGCGGGGGGTCCCGG + Intronic
1161719169 19:5893865-5893887 CTGGGCCCTGCTGGTGGGCCGGG - Intronic
1161740161 19:6016163-6016185 CTGGGTCTAGCTTGTGCTCCTGG + Exonic
1163114136 19:15179064-15179086 CTGGGTCCTGCAGGCAGTCCCGG + Exonic
1163862623 19:19750141-19750163 CTGGGCCCCACTGATGGTCCTGG - Intergenic
1164615086 19:29662970-29662992 CCTTGTCCTGCTGGTGGTCCAGG - Intergenic
1167286920 19:48603569-48603591 CGGGGGGCCGCTGGGGGTCCGGG + Exonic
1167782201 19:51606051-51606073 CTGGGTCCATCTGGGGATCCTGG - Intergenic
1168153272 19:54460396-54460418 CTGGGTCCCCACGGTGGCCCTGG + Intronic
925140009 2:1543827-1543849 CTGGGTTGCGCAGGTGGTGCAGG + Intergenic
925140631 2:1547488-1547510 CAGGCTCCCCCAGGTGGTCCAGG + Intergenic
925153668 2:1634608-1634630 ATGTGTCCAGCTGGTGGTCTTGG - Intronic
926142012 2:10373331-10373353 CTGGGACCTGCTGGGGGCCCAGG - Intronic
926143068 2:10380012-10380034 CTGAGTCCATCTGGAGGTCCAGG + Intronic
927698393 2:25252388-25252410 GTGGGCCCCGCTGGAGGGCCTGG + Intronic
929330225 2:40673565-40673587 CTTGGTCCTCCTTGTGGTCCAGG + Intergenic
933698259 2:85236335-85236357 CTGGGTCACCATGGTTGTCCTGG + Intronic
936913428 2:117615560-117615582 CAGTTTCCCCCTGGTGGTCCAGG - Intergenic
936938414 2:117859482-117859504 CCGGGTCCTGCTGCTGGTCTCGG - Intergenic
939676094 2:145073632-145073654 CTGGGTCCCCTTTGTTGTCCAGG + Intergenic
940986547 2:160057336-160057358 CTGGGTCCCCCTTGAGATCCTGG + Intronic
942045000 2:172095035-172095057 CTCCGTCCCGATTGTGGTCCAGG - Intergenic
942692356 2:178599418-178599440 ATGGGTCCCACTGGAGGGCCAGG + Exonic
943597918 2:189879607-189879629 TTTGGTCCCGCGGGTGGTGCTGG - Intronic
948845663 2:240681750-240681772 CTGGGTGCCACGGTTGGTCCAGG + Intronic
1169209921 20:3760167-3760189 CAGGCTCCCGCTGGTGTCCCTGG - Exonic
1170557733 20:17528966-17528988 CTGGGCCCCTCTTGAGGTCCAGG + Intronic
1171781980 20:29427783-29427805 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1172605686 20:36212061-36212083 CCTGGTCCTGGTGGTGGTCCTGG + Intronic
1173555453 20:43962306-43962328 ATGGGACTCACTGGTGGTCCTGG + Intronic
1175785245 20:61708075-61708097 CTGGGCTCTGCTGGGGGTCCCGG + Intronic
1175917144 20:62431564-62431586 CTGGGTCTCGCTCCTGTTCCTGG + Intergenic
1176043526 20:63080710-63080732 CTGAGTTCCTCTGCTGGTCCAGG + Intergenic
1176127700 20:63483316-63483338 CTGGGTGCCCCTGGCAGTCCTGG - Intergenic
1178599839 21:33985914-33985936 CTGGCTTCCGCTGGGGGTGCTGG + Intergenic
1179723657 21:43330002-43330024 CAGGGTGCAGCTGGAGGTCCGGG + Intergenic
1181171447 22:21012414-21012436 CTGGGTCCTGCTGGTGTTGCTGG - Intronic
1181177902 22:21048105-21048127 CTGGGGCCTGCTGGTGTTGCTGG + Intronic
1181403968 22:22668736-22668758 CTGGGCCCCGCTGATGGTCAAGG - Intergenic
1181415466 22:22755763-22755785 CTGGGTCCTGTTGATGGTCAGGG - Intronic
1181519323 22:23436325-23436347 CTGGGCCCCGCTGCAGGTGCTGG + Intergenic
1181554516 22:23660741-23660763 CTGGGTCTCACTGGTTGTCTAGG - Intergenic
1182299503 22:29329819-29329841 CTGGGTCCTGCTGGCAGTGCTGG - Intronic
1183063879 22:35350753-35350775 CAGGGTCCCCCTGGCGTTCCTGG + Intergenic
1183352614 22:37342568-37342590 CTGGGTCCCACTGCTGCCCCTGG + Intergenic
1183665360 22:39243395-39243417 CTGGCTCCCGGTCGGGGTCCGGG - Intronic
1183720698 22:39559903-39559925 CTGGCGCCCCCTGGTGGGCCTGG - Intergenic
1184208186 22:43018630-43018652 CTGGGTCCTGCTGATGTTCCTGG + Intergenic
1185291916 22:50031521-50031543 CTCGGTCCCGCTGAGGGCCCAGG - Intronic
1185340329 22:50288107-50288129 CTGGGTCAAGCTGGCGGTCTGGG - Intronic
949548870 3:5096134-5096156 TTGGTTCCAGCTGGTGGTCGCGG - Intergenic
950345613 3:12288790-12288812 CGGGGTGCGGCTGGGGGTCCTGG - Intronic
950472047 3:13192567-13192589 CTGGGGACGGCAGGTGGTCCTGG - Intergenic
950524901 3:13517862-13517884 CTGGGTCCTGCTGCTCCTCCTGG - Intergenic
952413842 3:33072873-33072895 CTGAGTACCCCTGGTGGACCTGG - Intronic
952530828 3:34260119-34260141 CTGGGACCCTCTAGAGGTCCAGG + Intergenic
954849728 3:53590105-53590127 ATGGATCCAGCTAGTGGTCCTGG + Intronic
955356704 3:58237876-58237898 CTGGGTCCCGCCGCCGGGCCCGG - Exonic
961301502 3:125925030-125925052 CAGGAGCCCGCTGGTGCTCCCGG - Intergenic
961790470 3:129372479-129372501 CAGGGTCTCCCTGGTTGTCCAGG + Intergenic
965667477 3:171110734-171110756 CTGGATCCTGCTTGTGATCCAGG + Exonic
968264831 3:197355005-197355027 CAGGGTCCCTATCGTGGTCCTGG - Intergenic
968996119 4:3946831-3946853 CAGGAGCCCGCTGGTGCTCCCGG + Intergenic
969436700 4:7192938-7192960 CCCGGTCCCGCTCCTGGTCCCGG + Exonic
969817847 4:9699409-9699431 CAGGAGCCCGCTGGTGCTCCCGG - Intergenic
974187155 4:58459577-58459599 CTCGGTCCTCCTGGTGGTCTAGG + Intergenic
975538945 4:75484185-75484207 CTGGGTCCCCTTGGTGCTCCTGG - Intronic
976554403 4:86433330-86433352 TTGGCTCCAGCTGGGGGTCCTGG - Intronic
982055844 4:151548188-151548210 CTGGGTCCCAGTGCTGGTGCTGG - Intronic
985950199 5:3217214-3217236 CTGGGTCCTGAAGGTGGTCTGGG - Intergenic
986771822 5:10980881-10980903 CTGGGGCCTGCTGGGGGTCAGGG + Intronic
986781133 5:11066717-11066739 CTGAGTCTCGCTGTTGGTCTTGG - Intronic
990116565 5:52398710-52398732 CTGGGTCCCCTTTGTGGTCTAGG + Intergenic
996434834 5:123423068-123423090 GGGGGTCCCGCCGGGGGTCCCGG - Exonic
999255179 5:150206013-150206035 CTGTGTCCCACTGGTGGCCCGGG + Intronic
1001772791 5:174308595-174308617 CTGGGTCCCCCTGGTTAACCCGG + Intergenic
1002167779 5:177358853-177358875 CTGGGGCCTGGTGGTGGGCCAGG - Intronic
1003503969 6:6724994-6725016 CTGGGTCGGGCTGCTGGGCCCGG - Intergenic
1003608365 6:7585778-7585800 CCGGGTCCCGCAGTGGGTCCCGG + Exonic
1006175053 6:32116546-32116568 CTGGGAGCAGCAGGTGGTCCTGG + Exonic
1006677950 6:35777279-35777301 CTGGGTCCTGCTGAGGGGCCGGG + Intronic
1008009106 6:46444802-46444824 CTGGGTCCAAGGGGTGGTCCTGG - Intronic
1010193531 6:73217432-73217454 CTAGGACCAGCTGGTGGCCCTGG + Intronic
1010195228 6:73232878-73232900 CTAGGACCAGCTGGTGGCCCTGG + Intronic
1015554860 6:134450669-134450691 CTGAGTCCTGCTGGTTGTCTTGG - Intergenic
1018650673 6:165988961-165988983 CTGAGTACCGCTGGCGGCCCAGG + Intergenic
1019158493 6:170054266-170054288 CTCGGTCCGGCTGAGGGTCCCGG + Intergenic
1019591956 7:1840006-1840028 CTGGGCCCCGCTGCAGGTGCTGG - Intronic
1019770440 7:2880924-2880946 CTGGCTCCGGCTGGTGGGGCTGG - Intergenic
1020339011 7:7089285-7089307 TTCGGTCTCGCTGGTGTTCCAGG + Intergenic
1020694015 7:11392511-11392533 TTCGGTCCTGCTGGTGCTCCAGG - Intronic
1022456049 7:30559332-30559354 CTGGGTCTCGCTTGTTGCCCAGG - Intergenic
1027765059 7:82329339-82329361 CTGTCTCCCTCTGGTTGTCCTGG - Intronic
1028753998 7:94413918-94413940 CAGGGTCCCCCTGGTCCTCCAGG + Exonic
1029375960 7:100177138-100177160 CTGTGTCCCGGTCCTGGTCCCGG - Exonic
1033283039 7:140019150-140019172 CTGGGACCAGCTGCTGGTCCTGG + Intronic
1033547314 7:142413208-142413230 CAGGGTCCCTCCGATGGTCCAGG - Intergenic
1035677794 8:1467414-1467436 CTGGGTCTCTCTGGAGCTCCTGG - Intergenic
1040637777 8:49295736-49295758 CTGGGTGCTGCTGGTGCTGCTGG - Intergenic
1041129414 8:54681688-54681710 CTGGGACCTGTTGGGGGTCCAGG - Intergenic
1043506283 8:80906516-80906538 CAGGGACCCGCTGGTGGACTAGG + Intergenic
1047791619 8:128209496-128209518 GTGGCTCCCGCTTGTAGTCCCGG - Intergenic
1049284511 8:141767277-141767299 CTGGGTCAGGCAGGTGGTCTAGG + Intergenic
1049347371 8:142146127-142146149 CTGGGGCCCTCTGCTTGTCCTGG + Intergenic
1049427608 8:142544366-142544388 CACGATCCCGCTGGTGGGCCAGG + Exonic
1051629255 9:19127359-19127381 CTGGGCGCCGCTGGGGGCCCGGG + Intronic
1053139517 9:35673983-35674005 CTGGCTCCCTCTGTTGATCCCGG + Exonic
1054828713 9:69599662-69599684 CTGGGTACTGCTGGTGCTACTGG - Intronic
1055266481 9:74499581-74499603 CTGGCTCCAGCTGATTGTCCCGG + Intronic
1057744325 9:97739462-97739484 CTGGGTCCTGCTGGGGGCTCTGG - Intergenic
1061385401 9:130286616-130286638 CTGGGTTCAGCAGTTGGTCCAGG + Intronic
1061872956 9:133530351-133530373 GAGGGTCCCGCTGCTGGTCCTGG + Intergenic
1061900683 9:133670621-133670643 CTGCGGCCCGCTGCTGCTCCAGG + Exonic
1062045109 9:134421429-134421451 CTGGGTCCCCCCAGTGGTGCAGG + Intronic
1062102961 9:134737984-134738006 CTGGGGCCTGACGGTGGTCCTGG + Intronic
1203441768 Un_GL000219v1:16008-16030 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1203512578 Un_KI270741v1:134917-134939 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1186881571 X:13871918-13871940 CTGGGTCCAGCTGTTCTTCCAGG + Intronic
1189349632 X:40266974-40266996 CTGGTTCCCGCCGGTGGCTCCGG + Intergenic
1190220381 X:48508990-48509012 CTGGGAGCCGCTGCTGGTCCCGG + Intronic
1196442428 X:115728716-115728738 CAGGGTCCCGCAGGTGGGCCAGG - Intergenic
1196443129 X:115732188-115732210 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196445450 X:115844103-115844125 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196446121 X:115847084-115847106 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196446792 X:115850065-115850087 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196447460 X:115853048-115853070 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196448131 X:115856027-115856049 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196448800 X:115859018-115859040 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196449471 X:115862009-115862031 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196450140 X:115864992-115865014 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196450810 X:115867977-115867999 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196451481 X:115870956-115870978 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196452152 X:115873943-115873965 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196452822 X:115876912-115876934 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196453492 X:115879905-115879927 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196454161 X:115882914-115882936 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196454828 X:115885903-115885925 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1196455242 X:115887985-115888007 CAGGGTCCCGCAGGTGGGCCAGG + Intergenic
1201631097 Y:16072752-16072774 CTGGGTCCTCCTTGTGGTCTAGG + Intergenic
1201915850 Y:19180595-19180617 CTGGGTCACACTGGTGGTTTTGG - Intergenic