ID: 1152835600

View in Genome Browser
Species Human (GRCh38)
Location 17:82528690-82528712
Sequence CGAGGAAAGCAGGGCCGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152835600_1152835607 5 Left 1152835600 17:82528690-82528712 CCCCTGCGGCCCTGCTTTCCTCG 0: 1
1: 0
2: 0
3: 8
4: 215
Right 1152835607 17:82528718-82528740 GTCAGTTTAGAGTGCACATTGGG 0: 1
1: 0
2: 2
3: 5
4: 101
1152835600_1152835606 4 Left 1152835600 17:82528690-82528712 CCCCTGCGGCCCTGCTTTCCTCG 0: 1
1: 0
2: 0
3: 8
4: 215
Right 1152835606 17:82528717-82528739 CGTCAGTTTAGAGTGCACATTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152835600 Original CRISPR CGAGGAAAGCAGGGCCGCAG GGG (reversed) Intronic
900100770 1:961094-961116 CCAGGGGAGCAGGGGCGCAGCGG + Intronic
900483703 1:2911404-2911426 CGGGGACAGCAGCGCCGCGGCGG - Intergenic
904289292 1:29473779-29473801 CCAGGAAAGCAGGTCGGCAGTGG - Intergenic
904314092 1:29649088-29649110 CGAGGAAAGCAAGGTCAGAGAGG + Intergenic
906276778 1:44522797-44522819 CCAGGAGGGCAGGGCCTCAGAGG - Intronic
908169864 1:61493753-61493775 CTAGGAAAACAGTGCTGCAGCGG - Intergenic
908181443 1:61610210-61610232 CAATGAAAGCATGGCCTCAGTGG + Intergenic
908415468 1:63909153-63909175 GGTGGAAAGCAGGTGCGCAGGGG - Intronic
914377355 1:147084142-147084164 CGATGAAAGCAGGGCCTTTGGGG - Intergenic
915468602 1:156112826-156112848 CAAGGAAAGCAGGGCTGGACAGG - Intronic
916472720 1:165139651-165139673 GTAGGAAAGTAGGGCTGCAGAGG + Intergenic
916694265 1:167220814-167220836 GGAGGCAAGCAGGGCGGGAGGGG + Exonic
917981430 1:180272003-180272025 CGAGGTGAGCAGGGCTGGAGGGG + Exonic
919423050 1:197395059-197395081 GGAGGAAGGCTGGGCCTCAGAGG + Intronic
919785996 1:201259176-201259198 GGAGGGAGGCAGGGCTGCAGTGG + Intergenic
920379501 1:205527593-205527615 GGAGGACAGCAGGGGTGCAGAGG - Intronic
922496486 1:226062198-226062220 CGAGGAGACCCGGGCGGCAGTGG - Intronic
922794432 1:228333136-228333158 CGAGGGGAGCAGGGCGGGAGGGG - Intronic
923724606 1:236495408-236495430 AGAGGAAAGCAGGGCTCCAGAGG - Intergenic
923755215 1:236785658-236785680 GGAGGAGAGCAAGGCAGCAGGGG - Intergenic
924385537 1:243495621-243495643 TGGGGACAGCAGGGCCGCAGGGG + Intronic
924896184 1:248339717-248339739 GGAGGAATGCATGGCCGCTGCGG + Intergenic
1062965615 10:1605402-1605424 CAAGGAAAGAAGGGCACCAGTGG - Intronic
1063393602 10:5666343-5666365 CGGTGAAAGCAGGGTCCCAGTGG - Intronic
1063647885 10:7904042-7904064 CTTGGAAACAAGGGCCGCAGAGG + Intronic
1065302843 10:24339666-24339688 AGAGGAAATAAGGGCTGCAGAGG + Intronic
1067082953 10:43221824-43221846 AGTGGAGAGCAGGGCCTCAGAGG - Intronic
1067284653 10:44898860-44898882 GGAGGAAGGCAGGACTGCAGGGG - Intergenic
1073070558 10:100790771-100790793 TGAGGAAGGCAGGGCAGGAGGGG - Intronic
1073144051 10:101267730-101267752 GGAGGTAAGCAAGGCCGCAGAGG + Intergenic
1073608177 10:104916490-104916512 AGAGGAAAGCAGAGAAGCAGAGG - Intronic
1074852640 10:117451079-117451101 CCAGGAGAGGAGGGCCGCAATGG + Intergenic
1076802283 10:132836123-132836145 GGAGGTGAGCAGGGCTGCAGGGG - Exonic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1077288784 11:1779338-1779360 TGGGGAAGGCAGGGCCCCAGGGG + Intergenic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1077463629 11:2723123-2723145 AGAGGAAGGCAGAGCCACAGAGG - Intronic
1078707797 11:13761973-13761995 GGTGGAAAGCAGGTCTGCAGGGG - Intergenic
1079248741 11:18772188-18772210 AGAGGCAAGCAGGGCACCAGGGG - Intronic
1081492501 11:43579282-43579304 GGAGGAAGGCAGGAACGCAGGGG + Intronic
1082055224 11:47809177-47809199 CCAGGAAATCAAGGCTGCAGTGG + Intronic
1084007756 11:66332281-66332303 AGAGGGAAGCCGGGCAGCAGAGG - Exonic
1084151244 11:67289004-67289026 AGAGGAAGGCGGGGCCGGAGGGG - Intronic
1085120698 11:73965595-73965617 TGTGGAAAGCATGGCCGCATCGG - Intronic
1085464526 11:76714905-76714927 CGAGGAAGGCAGGGCTGTAGAGG - Intergenic
1086009179 11:82078249-82078271 CAAGGAAAGCAGGGAAGGAGAGG + Intergenic
1088397703 11:109386817-109386839 AGAATAAAGCAGGGCTGCAGGGG + Intergenic
1090231675 11:125111515-125111537 TGAGGAAAGCGGGGCGGCTGCGG - Intronic
1090385410 11:126355475-126355497 AGAGGCAAGCAGGGGCGCCGTGG - Intergenic
1090908001 11:131094319-131094341 TGAGGAAAGAAGAGACGCAGGGG - Intergenic
1091998008 12:5010327-5010349 CGAGGAAGGCAGGGTGGCTGGGG - Intergenic
1092475513 12:8815659-8815681 CAAGGAAAACAAGACCGCAGTGG + Intergenic
1094174085 12:27524127-27524149 GGAGGAGAGAAGGGCGGCAGTGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096546645 12:52344723-52344745 CAAGGACAGCAGGGCTGGAGAGG + Intergenic
1101833334 12:108276461-108276483 AGAGGGAAGCAGGGACCCAGAGG + Intergenic
1101890598 12:108711293-108711315 CCAGGAAATCAAGGCTGCAGTGG + Intronic
1103399974 12:120637215-120637237 AGAGGAAAGCAGGAAAGCAGGGG - Intergenic
1104386107 12:128352962-128352984 GGAGGGAAGCAGGGTCTCAGGGG + Intronic
1106868717 13:33995819-33995841 TGAGGAAATCAAGGCCCCAGAGG - Intergenic
1106935854 13:34718656-34718678 GGAGGAAGGGAGGGCAGCAGGGG + Intergenic
1107386102 13:39911181-39911203 GGAGAAAAGCAGGGCTGGAGGGG + Intergenic
1113647978 13:112012285-112012307 CGGGGAACGCAGGGAGGCAGTGG - Intergenic
1118776359 14:68976767-68976789 CTAGGAAACCAGGGCCAGAGAGG - Intronic
1121016337 14:90551586-90551608 AGAGGGAAGCAGGGTGGCAGCGG + Intronic
1122463560 14:101915971-101915993 AGAGAAAAGCAGGGACACAGTGG + Intronic
1122838204 14:104441643-104441665 GGAGGACAGCAGGACAGCAGTGG + Intergenic
1125521280 15:40349078-40349100 GGAGGAAAGCAGGGGCTGAGAGG - Intergenic
1127449821 15:59105453-59105475 CGGGGAAAGGCGGGCCGGAGAGG - Intronic
1129110774 15:73335841-73335863 CCAGGAAAGAAGGGCCCCACTGG - Intronic
1130157209 15:81361976-81361998 AGAGAACAGCAGAGCCGCAGCGG + Intronic
1132483547 16:178208-178230 AGAGGAGAGCGGGGCCACAGAGG + Intergenic
1132668662 16:1093961-1093983 CGGGGCCTGCAGGGCCGCAGAGG - Exonic
1132732053 16:1367475-1367497 GGAGGGAGGGAGGGCCGCAGGGG - Intronic
1133756973 16:8769095-8769117 AGAGGGAAGCAGGGACACAGAGG + Intronic
1134070343 16:11256339-11256361 AGAGGGAAACAGGGCCGAAGCGG - Intronic
1135135724 16:19884523-19884545 CGACGAGAGCAGAGCCGTAGAGG - Intronic
1136776026 16:32872374-32872396 CTAGGAAAGAAGGCCAGCAGTGG - Intergenic
1136894589 16:33989138-33989160 CTAGGAAAGAAGGCCAGCAGTGG + Intergenic
1139408681 16:66740676-66740698 AGAGAAATGCAGGGCTGCAGGGG - Intronic
1139597333 16:67966124-67966146 AGAGGAAACCAAGGCCGCACAGG - Intronic
1139653216 16:68372927-68372949 TGTGGCCAGCAGGGCCGCAGGGG + Intronic
1139822025 16:69728184-69728206 CCAGGAATTCAAGGCCGCAGTGG + Intergenic
1203078442 16_KI270728v1_random:1134483-1134505 CTAGGAAAGAAGGCCAGCAGTGG - Intergenic
1142892997 17:2957309-2957331 CGGTGAAAGCAGGGTCGCTGTGG - Intronic
1143631187 17:8141216-8141238 GGAGGCGAGCAGGGCAGCAGCGG - Exonic
1146903340 17:36602037-36602059 CGGGTAAAGCTGGGCTGCAGGGG + Exonic
1147833802 17:43315632-43315654 CGAGCAGAGCTGGACCGCAGCGG + Intergenic
1147881958 17:43660086-43660108 GGAGGAAAACAGGGCAGCACGGG + Intronic
1151418569 17:73982759-73982781 CCAGGAAACCAGGGTCACAGAGG - Intergenic
1151698013 17:75727874-75727896 GGAGGACAGCAGGGCAGGAGGGG + Intronic
1152587926 17:81197384-81197406 AGAGGACAGCAGGGCTCCAGAGG + Intronic
1152835600 17:82528690-82528712 CGAGGAAAGCAGGGCCGCAGGGG - Intronic
1153382431 18:4454748-4454770 CGAGGACCGCATGGCCGGAGAGG + Intronic
1153522571 18:5966479-5966501 AGAGGAAAGAAGAGCCGCAAAGG - Intronic
1153635139 18:7106970-7106992 CGAGGAAAGCGGGGGAGGAGGGG - Intronic
1153636653 18:7118127-7118149 CGGGGACTGCAGGGCCGCGGCGG - Intergenic
1154966757 18:21366265-21366287 AGAGGAAAGCAGGGAAGGAGAGG - Intronic
1156816653 18:41319663-41319685 CAAGGAAAGCAGGCCATCAGAGG + Intergenic
1157686125 18:49644283-49644305 CTAGGATAACAGGGCTGCAGGGG + Intergenic
1158544441 18:58384059-58384081 CGAGGAACTCAGGGCCACTGTGG - Intronic
1158856675 18:61549898-61549920 TGAGGAAAGCAAGGGGGCAGGGG - Intronic
1158908032 18:62033042-62033064 CAAGGGAAGCTGGGCCACAGAGG + Intergenic
1160404210 18:78634106-78634128 TGAGGAAAGCAAGGCAGAAGCGG - Intergenic
1160766992 19:813136-813158 CGAGAAGAGCGGGGCGGCAGTGG - Exonic
1161774688 19:6253646-6253668 CCAGGAATGCAAGGCGGCAGGGG + Intronic
1165096191 19:33411190-33411212 TGCTGAACGCAGGGCCGCAGAGG + Intronic
1166052249 19:40267272-40267294 CCTGGAACGCAGGGCAGCAGAGG - Intronic
926104517 2:10141984-10142006 CAAGGAAAGCAGGGAGGAAGGGG + Intronic
927052917 2:19348071-19348093 AGAGGAGGGCGGGGCCGCAGTGG + Intergenic
930847544 2:55922526-55922548 CGAGGAAAGGAGGGTGGGAGAGG + Intronic
933946011 2:87286712-87286734 AGAGGAAAGCAGGAAAGCAGCGG + Intergenic
935698544 2:105790531-105790553 CTAGGAAACCAGGGCTCCAGAGG - Intronic
936334200 2:111574874-111574896 AGAGGAAAGCAGGAAAGCAGCGG - Intergenic
937010147 2:118555552-118555574 AGAGGAAAGAAGGCCCTCAGGGG + Intergenic
937132120 2:119521806-119521828 GAAGGAAAGCAGGGCTCCAGAGG + Intronic
937368915 2:121284708-121284730 GGGGGAGAGGAGGGCCGCAGGGG + Intronic
937907025 2:127057439-127057461 AGAGGAGAGCTGGGCCGCGGCGG + Intronic
938315925 2:130327946-130327968 CGCGGAGTGCAGGGCAGCAGAGG - Intergenic
943779886 2:191811853-191811875 CAAGGAAAGCAAAGCCCCAGCGG - Intergenic
948405809 2:237718093-237718115 CGAGGAGATCAGGGCGGCTGTGG - Intronic
948619516 2:239225595-239225617 CGGGGAAGGCAGGTCGGCAGGGG + Intronic
1168856500 20:1012892-1012914 GGAGGGAAGCAGGGCAGGAGTGG + Intergenic
1170369444 20:15632800-15632822 GGAGGAAAGGAGGACAGCAGGGG - Intronic
1171329349 20:24324006-24324028 GGAGGAAAACAGGGCAGAAGAGG - Intergenic
1171366658 20:24629474-24629496 AGAGGAAAGGAGGGAGGCAGAGG + Intronic
1172021583 20:31918444-31918466 CCAGGAGATCAGGGCTGCAGTGG - Intronic
1172635127 20:36405143-36405165 CCAGGGAAGCAGGGCAGCCGGGG + Intronic
1176053806 20:63134472-63134494 AGAGGGAAGCAGGGCCATAGAGG + Intergenic
1179922966 21:44517031-44517053 CGAGGAAGGCAGAGACACAGGGG - Intronic
1181658272 22:24319101-24319123 GGAAGAAAGCAGAGCAGCAGAGG - Intronic
1183737260 22:39650898-39650920 TGAGGAGAGCAGGGCCTCTGTGG + Intronic
1183883383 22:40856378-40856400 CGGGGGAAGCACGGCCCCAGGGG - Intronic
1184595561 22:45512030-45512052 AGAGAGAAGCAGGGCCTCAGGGG - Intronic
1185063392 22:48618793-48618815 CGAAGAAAGGAGAGCCTCAGAGG - Intronic
1185334326 22:50264871-50264893 CGAGGAAACCAGGCCAGCTGTGG + Exonic
950127435 3:10518617-10518639 TGAGGTCAGCACGGCCGCAGCGG - Intronic
950434469 3:12970479-12970501 GGAGGAAAGCAGGGAGGCTGTGG - Intronic
952222937 3:31342589-31342611 ATAGGAAAGCAGGGGAGCAGGGG + Intergenic
954443149 3:50532717-50532739 TGAGGAAAGCAGAGCTGGAGGGG + Intergenic
954870588 3:53764685-53764707 TGAGCAAAGCTGGGCCACAGGGG - Intronic
959587553 3:108039303-108039325 CGAGGAGAGCAGGGCTGTGGTGG - Intergenic
961562987 3:127743739-127743761 CGAGAAAAGCAGAGCCCCTGTGG - Intronic
969462857 4:7337938-7337960 AGAGGGCAGCAGGTCCGCAGAGG - Intronic
970967793 4:21948518-21948540 CGAGGGAAGGAGGGCGGAAGCGG + Intronic
971382955 4:26116588-26116610 CTAGGAATCCAGGGCTGCAGAGG - Intergenic
972192316 4:36609828-36609850 CTAGGAGAGAAGGGCAGCAGTGG + Intergenic
972987223 4:44779411-44779433 TGAGGAAAGCAGTGACACAGAGG - Intergenic
976950347 4:90821044-90821066 GGGGGAAATAAGGGCCGCAGAGG + Intronic
981614561 4:146633539-146633561 AGAGGAAAGCAGCCCGGCAGAGG - Intergenic
983175813 4:164586476-164586498 CCAGGCAAACAGGGTCGCAGTGG + Intergenic
984952616 4:185018487-185018509 CGCGGAGCGCAGGGGCGCAGCGG - Intergenic
986315356 5:6583197-6583219 CGGGGAACGCGGGGCCGCGGGGG + Intergenic
988621978 5:32832368-32832390 CGTGGCAAGCAGGGTCCCAGTGG + Intergenic
989379290 5:40797957-40797979 CCTGGAAAGAAGGGACGCAGCGG + Intronic
990323727 5:54653960-54653982 CAAGGAAAGCAGGGATGCAACGG - Intergenic
991977270 5:72195713-72195735 GAAGGAAGGCAAGGCCGCAGAGG + Exonic
995254459 5:110030486-110030508 GGAGGAAAGCAGGTCAGCAATGG - Intergenic
996088331 5:119326426-119326448 TGAGGAAAGCAGGTGAGCAGAGG + Intronic
998370182 5:141655807-141655829 GGAGGACAGCTGGGCCCCAGGGG + Intronic
999508526 5:152223613-152223635 CAAGGAAAGCAAGGCAGAAGTGG - Intergenic
1001081598 5:168671522-168671544 TGAGGACAGCAGGGTGGCAGGGG - Intronic
1001083456 5:168683745-168683767 AGAGGAAGGCAGGCCCGCAGAGG - Intronic
1001292192 5:170471639-170471661 CAAGCAAAGCAGGGAAGCAGCGG + Intronic
1001809847 5:174619294-174619316 AGAGGAAAGCAGGCAGGCAGGGG - Intergenic
1005740460 6:28786110-28786132 GGAGGGAAGCAGGGACGCGGTGG + Intergenic
1005743444 6:28814255-28814277 AGAGGGAAGCAGGGACGCGGTGG + Intergenic
1006078691 6:31551380-31551402 TGAGGAAAGCAGGGCCCAAAAGG + Intronic
1007409777 6:41654875-41654897 TGAGGATCGCAGGGCCGCACTGG + Intergenic
1007713469 6:43839221-43839243 TTAGGACAGCAGGGCCCCAGGGG + Intergenic
1007902508 6:45423749-45423771 GGAGGAAGGCGGGGCCGCTGGGG + Intronic
1007989262 6:46238201-46238223 TGAGGAAAGCTGGGAGGCAGGGG + Intronic
1009462597 6:63932587-63932609 CTAGGAAAGCAAAGCAGCAGTGG - Intronic
1009995654 6:70892616-70892638 CCAGGAAAGGAGGGCTGCACTGG + Intronic
1013286463 6:108686290-108686312 AGAGGAAAGCAGAGCTGGAGTGG - Intergenic
1014855503 6:126396278-126396300 TGTGGAAAGCAGGGTGGCAGGGG - Intergenic
1017024985 6:150173733-150173755 CTAGGAATGGAGGCCCGCAGAGG + Intronic
1019064951 6:169288757-169288779 CGAGGAGAGCAGTGACTCAGGGG - Intergenic
1019319526 7:409287-409309 CTGGGAAAGCCGGGCCTCAGTGG - Intergenic
1019446127 7:1072239-1072261 CGAGAGAAGAAGGGCAGCAGAGG - Intronic
1019632607 7:2057949-2057971 GGAGAGAAGCAGGGCCGGAGAGG + Intronic
1019632903 7:2059122-2059144 CGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019716279 7:2540934-2540956 CGAGGAGAGGAGGGAGGCAGAGG - Intronic
1022101741 7:27173330-27173352 CTGGGTAAGCAGGGCTGCAGAGG - Exonic
1022535833 7:31097731-31097753 TAAAGAAAGCAGGGCTGCAGAGG + Intronic
1023839549 7:44088641-44088663 GGAGGAAACCAGGGCAGCAGGGG - Intergenic
1023846542 7:44123923-44123945 CGGGGAAAGCTGGGACGCTGGGG - Intronic
1024199145 7:47088796-47088818 CGAGGAGAGCTGGGCTTCAGAGG + Intergenic
1024964051 7:55005718-55005740 CGAGGGAAAAAGGGCCGCACGGG - Intergenic
1029120086 7:98261932-98261954 GGAGGAAAGCATGGCTTCAGGGG - Intronic
1030367453 7:108661555-108661577 CTAAGACAGCAGGGCCACAGAGG - Intergenic
1034162604 7:149004214-149004236 CAAGGAAAGCAAGGCGGGAGGGG + Intronic
1034163908 7:149011651-149011673 CGAGGCCAGGAGGGCCACAGGGG + Intronic
1034309229 7:150072162-150072184 CCAGGAAAGCAGGGACCCACAGG + Intergenic
1034797628 7:154028474-154028496 CCAGGAAAGCAGGGACCCACAGG - Intronic
1035271496 7:157722618-157722640 CGAGGAATGGAGGGCCGCCCAGG - Intronic
1035388132 7:158488396-158488418 AGAGGAGAGCAGGTCCTCAGCGG - Intronic
1039465642 8:37783410-37783432 TGAGGGAAGCAGGGCAGGAGAGG + Intergenic
1040311129 8:46237399-46237421 GGAGGAAGGCAGGGACTCAGGGG + Intergenic
1040525277 8:48217485-48217507 CGAGGAGTGCAGGCCCCCAGTGG - Intergenic
1042159050 8:65873761-65873783 AGAGGAAAGCAGGGAAGAAGGGG - Intergenic
1046951478 8:120023903-120023925 GGAGGAAAGAAGGGAAGCAGAGG + Intronic
1049040631 8:140110088-140110110 AGTGGAGAGTAGGGCCGCAGTGG + Intronic
1049654480 8:143791687-143791709 GGAAGAAGGCAGGGCCGCAAAGG + Exonic
1049658328 8:143808671-143808693 GGAGGAAAACAGGGCTGAAGAGG - Exonic
1049705254 8:144039256-144039278 CAAGGAAAGCAGGCTCTCAGGGG + Intronic
1053295106 9:36907087-36907109 CAAGGGAAGCAGGACCGTAGAGG + Intronic
1057186694 9:93061134-93061156 CCAGGAAAGCAGGGTTCCAGTGG + Intronic
1057294439 9:93827158-93827180 TGAGGGAGGCGGGGCCGCAGGGG + Intergenic
1057674566 9:97128719-97128741 TGAGGAAGGCATAGCCGCAGGGG - Intergenic
1059746370 9:117205628-117205650 CAAGGAAAGATGGGCCTCAGAGG + Intronic
1060930889 9:127488921-127488943 CGAGGGAAGAAGGGAGGCAGCGG - Intronic
1061450242 9:130663746-130663768 CGGGGAGTGCAGGGCCGGAGAGG + Intergenic
1062176995 9:135168897-135168919 CATGGCAAGCAGGGCAGCAGTGG + Intergenic
1062324949 9:136008324-136008346 AGAGGAAGGCAGGGCAGGAGAGG + Exonic
1062615785 9:137395104-137395126 CGAGGACAACAAGGCCACAGTGG + Intronic
1185512741 X:675698-675720 AGGGGAAGGCAGGGACGCAGGGG - Intergenic
1190135492 X:47792911-47792933 CCAGGAAGGCAAGGCTGCAGTGG - Intergenic
1192585804 X:72317371-72317393 TGAGGAAAACAGGGCCAAAGAGG - Intergenic
1196355057 X:114781573-114781595 CGAGGACATCAAGGCTGCAGTGG - Intronic
1198310205 X:135422448-135422470 GAAGGAAAGCTGGGCCGCGGCGG + Intergenic
1199881035 X:151974471-151974493 CGAGGAACGCGGGGCCGCTGGGG + Intronic
1200103852 X:153701663-153701685 CTAGGAAAGAAGGCCAGCAGTGG + Intronic
1200383920 X:155869696-155869718 CGAGCAAGGGAGGGCAGCAGGGG - Intergenic