ID: 1152841418

View in Genome Browser
Species Human (GRCh38)
Location 17:82571085-82571107
Sequence GGGTGGGTAAGGCTGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 461}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152841418_1152841426 -4 Left 1152841418 17:82571085-82571107 CCCTCAGCCAGCCTTACCCACCC 0: 1
1: 0
2: 1
3: 26
4: 461
Right 1152841426 17:82571104-82571126 ACCCCTCGCCTGTACCCCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 106
1152841418_1152841424 -6 Left 1152841418 17:82571085-82571107 CCCTCAGCCAGCCTTACCCACCC 0: 1
1: 0
2: 1
3: 26
4: 461
Right 1152841424 17:82571102-82571124 CCACCCCTCGCCTGTACCCCTGG 0: 1
1: 0
2: 1
3: 23
4: 223
1152841418_1152841436 19 Left 1152841418 17:82571085-82571107 CCCTCAGCCAGCCTTACCCACCC 0: 1
1: 0
2: 1
3: 26
4: 461
Right 1152841436 17:82571127-82571149 TAGCTGACAGGATCTGGTCGTGG 0: 1
1: 0
2: 0
3: 5
4: 55
1152841418_1152841437 25 Left 1152841418 17:82571085-82571107 CCCTCAGCCAGCCTTACCCACCC 0: 1
1: 0
2: 1
3: 26
4: 461
Right 1152841437 17:82571133-82571155 ACAGGATCTGGTCGTGGTTGAGG 0: 1
1: 0
2: 1
3: 5
4: 142
1152841418_1152841425 -5 Left 1152841418 17:82571085-82571107 CCCTCAGCCAGCCTTACCCACCC 0: 1
1: 0
2: 1
3: 26
4: 461
Right 1152841425 17:82571103-82571125 CACCCCTCGCCTGTACCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 150
1152841418_1152841431 7 Left 1152841418 17:82571085-82571107 CCCTCAGCCAGCCTTACCCACCC 0: 1
1: 0
2: 1
3: 26
4: 461
Right 1152841431 17:82571115-82571137 GTACCCCTGGGGTAGCTGACAGG 0: 1
1: 0
2: 0
3: 10
4: 79
1152841418_1152841435 13 Left 1152841418 17:82571085-82571107 CCCTCAGCCAGCCTTACCCACCC 0: 1
1: 0
2: 1
3: 26
4: 461
Right 1152841435 17:82571121-82571143 CTGGGGTAGCTGACAGGATCTGG 0: 1
1: 0
2: 0
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152841418 Original CRISPR GGGTGGGTAAGGCTGGCTGA GGG (reversed) Intronic
900276384 1:1831817-1831839 GGGAGGCTGAGGCTGGCAGATGG + Intronic
900422588 1:2562039-2562061 GCGTGGGCAGGGGTGGCTGAGGG - Intronic
900743492 1:4344484-4344506 GGGTGGAGAGGGCTGCCTGATGG + Intergenic
901004028 1:6163042-6163064 GGGAGAGTAGGGCTGGCAGAAGG + Intronic
901035112 1:6331785-6331807 AGGTGGGTGTGGCTGGCTGCCGG - Intronic
901101321 1:6721299-6721321 GGGTGGCCAAGGCAGGCGGATGG - Intergenic
901663978 1:10816056-10816078 GGCAGGGTCAGGCTGGCTGCTGG + Intergenic
902362946 1:15951955-15951977 GGGTGGGGCAGGCTGCCTGGTGG - Intronic
902649847 1:17829898-17829920 GGCTGGGTGGGGCTGGCAGAGGG + Intergenic
903320355 1:22539293-22539315 GGGTGGGAAAGGCTGGCAGAGGG - Intergenic
903424775 1:23245586-23245608 CGGTGGGTTGGGCTGGGTGAGGG + Intergenic
903774392 1:25783401-25783423 GGGCAGGTGAAGCTGGCTGATGG + Intronic
903878848 1:26494949-26494971 GGGAGGCTGAGGCTGGCGGATGG + Intergenic
904006395 1:27365616-27365638 GGGCGGGAAAGGATGGCTCAGGG - Intronic
904121007 1:28197799-28197821 GGGTAGGGAAGGCTTGCTGGAGG - Intergenic
904300550 1:29550810-29550832 GGGCGAGTAAGGCTGGGGGAGGG - Intergenic
904373153 1:30063447-30063469 GGGTGGAGAAGGCTGTGTGAAGG - Intergenic
904457656 1:30657234-30657256 GGGCGAGTAAGGCTGGGGGAGGG + Intergenic
904688162 1:32275224-32275246 GGTTGGGGGAGGCTGGCTTAAGG + Intronic
904919185 1:33993546-33993568 GAGAGGGAGAGGCTGGCTGAGGG - Intronic
906521352 1:46468874-46468896 GGGGGGGTGAGGCTGCCTGGTGG - Intergenic
907157335 1:52346368-52346390 GGGTGGGAAAGGGTGGTTGGGGG + Exonic
907441292 1:54480273-54480295 GGGTGGGGAAGGCTGTCTGGTGG - Intergenic
909036707 1:70601342-70601364 GGATTGGGAAGGCTGACTGAGGG + Intergenic
910941453 1:92539436-92539458 GGGAGGGTGAGGCTGGAGGATGG + Intronic
912690958 1:111804356-111804378 GTGTGGGGAAGGCTGACAGATGG - Intronic
912933375 1:113983148-113983170 GCAGGGGCAAGGCTGGCTGATGG + Intergenic
913325426 1:117624004-117624026 GGTAGGGTAAGGCTGGCTGTAGG - Exonic
915610364 1:156986950-156986972 AGGTGCCTCAGGCTGGCTGAGGG - Intronic
915704937 1:157834697-157834719 GAGGGTGTCAGGCTGGCTGACGG - Exonic
915955175 1:160214863-160214885 GGGAGGGGAGGGCTGGCTGCTGG + Exonic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
918217848 1:182408715-182408737 GGGTGGGTAAGGGTGGAGGGTGG - Intergenic
919728896 1:200900622-200900644 GGGTGGGGCAGGCTGGCCCATGG - Intronic
920171944 1:204077401-204077423 GGGAGGGAAATGGTGGCTGAGGG + Intronic
920543017 1:206793491-206793513 GGGTGAGTCAGGCCGGCTGGGGG - Intergenic
921094384 1:211874361-211874383 GGGTGGGGAGGGCTGGTTGGGGG + Intergenic
921173115 1:212566514-212566536 GGTGGGGTAAGGCAGGCTGAGGG + Intronic
921339642 1:214121980-214122002 TAGTGGGGAAAGCTGGCTGAAGG + Intergenic
922751821 1:228073641-228073663 GGGAGGGCAAGGCTGGCTGTGGG - Intergenic
923095305 1:230770739-230770761 GAGTGGGCAAGGCAGGCTGCTGG - Intronic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
923170248 1:231409539-231409561 GGATTGGTAAGCCTGTCTGATGG - Intronic
923663305 1:235977610-235977632 GGGTGTATAAGTCTGTCTGAGGG + Exonic
1063074016 10:2696303-2696325 GGGTTGGTGAGGGTGGCTGGAGG - Intergenic
1065366636 10:24943789-24943811 GGGAGGCTAAGGCAGGCGGATGG - Intronic
1065484856 10:26227803-26227825 CGGTGTGAAAGGCTGGCTGTAGG - Intronic
1066384657 10:34931941-34931963 GGGAGGCTGAGGCGGGCTGAGGG + Intergenic
1066438072 10:35412472-35412494 GGGTGGGAAGGGCTGGCAGCAGG + Intronic
1066502478 10:36007569-36007591 GGGTGGGGAGGAGTGGCTGAGGG + Intergenic
1067131145 10:43566523-43566545 GGGAGGCTAAGGCGGGCAGATGG - Intronic
1067221717 10:44348658-44348680 GGGTGGGTGAGGCTGGCCCAGGG + Intergenic
1067681636 10:48445465-48445487 GGGTGGGAAAGGCTTTCTGGAGG + Intergenic
1070281166 10:75049901-75049923 GGGTGGGTGGGGCAGGCTGCAGG + Intronic
1070427868 10:76307107-76307129 GGGTGGGCAAGGGTAGCTGCTGG - Intronic
1071669873 10:87598357-87598379 GGGAGGCTAAGGCGGGCAGATGG + Intergenic
1072451325 10:95541663-95541685 GGGTGGGTAAGACTGGTTTCTGG - Intronic
1073036331 10:100566609-100566631 GTGGGGGTGAGGCAGGCTGAGGG + Intergenic
1073051320 10:100669341-100669363 GGGTGGGTGGGGCTGCATGAGGG - Intergenic
1073176282 10:101559561-101559583 GGGAGGGTTGGGCTGGCTGGTGG - Intergenic
1074504379 10:114055283-114055305 GGGAGGCTGAGGCAGGCTGAAGG - Intergenic
1075388514 10:122075337-122075359 GGATGGGGAAGGCTGGCCCAGGG + Intronic
1075531775 10:123236068-123236090 GGGAGGGTTTGGCTGGCTCAAGG + Intergenic
1075792270 10:125093582-125093604 GGGTGGGGCAGCCTGGGTGATGG - Intronic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1077426455 11:2481484-2481506 GGTTGGGGACGCCTGGCTGATGG - Intronic
1080276251 11:30506281-30506303 GGGAGGCTGAGGCGGGCTGAGGG - Intronic
1081326026 11:41745463-41745485 GGGTGCCTAAGGCTGGGAGATGG + Intergenic
1081676392 11:44972474-44972496 GGGATGGTGAGGCTGGCTGGCGG - Intergenic
1084366853 11:68707027-68707049 TGGGGTGTACGGCTGGCTGAGGG + Intergenic
1084467288 11:69333316-69333338 GGCTGGGGAAGGCTGCCTGGAGG - Intronic
1084936006 11:72586974-72586996 AGGTGGGTGGGGCTAGCTGAGGG - Intronic
1086220609 11:84438206-84438228 TTGTGGATAAGGCTGGCTGGTGG - Intronic
1086376244 11:86203756-86203778 GGGAGGCTAAGGCTGGCAGATGG + Intergenic
1087381595 11:97409992-97410014 GGGTGGGTAAGCCTGGCACCTGG - Intergenic
1088834688 11:113567844-113567866 TGGCGGGAAAGGCTGGCAGATGG + Intergenic
1088982596 11:114876871-114876893 GGCTGGGTAGGGGTGGCTTAGGG + Intergenic
1089588120 11:119522780-119522802 GAGTGGGTGAGGCTGGCTCCTGG + Intergenic
1089612910 11:119679576-119679598 TGGTGGGAAAGTGTGGCTGATGG - Intronic
1089756230 11:120689439-120689461 GGGTGGGTATGGCTGGATCATGG - Intronic
1089972923 11:122709005-122709027 GGGAGGCTGAGGCTGGCAGATGG + Intronic
1090057103 11:123432739-123432761 GGGTGCATAAGACTGGCTGAAGG + Intronic
1090902774 11:131047163-131047185 GGGTGGGTAGGAGAGGCTGAGGG + Intergenic
1091252880 11:134158409-134158431 GGGTGTGCAGGGCTGGCTCACGG + Exonic
1091589821 12:1836447-1836469 GGGTGGGTGAGGTGGGCTGGGGG + Exonic
1092218105 12:6696321-6696343 GGGTGGGAAATGCTGGATGAAGG - Intronic
1092491372 12:8949022-8949044 GTGTGGATAAGAATGGCTGATGG - Intronic
1096037956 12:48489654-48489676 GGGAGGCCAAGGCTGGCAGATGG - Intronic
1096389737 12:51218704-51218726 GGGTGGATGTGGGTGGCTGAGGG + Intergenic
1096513973 12:52146400-52146422 GGTTGGGTGAGGCTGGGTCAGGG + Intergenic
1100282095 12:93127798-93127820 AGGTGGCTAAGGCTGCTTGATGG - Intergenic
1101443704 12:104722240-104722262 GGGAGGCTAAGGCGGGCAGATGG - Intronic
1101715602 12:107309328-107309350 GGGTGGCTGAGGCTGCCTGCTGG + Intergenic
1102341999 12:112128795-112128817 GGGAGGCTGAGGCTGGCTGGTGG + Intronic
1102959805 12:117085134-117085156 GGGTGGACAGGGCTGGCAGAAGG + Intronic
1103202132 12:119096420-119096442 GGGATGGTAATGCTGGCTCATGG + Intronic
1103487212 12:121291158-121291180 GGGTAGGTAAGGGTGCATGAAGG + Intronic
1103724606 12:122991427-122991449 GGGTGGGCCCGGCTGGCTCAAGG + Intronic
1104795586 12:131514875-131514897 GCGTGGGGAAGGCTGGCTCGGGG - Intergenic
1106086485 13:26546897-26546919 AAGAGGGTAAGGGTGGCTGAAGG - Intergenic
1106792637 13:33171202-33171224 GGGTGGGTAAGGGTAGCAAATGG - Intronic
1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG + Intronic
1107910162 13:45098338-45098360 GGGAGGGCAAGGCAGGCAGACGG + Intergenic
1108405182 13:50093861-50093883 GGGTAGGTATTTCTGGCTGATGG - Intronic
1108704769 13:52974977-52974999 GGATGGCCAAGGCTGGCTGCTGG + Intergenic
1110247368 13:73342055-73342077 GGGTGGGAAAGGATGGGGGAGGG - Intergenic
1111921845 13:94420630-94420652 GGGAGGATAATGCTGGCGGAAGG + Intergenic
1112654069 13:101430082-101430104 GGATGGGTGAGGCAGGCTCACGG - Intergenic
1113444483 13:110355219-110355241 GGCTGGCAGAGGCTGGCTGAGGG + Intronic
1113966494 13:114156012-114156034 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113966577 13:114156212-114156234 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113966596 13:114156249-114156271 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113966621 13:114156308-114156330 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113966640 13:114156345-114156367 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1113966656 13:114156379-114156401 GGGTGGGGAAGGGTGGGTGCTGG + Intergenic
1115681245 14:35740701-35740723 GGGTGGCTGAGGCTGGATGATGG + Intronic
1115776399 14:36720060-36720082 GGGTGGGCCTGGCTGGCAGAGGG - Intronic
1116829690 14:49706103-49706125 GGGTGGGTAGGGATGGCTAATGG - Intronic
1116844789 14:49855204-49855226 GGGAGGCCAAGGCTGGCAGATGG + Intergenic
1117414169 14:55478458-55478480 GGGAGGGTAAGGCTGGAGAATGG + Intergenic
1118157437 14:63255566-63255588 GGGAGGGTAAGGCTGGGGGGAGG - Intronic
1118368244 14:65113887-65113909 GGGAAGGTAAGGCTGGTGGAGGG - Intergenic
1119281179 14:73409425-73409447 TGGTGGTTAAAGCTGGCTGTTGG - Intronic
1119570469 14:75666612-75666634 AGCTGGGGAAGGCTGCCTGAAGG + Intronic
1121117716 14:91355279-91355301 GGAAGGATAAGGATGGCTGAGGG + Intronic
1121120274 14:91371948-91371970 GGGTGGGAAAGGCAGGCAGTGGG + Intronic
1121230519 14:92354253-92354275 GGGTGGGTAAGGCAGGAGAATGG - Intronic
1121563000 14:94888007-94888029 AGGTGGGGAAGGCAGGGTGATGG - Intergenic
1122214971 14:100197138-100197160 GGGAGGCTAAGGCAGGATGATGG + Intergenic
1122234379 14:100323591-100323613 GGGAGGCTAAGGCTGGGTGAGGG + Intronic
1122429283 14:101629769-101629791 GTGTGGGTGTGGCTGGCTCAAGG - Intergenic
1122634490 14:103123672-103123694 GAGGGGCCAAGGCTGGCTGAGGG + Exonic
1123673954 15:22690065-22690087 GGGTGGGAAAGGGTGGTTGGGGG - Intergenic
1124099061 15:26676334-26676356 GGGGGTGGAAGGCTGGCTCAGGG + Intronic
1124325959 15:28763053-28763075 GGGTGGGAAAGGGTGGTTGGGGG - Intergenic
1124883307 15:33661541-33661563 TGGTGGGTGAGGCTGGGGGAGGG + Intronic
1124945983 15:34266669-34266691 GGGAGGTTGAGGCAGGCTGATGG - Intronic
1126110628 15:45172812-45172834 GGGAGGGACAGGCTGGCTGGTGG - Intronic
1126402960 15:48293146-48293168 GGGAGGATAAGGCGGGCAGATGG - Intronic
1126876257 15:53045048-53045070 AGGTGGGAAGGGCTGACTGATGG - Intergenic
1127338912 15:58020625-58020647 GGGTGGGTCAAGCTGGAGGACGG - Intronic
1127365425 15:58284782-58284804 GGCTGGGGAAGGCTGGATGGAGG + Intronic
1127655431 15:61051154-61051176 GGGTGTGGAAGGATGGCAGAAGG + Intronic
1127926184 15:63545728-63545750 GGGAGGCTAAGGCGGGCGGATGG + Intronic
1128363448 15:66979544-66979566 GGAAGGGGAAGGCTGGGTGATGG - Intergenic
1129359016 15:75012824-75012846 GGGTGGGCCAGGGTGGCTGGAGG + Intronic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1131203250 15:90418905-90418927 GGGAGGGTAAGGCAGGTGGATGG + Intronic
1134164022 16:11915789-11915811 GAGTGGGCAACGCTGACTGAGGG + Exonic
1135290752 16:21235872-21235894 GACTGGAGAAGGCTGGCTGATGG - Intronic
1135970866 16:27070965-27070987 GGGAGGCTAAGGCGGGCTGGGGG - Intergenic
1136067908 16:27771069-27771091 GGGTGGGGCAGGCTGCCTCAGGG - Intronic
1136136627 16:28260292-28260314 GGGTGGGGAGAGCTGGCTAAAGG - Intergenic
1136453593 16:30368712-30368734 AGGTGGGGAAGTCTGGCTGATGG - Intronic
1137424640 16:48367137-48367159 GGGAGGCCAAGGCAGGCTGATGG - Intronic
1137578689 16:49620777-49620799 GGGTGGGGATGGCTGGATAAGGG - Intronic
1137602557 16:49766481-49766503 GCGTGGGTGAGGATGTCTGAAGG - Intronic
1137903084 16:52290242-52290264 GTTGGGGCAAGGCTGGCTGAAGG + Intergenic
1137948410 16:52758106-52758128 GGATGGGTACTGATGGCTGAGGG - Intergenic
1138205794 16:55124158-55124180 GGCTGGGTGATGCTGGCTGTTGG + Intergenic
1138660033 16:58511424-58511446 AGGCGGGTCATGCTGGCTGAGGG - Exonic
1139405623 16:66715344-66715366 GGATGAGGAAGGCTGGTTGATGG + Intergenic
1139565238 16:67771021-67771043 GGGAGGCCAAGGCAGGCTGATGG + Intronic
1139673760 16:68509246-68509268 GGGAGGCCAAGGCTGGCAGATGG - Intergenic
1139827113 16:69766128-69766150 AGATGGGGAAGGCTGTCTGAGGG - Intronic
1140056996 16:71534094-71534116 GGGTGTGTCAGGCTGGCTGCAGG + Intronic
1141244264 16:82291642-82291664 GGGAGGGTGAGGCGGGCAGATGG - Intergenic
1142010223 16:87710049-87710071 GGCTGGGGAAGCCAGGCTGAGGG + Intronic
1142225505 16:88875337-88875359 GGGTGGGCAGGGCTGGAGGATGG + Exonic
1142359919 16:89621140-89621162 GGGTGGGGAGGCCAGGCTGAGGG + Intronic
1142658265 17:1409299-1409321 GGGAGGCTGAGGCTGGCAGATGG - Intergenic
1143287407 17:5800546-5800568 GTGTGGCTAGGGCTGGATGAAGG + Intronic
1143858301 17:9869212-9869234 GTGAGGGTAAGGCTGGAGGAGGG - Intronic
1143965348 17:10752946-10752968 GGTTGGGTGGGGCTGGGTGAGGG + Intergenic
1143967747 17:10768901-10768923 TGGTGGTTGATGCTGGCTGATGG - Intergenic
1144795600 17:17889172-17889194 GGGTGGCTACGGATGGCTGGAGG + Intronic
1145259836 17:21348154-21348176 GGGTGGATAAGGCAGGCCAAAGG - Intergenic
1145316779 17:21739784-21739806 GGGTGGATAAGGCAGGCCAAAGG + Intergenic
1145721493 17:27077262-27077284 GGGAGGCTGAGGCTGGCAGATGG + Intergenic
1147136386 17:38436374-38436396 GGGGGGGTAGGGGTAGCTGAGGG - Intronic
1147180175 17:38679572-38679594 GGGAGGCCAAGGCAGGCTGATGG + Intergenic
1147316265 17:39621891-39621913 GTGTGTGTAAGGCTGGTGGAGGG + Intergenic
1147322152 17:39653013-39653035 GGGAGGGGAAGACTGGCTGCTGG + Intronic
1147755011 17:42761911-42761933 GGGTGTGGAAGGGTGGCCGAGGG + Intronic
1148354797 17:46968685-46968707 TGGTGGGGAAGGCAGGCAGAGGG - Intronic
1148615536 17:48997575-48997597 GGGCGGGGAAGGCGGCCTGAGGG - Exonic
1149573780 17:57696844-57696866 GGATGGGTAGGACTGGGTGAAGG - Intergenic
1150590841 17:66560827-66560849 TGCTGGGCAAGTCTGGCTGACGG + Intronic
1150686182 17:67322715-67322737 GGGAGGCTGAGGCTGGCAGATGG - Intergenic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151935143 17:77256795-77256817 GGGTGGGTGGGGCTGCCTGGGGG + Intergenic
1152841418 17:82571085-82571107 GGGTGGGTAAGGCTGGCTGAGGG - Intronic
1153193000 18:2563351-2563373 GGGAGGCTGAGGCTGGCGGATGG + Intronic
1153350638 18:4077567-4077589 GGGTGGGTCAGGCGGGCAGGAGG - Intronic
1153776183 18:8456248-8456270 GGGTGTGCAAGGCTTGGTGAAGG - Intergenic
1154306310 18:13233348-13233370 GGGTTGGCAAGGTTGGCAGAGGG + Intronic
1156775560 18:40783947-40783969 GAGTAGGTAAGGCTAGCTTAAGG + Intergenic
1157465764 18:47943556-47943578 TGGTGGGTGATGCTGGCTGCTGG + Intergenic
1157572660 18:48723382-48723404 GGGTGGGTGACCCTGTCTGAGGG - Intronic
1157579269 18:48764024-48764046 GGGAGGTTCAGCCTGGCTGATGG - Intronic
1158240693 18:55374659-55374681 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1158352697 18:56578958-56578980 GGGTGGGACAGGGTGGCTAAAGG - Intergenic
1158537474 18:58321245-58321267 GGGGTGATAAGGGTGGCTGATGG + Intronic
1158775676 18:60575613-60575635 GGCTGGGCAAGGCTGCCTGGTGG + Intergenic
1159916041 18:74188778-74188800 AGGTGGGGAAGGCTGGAGGAGGG - Intergenic
1160024174 18:75205003-75205025 AGGAGGCTTAGGCTGGCTGACGG + Intronic
1160855587 19:1215702-1215724 GGGTGGGGAAGGCTGGGTCGTGG + Intronic
1161445134 19:4314079-4314101 GGCGGGGAGAGGCTGGCTGACGG + Intronic
1161453869 19:4360800-4360822 GGGTGGGTGTGGGTGGCTGGTGG + Exonic
1161816492 19:6502554-6502576 GGGTGGCCAAGCCTGGCTGGGGG - Exonic
1162491656 19:10995950-10995972 GAGTGGGTAGGACTGGCTCATGG + Intronic
1162551269 19:11359753-11359775 GGGCCGGTAAGGGTGGGTGAGGG + Intronic
1162568440 19:11457208-11457230 GGGTGGGGAGGGCAGGCCGACGG - Intronic
1162788928 19:13053194-13053216 ATGGGGGTCAGGCTGGCTGAGGG + Intronic
1163168013 19:15510877-15510899 GGGAGGCTAAGGCTGGAGGATGG + Intronic
1163660359 19:18573402-18573424 GGGTGAGTAGGGCTGGGTGTGGG + Exonic
1163723863 19:18911436-18911458 AGGTGGGCAGGGCTGGCTGGGGG - Intronic
1164781140 19:30894127-30894149 GTGTGTTTAAGGCTGGCTCATGG + Intergenic
1167571534 19:50292071-50292093 GAGTGGGAGAGGCTGGCTCAGGG + Intronic
925046161 2:774181-774203 GGGTGGGTGAGCCAGGCTGGGGG - Intergenic
925287586 2:2726090-2726112 AGGTGGGAAAGACTGGATGAAGG - Intergenic
926176111 2:10593769-10593791 GGGAGGGCAAGGCTGGCACATGG + Intronic
926332749 2:11838612-11838634 GGGCAGCCAAGGCTGGCTGACGG - Intergenic
927186088 2:20483687-20483709 CTGTGGCTGAGGCTGGCTGAGGG - Intergenic
928008253 2:27582760-27582782 GGATGGGGAAGGCAGGCTGGAGG + Intergenic
928100060 2:28431762-28431784 TGGTGGGGAAAGCAGGCTGAGGG - Intergenic
928374367 2:30763065-30763087 GAGCAGGTAAGGCTGGCTGCTGG - Exonic
932247579 2:70208319-70208341 TGGTGGGTATGTCTGGCTGTTGG + Intronic
932411247 2:71549297-71549319 GGGTGGGCATGGCTGGGAGAAGG - Intronic
932411710 2:71551475-71551497 GGGGGGATGAGGTTGGCTGAGGG + Intronic
932689065 2:73897066-73897088 GGGTGGGGAAGGCAGGGGGAAGG - Exonic
932758365 2:74424002-74424024 GGGTGGGGAAGGCTCCCAGATGG - Intronic
933022300 2:77209011-77209033 GGGAGGGGAAGGCTGAGTGAAGG - Intronic
933657826 2:84904264-84904286 GGGAGGTTAAGGCAGGCAGATGG + Intronic
934614433 2:95762537-95762559 GGGTGGGGCAGGGTGGCAGAGGG + Intergenic
934646472 2:96061962-96061984 GGGTGGGGCAGGGTGGCAGAGGG - Intergenic
934761612 2:96859899-96859921 GGCTGGGAAAGGCTGTGTGAGGG - Exonic
934770951 2:96907369-96907391 GGCTGGCTGAGGCTGGCTGTGGG + Intronic
936059417 2:109284576-109284598 GGGTGGTTTTGGCTGGATGAAGG + Intronic
937294408 2:120801009-120801031 GGGTGGGGGAGGCTGCATGAGGG - Intronic
938036563 2:128039635-128039657 GGCTGGGACAGGTTGGCTGAGGG + Intergenic
938094406 2:128452168-128452190 TGGTGGGTAATGGAGGCTGATGG - Intergenic
938255787 2:129858790-129858812 GGGTGAGTAAGGCAGGCTTTGGG + Intergenic
938402501 2:131005050-131005072 GGGTGGCTGAGTATGGCTGAGGG + Intronic
938909638 2:135874996-135875018 TGGTGGGTGACGGTGGCTGAGGG + Intronic
939976458 2:148722266-148722288 GGGTGGGACAGGCTGTCTAAAGG + Intronic
942461040 2:176169248-176169270 GGGTGGGTAGGGCTGGTGGGGGG - Exonic
944568654 2:201019511-201019533 GGGAGGCCAAGGCAGGCTGATGG + Intronic
945603811 2:211901488-211901510 AGGTGGGTAATGCTTGCAGAAGG - Intronic
947457617 2:230269948-230269970 CAATGGGTAAGGCTGTCTGAGGG + Exonic
947467958 2:230370962-230370984 AAATGGGTAAGGCTGCCTGAGGG + Exonic
947774844 2:232699466-232699488 GGGTTGGGGAGGCTGGCTGCTGG - Intronic
1168849259 20:965408-965430 GGGGTGGAAAGGCTGGCAGATGG + Intronic
1169244137 20:4012171-4012193 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1169378479 20:5086432-5086454 GGGAGGCTAAGGCTGGAGGATGG + Intronic
1170062390 20:12272950-12272972 GGGTGAGTGAGGGTGGCTGGAGG - Intergenic
1171227144 20:23451334-23451356 TGGTGGGTGAGGGTGGATGAGGG - Intronic
1171255784 20:23688252-23688274 GGGTGGGTCAGCCTGCCTGAGGG + Intronic
1172175124 20:32967565-32967587 GGGTGGGAGAGGCTGGGTGTGGG - Intergenic
1172918838 20:38464504-38464526 GGGAGGCCAAGGCAGGCTGATGG + Intergenic
1173005843 20:39139014-39139036 GGGTAGGGAAGGCTGGCTATGGG - Intergenic
1173225105 20:41157966-41157988 GACTGGGGAAGGATGGCTGATGG + Intronic
1173522298 20:43709294-43709316 GGCTGGGCCAGGCTGGCTGTGGG - Intronic
1173813283 20:45969385-45969407 GGGTGGGCACAGCTGGCTGCCGG + Intronic
1174760937 20:53206813-53206835 TGGTGGGTAACGGTGACTGAGGG + Intronic
1175230658 20:57471410-57471432 GGGTGGGTGAGGTTGGGGGATGG + Intergenic
1175407800 20:58745983-58746005 GGGTGGGTGTGGCTTCCTGAAGG + Intergenic
1176249582 20:64114030-64114052 GGCTGGGGAAGGCTGGGTGGCGG + Intergenic
1176865920 21:14055146-14055168 GGGAGGCCAAGGCTGGCAGATGG - Intergenic
1176962417 21:15174230-15174252 GGGAGGCCAAGGCAGGCTGATGG - Intergenic
1179063912 21:38006010-38006032 AGGTGGGTGTGGCTGTCTGAGGG + Intronic
1179722404 21:43323203-43323225 GGCTGAGTCAGGGTGGCTGAGGG - Intergenic
1181432484 22:22889961-22889983 TGGTGTGTCTGGCTGGCTGATGG + Intronic
1181615857 22:24053911-24053933 GGTTGGGGAAGGCTGGGTGGTGG + Intronic
1181632423 22:24158166-24158188 GGGTGGGCAAGGCTTCCTGGAGG - Intronic
1181943689 22:26498800-26498822 GGGTTGGGAAGGATTGCTGAAGG - Intronic
1182268853 22:29140185-29140207 AAGTGAGTAAGTCTGGCTGAGGG - Intronic
1182455580 22:30448237-30448259 GGGGGGGTAGGGCTGTCAGAGGG - Intronic
1183364446 22:37399670-37399692 GGGTGGGAGAGGTGGGCTGATGG - Intronic
1183477394 22:38043010-38043032 GGGTGGGTGGTGCTGGGTGAGGG + Intergenic
1183829295 22:40409407-40409429 GGGTGGGAAGGGCTAGCTGGGGG + Intronic
1183975853 22:41511799-41511821 GGGTGGGGAGGGCTTGGTGAGGG + Intronic
1184053092 22:42023432-42023454 GGGAGGGCAAGGCGGGCAGATGG - Intronic
1184326288 22:43789545-43789567 GGGGGCGTGAGCCTGGCTGATGG - Intronic
1184422761 22:44391457-44391479 GGGTGGGTAGGGGTGGGTGCTGG + Intergenic
1184659147 22:45957914-45957936 GGTGGGGACAGGCTGGCTGATGG - Intronic
1184692357 22:46123069-46123091 GGGTGGGTGAGGCTGGCCACAGG + Intergenic
1184817164 22:46881126-46881148 GGGTGGGTAGGGATGGCAGTAGG - Intronic
1184817717 22:46884726-46884748 GGGTGGGCAGGATTGGCTGATGG + Intronic
1184878304 22:47289378-47289400 GGGGTGGTCAGGCTGGATGAGGG - Intergenic
1185242747 22:49755312-49755334 GGGTGGGGCAGGTTGGGTGAAGG - Intergenic
949810898 3:8004867-8004889 GGGTGGGAAAGGATGTTTGAGGG + Intergenic
950882587 3:16335258-16335280 GGAGGGATGAGGCTGGCTGAGGG + Intronic
950924543 3:16727479-16727501 GGGTGGGCTGGGCTGGCTGGGGG + Intergenic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951079052 3:18429593-18429615 GGCTGGGTCAGGTTGGCTGCAGG - Intronic
951614859 3:24531129-24531151 GGCTGGGTAATGCTGAGTGAGGG + Intergenic
952002540 3:28803123-28803145 AGGTGGGAGATGCTGGCTGAGGG - Intergenic
952817878 3:37461294-37461316 AGCTGAGTAAGGCAGGCTGAGGG - Intronic
952887930 3:38022847-38022869 GGTTGAGTAGGGCTGGGTGAGGG - Intronic
953943741 3:47127115-47127137 GGGAGGCTGAGGCCGGCTGATGG + Intronic
954076432 3:48185170-48185192 GGGAGGCTGAGGCAGGCTGATGG + Intronic
954581026 3:51702999-51703021 GGGTGGGTAAGGGTTTCTCAGGG + Intronic
955583867 3:60455112-60455134 GGGTGGGTGAGGTAGGGTGAGGG + Intronic
956740170 3:72269530-72269552 GGGTGGCTTAGGCTGGCCCAGGG - Intergenic
958184505 3:90103161-90103183 GGGAGGTTAAGGCTGGTTGGAGG + Intergenic
959016660 3:101142389-101142411 GGGTGGGGGACGCTGGCTGGAGG + Intergenic
961489764 3:127246712-127246734 TGGTGGGTAAGGGTGCCTGCAGG + Intergenic
961508519 3:127387530-127387552 GGGTGGGTGACACTGGCTGGGGG - Intergenic
961742564 3:129041960-129041982 AGGTGGGACAGGATGGCTGAAGG - Intergenic
962600750 3:136989434-136989456 GGTCGGGTAAGGATGGCTGTTGG - Exonic
962657524 3:137563159-137563181 ACGTGGGGAAGGCTGGATGAAGG + Intergenic
962812877 3:138974136-138974158 GGGGGGCTAAGGCTGGAGGATGG - Intergenic
963785761 3:149532926-149532948 AGTTGGTCAAGGCTGGCTGAGGG + Intronic
966477386 3:180366194-180366216 GGGTGGTTAAGGGGGACTGAGGG - Intergenic
966925107 3:184639615-184639637 GGCTGGGAAAGGCAGGGTGAGGG + Intronic
967292575 3:187935795-187935817 TGCTGGGTATGGCTGGCTGGAGG + Intergenic
968883467 4:3313902-3313924 AGGTGTGACAGGCTGGCTGATGG - Intronic
969096443 4:4736133-4736155 GGGAGGGTTAGGCAGGCTGCAGG + Intergenic
969371681 4:6735341-6735363 GGGAGGGGAGGGCTGGTTGAAGG + Intergenic
969536926 4:7761988-7762010 GGGAAAGAAAGGCTGGCTGATGG + Exonic
971030603 4:22633744-22633766 GGCTGGGTTAGGGGGGCTGAAGG - Intergenic
972100028 4:35403894-35403916 GGCTGTCTAAGGCTTGCTGAAGG - Intergenic
972406385 4:38750738-38750760 TGGTGGGTGAAGCTGGCTGTTGG + Intergenic
973545514 4:51977586-51977608 GGGAGGCTAAGGCTGGAGGATGG + Intergenic
975123041 4:70749893-70749915 GGGAGGCTGAGGCTGGCAGATGG - Intronic
976988923 4:91339450-91339472 GGGGGGGTAGGGCTGACTTAAGG + Intronic
977992800 4:103465182-103465204 GGGTGGGAAATGTGGGCTGATGG + Intergenic
979195647 4:117917152-117917174 GGGTGGGGAAGGTGGGTTGAGGG - Intergenic
980279454 4:130700646-130700668 GGGAGGGTAAGGGGGGATGAAGG - Intergenic
981000361 4:139823344-139823366 GGGTGGGCAAGGATGGTTGTAGG - Intronic
982573063 4:157075014-157075036 GGGAGGCTAAGGCAGGCGGATGG + Intergenic
983902236 4:173147846-173147868 GGATGGGAAAGGCATGCTGAGGG - Intergenic
984148910 4:176101218-176101240 AGGTGGGACAGGATGGCTGAAGG - Intronic
984494301 4:180475268-180475290 GTGTGGGTGAGGGTGGGTGAAGG + Intergenic
984501852 4:180566900-180566922 GGGTGGGTGAGTGTGGGTGAGGG + Intergenic
985553669 5:545792-545814 GGGTGGGCAAGGCCCGCTGGAGG + Intergenic
985843490 5:2327171-2327193 GGGTGGGTAGGGGCAGCTGATGG + Intergenic
986694489 5:10339694-10339716 GAGTGGTGAAGGCTGTCTGAAGG + Intergenic
987441037 5:17956809-17956831 GGGTAGATAAGGCTGGATAAAGG - Intergenic
989103255 5:37839433-37839455 GGGTGGGTGCGGCCGGCTGAAGG - Intronic
989534019 5:42542776-42542798 GAGGGGGTAGGGGTGGCTGAGGG - Intronic
990580788 5:57165724-57165746 GGGAGGCTGAGGCTGGCGGATGG - Intergenic
991250198 5:64551500-64551522 AGGAGGCTAAGGCCGGCTGATGG - Intronic
992040261 5:72823831-72823853 GGGTCTGTAATGCTGCCTGATGG + Intronic
995559735 5:113367749-113367771 GGGTAGGGTATGCTGGCTGAGGG + Intronic
995934925 5:117499184-117499206 GTCTGGGTTAGGGTGGCTGAAGG + Intergenic
996536265 5:124581110-124581132 CGCTGGGAAAGGCTGCCTGATGG - Intergenic
996754265 5:126919779-126919801 GGGTGGGAAAGGGAGGCTGCTGG - Intronic
997294465 5:132761073-132761095 GGGAGGGAAGGCCTGGCTGAGGG - Intronic
997647047 5:135488794-135488816 GGGTGGGGTTGGCTGGGTGACGG + Intergenic
998402692 5:141856157-141856179 GGGTGGGTGAGGCTGGGTGCTGG + Intronic
998807309 5:145931269-145931291 GGGAGGCTAAGGCAGGCGGATGG - Intergenic
999585969 5:153089960-153089982 GGGTGGGTAAGACAAGGTGAAGG - Intergenic
1000091113 5:157930391-157930413 GGGTGGCCAAGGCAGGCAGATGG + Intergenic
1001134409 5:169090498-169090520 GGGTGGGAAAGGCTTCCTGGAGG - Intronic
1001382702 5:171314790-171314812 GGCTGGGCAAGGCTGGGTGAGGG - Intergenic
1001703209 5:173722320-173722342 GGGAGGGAAAGGCAAGCTGAGGG + Intergenic
1001731581 5:173964438-173964460 GGGTGGGGTAGGGTGGGTGAGGG + Intergenic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002192898 5:177488047-177488069 GCGTGAGTAGGGCTGGCTGGCGG - Exonic
1002902701 6:1423476-1423498 GGTGGGGTAAGGCTGGGTAATGG - Intergenic
1004215948 6:13704386-13704408 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1004426426 6:15510271-15510293 GGGTGTCTCAGGCTGTCTGAGGG - Intronic
1004691162 6:17993171-17993193 GGCATTGTAAGGCTGGCTGATGG - Intergenic
1005044404 6:21628445-21628467 GGGTGATTAAGTTTGGCTGACGG - Intergenic
1006034185 6:31198806-31198828 GGGAGGGTGAGGCAGGCAGATGG + Intronic
1006380618 6:33695147-33695169 GGGTGGGTCAGGAAGGATGAAGG - Intronic
1006565286 6:34950791-34950813 TGGTGGGTGAGGCTGGTTGTGGG + Intronic
1006797237 6:36739566-36739588 GGGTGGGAATGGCTGCCTGGAGG + Intergenic
1006940560 6:37749247-37749269 GGGTGGGGAAGGCTTCCTGGGGG - Intergenic
1008486004 6:52036515-52036537 GGGGGGGTAAGGCTGTTTGGTGG - Intronic
1011573178 6:88762312-88762334 TGGTAGGGAAGGCTGGTTGAAGG - Intronic
1012352010 6:98263408-98263430 GGATAGGTCAGGCTGGGTGAAGG + Intergenic
1014784106 6:125598364-125598386 GGGTGGTTCAGGCTTACTGAGGG + Intergenic
1015270216 6:131330213-131330235 GGGTGGGTCAGGGAGGATGAGGG + Intergenic
1015436674 6:133197679-133197701 GAGTGGGTCAGCCTGGTTGATGG - Intergenic
1015818338 6:137233525-137233547 GGGAGGGCAAGGCAGGCGGATGG - Intergenic
1018005654 6:159619638-159619660 GGGTGGGCAAGGCTGGGGGCCGG - Intergenic
1019048134 6:169163482-169163504 GGGTGGGAACTGCTGGCCGAGGG + Intergenic
1019626534 7:2018751-2018773 GGGTGGCGGAGGCTGGGTGAGGG - Intronic
1019639497 7:2095871-2095893 GGGTGGGTGGGGGTGCCTGAAGG + Intronic
1019682248 7:2357232-2357254 GGGTTGGCCAGGCTGGGTGACGG + Intronic
1019741025 7:2673715-2673737 GGGAGGCTGAGGCAGGCTGATGG - Intergenic
1019744222 7:2690556-2690578 GGGCGGCTCAGGTTGGCTGAAGG + Intronic
1020164576 7:5797841-5797863 TGGTGGGTGTGGCTGGGTGAGGG + Intergenic
1020586734 7:10078859-10078881 GGGAGGTTAAGGGGGGCTGAGGG + Intergenic
1020649273 7:10855120-10855142 GGGTGGGGAGGGGTGGCTTATGG - Intergenic
1022283756 7:28935599-28935621 TGCTGTGTAAGGCTGGCTGGGGG + Intergenic
1022420401 7:30215431-30215453 AGGTGAGAAAGGATGGCTGAAGG - Intergenic
1022984422 7:35636887-35636909 GGGTGGTCAAGGCAGGCAGATGG + Intronic
1023186825 7:37541260-37541282 GCCTGGGTGAGGCTGTCTGAGGG + Intergenic
1023684496 7:42720784-42720806 GGGTCGGCAAGTCTGGCTGGAGG - Intergenic
1023727436 7:43158699-43158721 GGGTGGGAATGACTGCCTGATGG - Intronic
1024936140 7:54713998-54714020 GTGCGGGTAAGGGTGGCTGTTGG + Intergenic
1025116533 7:56263177-56263199 GGGAGGGTGAGGCTGGAGGATGG + Intergenic
1026582072 7:71626888-71626910 GGGTGGCCAAAGCTGGGTGATGG + Intronic
1026989000 7:74572660-74572682 GGGTGGGGAAGGCTGAGAGAGGG - Intronic
1027266365 7:76497154-76497176 GGGTGGGGCAGCCTGGCTCATGG - Intronic
1027317745 7:76995272-76995294 GGGTGGGGCAGCCTGGCTCATGG - Intergenic
1027942064 7:84695154-84695176 GGGAGGCCAAGGCTGGCTGGTGG - Intergenic
1028224194 7:88231006-88231028 GGGTGGGTATGTATGGGTGAAGG - Intergenic
1029159837 7:98543799-98543821 GGCTGGGAAAGGATGGCTGAGGG - Intergenic
1030269761 7:107658639-107658661 AGTGGGGTAAGGCTGGCAGAAGG - Intergenic
1030330925 7:108269520-108269542 GGGAGGGAAAGGATGGGTGACGG + Intronic
1030865571 7:114698459-114698481 GGATTGGCATGGCTGGCTGAGGG - Intergenic
1032208351 7:129889220-129889242 TGGTGTGTAGGACTGGCTGAAGG + Intronic
1033414034 7:141146791-141146813 GGGTGGGAAAGGATGGTAGAAGG - Intronic
1034983765 7:155494949-155494971 CGGTGGGAGAGGCTGGCTCAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414063 7:158668175-158668197 GGGTCGGTAAGGAAGGCGGAGGG - Intronic
1035690987 8:1559733-1559755 GGGAGGCTGAGGCTGGCTGGTGG - Intronic
1035750478 8:1992472-1992494 GGGTGGGAAACACTGGCTGGAGG + Intronic
1036915492 8:12799892-12799914 GGGAGGCTAAGGGGGGCTGAGGG - Intergenic
1037865800 8:22441291-22441313 GGCCGGGCACGGCTGGCTGACGG + Exonic
1038443570 8:27587864-27587886 GGGCAGGCAGGGCTGGCTGATGG - Intergenic
1039446124 8:37634421-37634443 GGGTGGGAGAGGGTGGATGATGG + Intergenic
1039478539 8:37854863-37854885 GGGAGGGGAAGGGTGGCTGACGG + Intergenic
1039792079 8:40884175-40884197 GGGTGGGTGAGGCGGGGTGGGGG - Intronic
1040299424 8:46180271-46180293 GGGAGGTTGAGGCAGGCTGATGG - Intergenic
1041513685 8:58676881-58676903 GGGAGGCTAAGGCAGGCTGCTGG + Intergenic
1041745909 8:61209211-61209233 GGATGTGTAAGGCAGGCTCAGGG + Intronic
1047769468 8:128019077-128019099 AGGTGGGAAACGCTGCCTGATGG - Intergenic
1048885283 8:138904471-138904493 TGATGGGTGAGGCAGGCTGAGGG - Intronic
1049222371 8:141433935-141433957 GGGTGGGGGAGGATGGCTGGAGG + Intergenic
1049268951 8:141684083-141684105 GGGTGGGTTGTGCAGGCTGAAGG - Intergenic
1049315803 8:141966751-141966773 GGGTCAGTATGGCTGGCTGGAGG - Intergenic
1049348039 8:142149160-142149182 TGGAGAGAAAGGCTGGCTGAAGG - Intergenic
1049384686 8:142336680-142336702 GCGTGGGTTAGGCTGGTTGATGG - Intronic
1049411592 8:142476025-142476047 GTGTGCGGAAGGCTGGCTGTGGG + Intronic
1049437978 8:142596387-142596409 GGGAGGGCAGGGCAGGCTGAGGG + Intergenic
1049444409 8:142623455-142623477 GGGAGGGCATGGCAGGCTGAGGG + Intergenic
1049494604 8:142923889-142923911 GGATGGGAAATGCTGGCTCATGG - Intergenic
1050153701 9:2643401-2643423 TGGTGTGTATGACTGGCTGACGG - Exonic
1050190756 9:3023418-3023440 GGTTAGATAAGGCTGGCTCAAGG - Intergenic
1051269026 9:15336894-15336916 GGGAGGCTAAGGCCGGCGGATGG + Intergenic
1052043547 9:23768595-23768617 CAGTGGGTGAGGGTGGCTGATGG - Intronic
1052199462 9:25760798-25760820 GGGAGGCCAAGGCAGGCTGATGG - Intergenic
1052932593 9:34067892-34067914 GGGAGGCTAAGGCAGGCTAATGG + Intergenic
1053170095 9:35872145-35872167 GGGTGGGTGAGGCTGGGTATGGG - Intergenic
1053458823 9:38252680-38252702 GAGTGGGTATGGCTGCATGAAGG - Intergenic
1054456609 9:65434530-65434552 GGGTGGAGGAGGCTGGCGGAGGG - Intergenic
1055555884 9:77473215-77473237 GGGAGGCTAAGGCAGGCAGATGG + Intronic
1057144414 9:92748642-92748664 GGATGGGAAGAGCTGGCTGAGGG - Intronic
1057677872 9:97149901-97149923 GGGAGGAGAAGGCTGGCTGTAGG - Intergenic
1058087170 9:100760905-100760927 GGGTGGGTTGGGATGGCTGATGG + Intergenic
1059395660 9:114032562-114032584 GGGAGGGGTAGGCTGGGTGAAGG - Intronic
1060029720 9:120203913-120203935 GGGTGGGTAAAGCTGATTGTGGG + Intergenic
1060279021 9:122203635-122203657 GGGTGGGTGGGGCTGGCTCCAGG + Exonic
1060801614 9:126548903-126548925 GGCTGGGGAGGGGTGGCTGAAGG - Intergenic
1060907011 9:127315534-127315556 GGGAGGGTAAGGCAGGAGGATGG + Intronic
1061163553 9:128909809-128909831 GGGTGGCCAGTGCTGGCTGAGGG + Intronic
1061521960 9:131123788-131123810 GTCTGGATAAGGCTGACTGATGG - Intergenic
1062069876 9:134549893-134549915 GGGTGGAGAAGGCTGGGTGGTGG + Intergenic
1062069889 9:134549935-134549957 GGGTGGAGAAGGCTGGGTGGTGG + Intergenic
1062069898 9:134549963-134549985 GGGTGGAGAAGGCTGGGTGGTGG + Intergenic
1062069907 9:134549991-134550013 GGGTGGCGAAGGCTGGGTGGTGG + Intergenic
1062069916 9:134550019-134550041 GGGTGGAGAAGGCTGGGTGGTGG + Intergenic
1062069944 9:134550103-134550125 GGGTGGAGAAGGCTGGGTGGTGG + Intergenic
1062069991 9:134550236-134550258 GGGTGGAGAAGGCTGGGTGGTGG + Intergenic
1062070000 9:134550264-134550286 GGGTGGAGAAGGCTGGGTGGTGG + Intergenic
1062070023 9:134550334-134550356 GGGTGGAGAAGGCTGGGTGGTGG + Intergenic
1062464875 9:136676519-136676541 GGCGGGGTCAGGCTGGCTTAAGG - Intronic
1062540034 9:137037507-137037529 GGGTGGGCCAGGCAGGCTGGGGG - Exonic
1062549598 9:137079889-137079911 GGGTGGGACAGGATGGCAGAAGG - Intronic
1185860050 X:3569370-3569392 GGTTGAGGCAGGCTGGCTGAGGG - Intergenic
1186548696 X:10479456-10479478 GGGTGGGTAGGGATGGTTAATGG - Intronic
1186660040 X:11660319-11660341 GGGAGGGTGAGGCAGGCAGATGG + Intronic
1188098303 X:26049588-26049610 GAGTGGTAAAGGCTGGCTAAGGG + Intergenic
1188112813 X:26212112-26212134 GGGTGGAAGAGGCTGGGTGAGGG + Intergenic
1188757045 X:33975056-33975078 GGTTGGGTAAGGCTGGAGTAGGG + Intergenic
1192450147 X:71239706-71239728 GGGTGGGCATGGCTCACTGAAGG + Exonic
1192486772 X:71534022-71534044 GGGTGGGAAATCCAGGCTGAGGG - Intronic
1197830700 X:130639287-130639309 TGGTGGGACAGGATGGCTGAGGG - Intronic
1197840164 X:130737799-130737821 GAGTGGGTAAGGCAGTCTAAGGG + Intronic
1199290229 X:146096879-146096901 GAGTGGCTAATGCTGGCTGAGGG + Intergenic
1200089124 X:153626201-153626223 GGGTGGGCAAGGCTGGGACATGG - Intergenic
1200105291 X:153708721-153708743 TGGTGGGTAAGAGTCGCTGAGGG - Intronic
1200267900 X:154655613-154655635 CGATGGGTAAGGGTGGGTGAAGG + Intergenic
1200790383 Y:7294173-7294195 GGGAGGCTGAGGCGGGCTGATGG + Intergenic
1201448511 Y:14084110-14084132 GGGTTGGGGAGGCTGCCTGAAGG + Intergenic
1201739668 Y:17310520-17310542 GGGTGGCCAAGGCTTGCAGATGG + Intergenic