ID: 1152842271

View in Genome Browser
Species Human (GRCh38)
Location 17:82577697-82577719
Sequence GCCTCCAAAGGGACTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152842271 Original CRISPR GCCTCCAAAGGGACTAGAGC TGG Intronic
901040103 1:6358536-6358558 TCCTCCCTGGGGACTAGAGCAGG + Intronic
903459430 1:23510085-23510107 GCCTCCAAGGGGACCAGGGATGG + Exonic
903664659 1:24998871-24998893 GCCTTCCCAGGGACTAGGGCAGG - Intergenic
903810037 1:26030056-26030078 GCCTCCATGGGGACTGGAGTGGG + Intronic
904549664 1:31305144-31305166 ACCCCCAAAGAAACTAGAGCTGG - Intronic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905286768 1:36885697-36885719 GCCCCCACAGGGACCAGGGCAGG + Intronic
909755926 1:79225428-79225450 CCCTCGAAAGGGAATACAGCTGG - Intergenic
910637786 1:89428476-89428498 GCCTCCAATGGTCCTGGAGCTGG - Intergenic
911226229 1:95308471-95308493 GGCTCCAGAGGGAGTAGAGTTGG + Intergenic
914808184 1:151007091-151007113 GGCTCCAGAGGGAAAAGAGCTGG - Intronic
917883910 1:179365241-179365263 GCCTCCCGAGGGACTACAGGCGG - Intergenic
918480505 1:184973202-184973224 ACCTCCAAAAGCACCAGAGCAGG + Intronic
920118083 1:203635387-203635409 GCCTCCCAAGTAACTGGAGCAGG + Intronic
922500951 1:226096541-226096563 GCCTCCAGGGGGACCACAGCTGG - Intergenic
923095578 1:230772885-230772907 ACTTCCCAAGGGACCAGAGCTGG - Intronic
1069590327 10:69637408-69637430 CCCACCAGAGGGACTGGAGCTGG - Intergenic
1069691694 10:70357875-70357897 GGCTCTAAAGGGACCACAGCTGG + Intronic
1069775713 10:70925999-70926021 GCCTCCAAGTGGACAGGAGCTGG - Intergenic
1070657049 10:78278789-78278811 ACCTCCCTAGGGTCTAGAGCTGG + Intergenic
1073424189 10:103446372-103446394 GCATCCAAAGGTTCTAGAGGTGG + Intergenic
1074247813 10:111712879-111712901 ACCTCCGAAGAGACTAGAGTGGG + Intergenic
1074294509 10:112171272-112171294 GCCCCCATAGGGACTAGCACTGG + Intronic
1074445609 10:113518983-113519005 GCTTTCAGTGGGACTAGAGCTGG + Intergenic
1075665011 10:124223785-124223807 GCCTGGAATGGGACAAGAGCAGG + Intergenic
1077010137 11:376003-376025 GCCTCCCAAGGGGCTGGAGAAGG - Intronic
1077309739 11:1883006-1883028 GCCCCCACAGGGAGCAGAGCAGG + Intronic
1077672034 11:4166169-4166191 TCCTCCCCAGGGCCTAGAGCAGG - Intergenic
1079925645 11:26488805-26488827 GCCTCGAAAGGGACCCGAGCAGG + Intronic
1081486074 11:43530333-43530355 GCCTCCAAAGGATATAGAGCTGG - Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084488002 11:69462348-69462370 GCCTCCAGTGGGTGTAGAGCTGG - Intergenic
1084765418 11:71305253-71305275 CCCTCCAAAGGCTCTAGAGGAGG - Intergenic
1085582481 11:77667008-77667030 GCCTCCAATGGGACAAGTGGTGG - Exonic
1090230913 11:125103059-125103081 CCCTCCAAAGGCTCTAGGGCAGG + Intronic
1090667898 11:128926989-128927011 GGCTCCAAAGGGGCAAGAGAAGG + Intergenic
1091397118 12:160728-160750 GCCACCAAAGGGCTTAGAGCTGG - Intronic
1092524611 12:9302104-9302126 GCCACCAAAGGGAGGAGAGGGGG - Intergenic
1092542654 12:9429708-9429730 GCCACCAAAGGGAGGAGAGGGGG + Intergenic
1094510358 12:31092722-31092744 GCCACCAAAGGGAGGAGAGGGGG - Intronic
1099185204 12:79508773-79508795 CCCTCTAAAGCGAATAGAGCAGG + Intergenic
1101784962 12:107874757-107874779 CCCTCCCCAGGGACTAGAGCAGG + Intergenic
1104431442 12:128719684-128719706 CCCTCCAAAGGCTCTAGAGGAGG + Intergenic
1106184894 13:27400698-27400720 GCATCAAAAGGGACCGGAGCAGG - Intergenic
1106620058 13:31364348-31364370 GCGTCCAAATAGACTAGAGCTGG + Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1116298642 14:43146640-43146662 GCCTCCAAAGGAAATAAAGAAGG - Intergenic
1120355771 14:83431765-83431787 GCCTCCCAAGTAGCTAGAGCAGG - Intergenic
1121365657 14:93307271-93307293 GCCTCCCAAGTAGCTAGAGCAGG + Intronic
1121788932 14:96684128-96684150 GCCTCCAAAGAGTGTAGAGAGGG + Intergenic
1121833503 14:97071955-97071977 TCCTCCAAGGGCACTAGGGCAGG - Intergenic
1129294312 15:74591539-74591561 ACCTGCAAAGGAACTGGAGCTGG - Exonic
1130458713 15:84141648-84141670 CCCTCAAAAGAGACTAGTGCTGG - Intergenic
1130841963 15:87709164-87709186 GCCACCAAAGAGACTAGTGCGGG - Intergenic
1131513368 15:93062024-93062046 GCGTGCAAAGGGATTAGATCAGG + Intronic
1131967240 15:97857480-97857502 GACCCCAAAGGAACTATAGCTGG + Intergenic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1136271951 16:29153699-29153721 GCCTCCGGAGGGACTATGGCTGG - Intergenic
1136716910 16:32288819-32288841 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1138295924 16:55885119-55885141 GCCTACAAAGGCAGTAGAGTAGG - Intronic
1203145458 16_KI270728v1_random:1795385-1795407 GCCTGCAGAGGGAACAGAGCTGG + Intergenic
1142504829 17:356742-356764 GCCTCCGAAGGGGCAGGAGCAGG - Intronic
1143732491 17:8888941-8888963 CCCTCCAAAGGGAATATAGAAGG - Intronic
1143985577 17:10910760-10910782 GCTTCCACAGCAACTAGAGCAGG - Intergenic
1144899360 17:18569587-18569609 GCGTGCAAAGGGATTAGATCAGG - Intergenic
1144956005 17:19019234-19019256 GCCACCAAAGGGTTTGGAGCAGG + Intronic
1145283126 17:21482801-21482823 TCCTCCAAAGGGAGCACAGCTGG - Intergenic
1149326331 17:55534063-55534085 GACTCAAAAGGGACTAGAGATGG + Intergenic
1151979779 17:77501952-77501974 CCCTCCAAAGGCTCTAGAGGAGG + Intergenic
1152016826 17:77756315-77756337 GCCTCCAAAGGGAGTGAGGCAGG + Intergenic
1152281846 17:79389517-79389539 TCTTCCAAAGGAACTAAAGCAGG - Intronic
1152842271 17:82577697-82577719 GCCTCCAAAGGGACTAGAGCTGG + Intronic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1154294798 18:13138547-13138569 GCCTCCCGAGGTACAAGAGCAGG - Intergenic
1157430496 18:47620444-47620466 CCCTCCAAAGGCTCTAGAGATGG + Intergenic
1160621728 18:80175915-80175937 ACCTCCAATGTGACTGGAGCTGG - Intronic
1161423291 19:4187604-4187626 GCCGCCACAGGGACTTGAGGGGG - Intronic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
928387862 2:30884981-30885003 GCATCAAAAGGGACCAGACCCGG - Intergenic
930173917 2:48281837-48281859 GCCTCCTGAGGGACTGGAGGTGG - Intergenic
931290074 2:60864859-60864881 CCCTCCAAAGGCTCTAGAGGAGG - Intergenic
931345479 2:61441437-61441459 GGCTGCAGAGAGACTAGAGCTGG + Intronic
931483445 2:62666932-62666954 GCCTCCCAAAGTACTAGTGCTGG - Intergenic
931636441 2:64344581-64344603 TCCACCAAATGGAATAGAGCAGG - Intergenic
932592411 2:73075341-73075363 GCCTCCAAAGGGAATCCAGAGGG + Exonic
932756681 2:74414583-74414605 GCCTCCACAGGGTCTGGAGCTGG - Exonic
933895583 2:86807745-86807767 GCCACCAAGGCGACGAGAGCCGG + Exonic
934048434 2:88190640-88190662 GCCTCCCAGGGGCCAAGAGCTGG + Intergenic
935388494 2:102525617-102525639 GCCTCCAATGGGAAGAGTGCAGG - Intronic
937363011 2:121242136-121242158 GCATTCAAAGGGAGCAGAGCTGG + Intronic
941842854 2:170106505-170106527 GTCTCCACAGAGAATAGAGCAGG + Intergenic
943318945 2:186423466-186423488 GACTCCTAAGGGACTATAGTAGG - Intergenic
946109650 2:217403354-217403376 GCCTCCAAAGGCACTACAACAGG + Intronic
947500615 2:230668328-230668350 ACCTCCAAAGGTGCTGGAGCTGG - Intergenic
1173792368 20:45835946-45835968 GCCTGAAAAGGGACTGGAGCAGG - Intronic
1175765319 20:61588432-61588454 CCCTGCAAAGGGCCTAGAGCTGG - Intronic
1175991700 20:62793130-62793152 GGGTCCACAGGGACTAGAGCAGG + Intergenic
1176372111 21:6068500-6068522 GCCTCCCCAGGCACTGGAGCTGG + Intergenic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179751408 21:43470039-43470061 GCCTCCCCAGGCACTGGAGCTGG - Intergenic
953794576 3:45974712-45974734 GCCTCAAAAGGGAAGAGAGAAGG - Intronic
959071886 3:101709632-101709654 GCCTCCAGAAAGACTAGAGACGG - Intergenic
961091460 3:124116126-124116148 GCCACCAGAGGGAAGAGAGCTGG - Intronic
961261333 3:125604635-125604657 GCATGGAAAGGGACTCGAGCAGG - Intergenic
964158635 3:153618415-153618437 GCACCCAAAGGGAAAAGAGCAGG + Intergenic
965799251 3:172474730-172474752 GCCTGCAAAGGGATTAGAAAGGG - Intergenic
966669274 3:182508811-182508833 GCCTTCAAGGGGGTTAGAGCTGG + Intergenic
968480074 4:829353-829375 GCTTCCAGAGAGGCTAGAGCTGG - Intergenic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
971617446 4:28810722-28810744 ACCTCCACAGGGACTAGAATAGG - Intergenic
972651591 4:41022540-41022562 GACTCCAGAGGGACAAGAGAAGG - Intronic
977371488 4:96142694-96142716 GCATCTACAGGGACTAGAACAGG + Intergenic
980191715 4:129533100-129533122 GACTCCAAAGGGACTCCAGAAGG - Intergenic
985423477 4:189806623-189806645 GCCTGGAAAGGGACCAGAGCGGG + Intergenic
989998202 5:50860860-50860882 GTCTCCATAGAGACTTGAGCAGG + Intergenic
990035946 5:51319922-51319944 TCCTCCAAAGGAACCAAAGCTGG - Intergenic
990448346 5:55913788-55913810 GCCTCAAAAAGGCCTAGACCTGG - Intronic
992343746 5:75854012-75854034 GACTCCAAAGGAACAAGAGGAGG - Intergenic
997214010 5:132095560-132095582 CCCTCCAAAGGCCCTGGAGCTGG - Intergenic
997405827 5:133645846-133645868 CCCTCCAAAGGCTCTAGAGGAGG - Intergenic
997522936 5:134534868-134534890 CCCTCCAAGGGGATGAGAGCAGG + Intronic
999028978 5:148268842-148268864 ACATCCAAAGTGACAAGAGCAGG + Exonic
999314413 5:150574864-150574886 ACCTCCAAAGAGGCTAGAGGTGG - Intergenic
1004317299 6:14600935-14600957 GCCACCAAAGGGAGTAGTGGAGG + Intergenic
1006292142 6:33146419-33146441 GCCCCCAAAGGCCCTAGTGCTGG - Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1010387767 6:75302201-75302223 CCCTCCAAAGGCACAACAGCAGG - Intronic
1010514204 6:76753422-76753444 GCCTCCCCTTGGACTAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1019775503 7:2909838-2909860 GCATCCCAGGGGACAAGAGCTGG - Intronic
1021936047 7:25632360-25632382 GCTTCCAAAGGGACTGCAGAGGG - Intergenic
1023797364 7:43804913-43804935 TCCTCAAAATGGACTAGATCAGG - Intronic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1033157153 7:138966835-138966857 TCCTCCAAAGGTGCTAGAGAAGG - Intronic
1033530885 7:142262929-142262951 GCCTGCAAAGGAAATAGAGGAGG + Intergenic
1034966989 7:155397877-155397899 GCCTGGAAGGGGACTGGAGCGGG + Intergenic
1037520772 8:19678806-19678828 GCATCCAAAAGGACAAGACCTGG + Intronic
1037688602 8:21164309-21164331 GCCTCCAAAGGGAAGACACCTGG + Intergenic
1039655214 8:39397121-39397143 GCCTCCAAAGGGACTACATGGGG - Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1046513796 8:115232753-115232775 GTTTGCAAAGGGACAAGAGCTGG - Intergenic
1048860051 8:138717672-138717694 TCCTCCAAGGGGACTAAACCTGG - Intronic
1049266302 8:141669662-141669684 GCAGCCAAAGGGACTAGGACAGG + Intergenic
1053192696 9:36086553-36086575 GCATGGAAAGGGACTGGAGCAGG + Intronic
1055379206 9:75688031-75688053 GTCTACCAGGGGACTAGAGCAGG - Intergenic
1058782054 9:108347593-108347615 GCATCCAAAAAGACAAGAGCAGG + Intergenic
1203435023 Un_GL000195v1:130218-130240 GCCTGCAGAGGGACTAGGGAGGG - Intergenic
1189852823 X:45193932-45193954 GCCACTAAAGGGACTGGAGCTGG + Intronic
1191825830 X:65363766-65363788 GCCTCCAAAAGTATTAGGGCGGG - Intergenic
1192442283 X:71183421-71183443 GCCTCCAAAGGGAGAGCAGCGGG - Intergenic
1199854592 X:151750104-151750126 GCCTTCAAAGGGACCACAGTGGG - Intergenic