ID: 1152842390

View in Genome Browser
Species Human (GRCh38)
Location 17:82578520-82578542
Sequence GTTGTAATTTGATCAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152842390 Original CRISPR GTTGTAATTTGATCAAACCC AGG (reversed) Intronic
907842333 1:58170013-58170035 GCTATTATTAGATCAAACCCCGG + Intronic
917227567 1:172800768-172800790 CATGTTATTAGATCAAACCCTGG + Intergenic
917290137 1:173463535-173463557 GTTCTAATTTGATTACACCTTGG - Intergenic
918037174 1:180885194-180885216 CTTTTAATTTGATCAAATTCTGG - Exonic
918610007 1:186478634-186478656 GTTGAAATATGATGAATCCCTGG + Intergenic
919558643 1:199092633-199092655 GCTATAGTTAGATCAAACCCTGG + Intergenic
1063356442 10:5403309-5403331 GCTGTAATCTGATCAAAACTTGG + Intronic
1063507918 10:6618442-6618464 CTTGCAAATTAATCAAACCCAGG + Intergenic
1066664455 10:37768429-37768451 GTTCTAGTTTGATCACACCGTGG - Intergenic
1070567333 10:77613847-77613869 TTTGTCATTTTATCAAACACAGG + Intronic
1073334085 10:102692131-102692153 GTTGTAATATAATGTAACCCTGG - Intronic
1079985546 11:27196911-27196933 GGTGTAATTTGAACTAACACAGG + Intergenic
1080230748 11:30016343-30016365 GTTGTTATTTTCCCAAACCCGGG - Intronic
1080771332 11:35344876-35344898 GATGGAATTTGATCCAATCCAGG - Intronic
1086593450 11:88543142-88543164 GGTGTAATTTGAACTTACCCTGG + Intronic
1088511295 11:110578449-110578471 GTTAAAATGTGATCAAACCATGG - Exonic
1090088819 11:123675527-123675549 GTTGTAAAATGATCAAATCAGGG - Intergenic
1092396005 12:8127255-8127277 GTTGCCATGTGAACAAACCCAGG - Intronic
1092925362 12:13267329-13267351 GTAGAAATTTGATCAAAGCCAGG - Intergenic
1100068784 12:90684725-90684747 CTTTGAATTTCATCAAACCCAGG + Intergenic
1100372974 12:93986003-93986025 GTTGTAACTTGAATAAATCCCGG + Intergenic
1100647427 12:96546024-96546046 GTTGCAAATTAATCAGACCCAGG + Intronic
1101478134 12:105070954-105070976 GTTGTAATTGGATCACACTAAGG + Intronic
1107686628 13:42906915-42906937 GTTGTAAAATGATCAAATCAGGG + Intronic
1109837176 13:67875500-67875522 TTTGTAATTTGTTCTAACACAGG - Intergenic
1112355699 13:98673317-98673339 GTGGTCATTTGACCACACCCTGG + Intergenic
1112411742 13:99170307-99170329 GTTCTAATTTGATCACACTGTGG + Intergenic
1113038017 13:106072378-106072400 GTTCTAATTTACTCACACCCAGG - Intergenic
1117127779 14:52649547-52649569 GTTTTAATTTGATCAAAACTCGG - Intronic
1120198798 14:81515357-81515379 GTTATTGTTAGATCAAACCCTGG + Intronic
1120507444 14:85370262-85370284 GTTCTAATTTGATTGAACCGTGG + Intergenic
1123832358 15:24153906-24153928 GTTTTAATTTGATGTAACCTGGG + Intergenic
1125696692 15:41643699-41643721 GTTTTAATTTGATGAAGTCCAGG + Intronic
1131386027 15:92008234-92008256 GGTCTGATTTGATCAAAACCTGG + Intronic
1131411209 15:92209660-92209682 GCTGTTGTTAGATCAAACCCTGG + Intergenic
1131734761 15:95320249-95320271 CTTGTAAATTAATCAGACCCAGG - Intergenic
1133860664 16:9591967-9591989 GTTGTGCTTTTATTAAACCCAGG - Intergenic
1146371745 17:32268813-32268835 GTTGTTATGTGATCCAAGCCAGG + Intronic
1150589764 17:66551908-66551930 TTTGTTATTTTATAAAACCCTGG + Intronic
1151022971 17:70640626-70640648 CTTTTAATCTTATCAAACCCAGG - Intergenic
1152842390 17:82578520-82578542 GTTGTAATTTGATCAAACCCAGG - Intronic
1157461226 18:47896482-47896504 GACATAATTTGATCAAACCTGGG + Intronic
1167124753 19:47541730-47541752 GTTATAATTTAAACAAACCACGG + Intronic
1167785640 19:51633772-51633794 TTTGTAATTTGATTAATCTCTGG - Intronic
925949904 2:8900351-8900373 GCTATTATTAGATCAAACCCTGG - Intronic
928586676 2:32766234-32766256 GTTGTATTATGATCAAATCAGGG + Intronic
928813610 2:35260525-35260547 GTTTCAATTTGATTAAACTCAGG + Intergenic
931685964 2:64793592-64793614 GGTATAATTTGATTAAAGCCAGG - Intergenic
932856437 2:75238996-75239018 GGTGTCATTTAATCAAACCATGG - Intergenic
933478136 2:82818756-82818778 GTTGGAGTTGGATGAAACCCCGG - Intergenic
935058006 2:99584138-99584160 GGTTTAATCTGATCAATCCCTGG - Intronic
936577171 2:113666795-113666817 TTTTTAATTTGCTCAAATCCAGG + Intergenic
942434892 2:175960367-175960389 GTTCTAATTTGATTGCACCCTGG - Intronic
943147415 2:184063449-184063471 GTTCTAATTTGATCACACTGTGG + Intergenic
943820860 2:192319073-192319095 GTTGTATTTTGGTCAAAACAAGG + Intergenic
944249337 2:197565812-197565834 GTTCTAATTTGATTAAACTGTGG + Intergenic
1170527754 20:17258031-17258053 GTTGTTATTTGATCTGTCCCAGG - Intronic
1185423066 22:50745869-50745891 TTTTTAATTTGCTCAAATCCAGG - Intergenic
949246880 3:1935300-1935322 GTTGTAATTTGATTGCACCGTGG - Intergenic
951496926 3:23339320-23339342 GTGGTATTTGGATCAAACACTGG + Intronic
954936111 3:54328651-54328673 GGTGTAATTTCCTCAAACCCTGG - Intronic
957721674 3:84010408-84010430 GTTGTAATTTGATTACACTGTGG - Intergenic
959154808 3:102653816-102653838 GCTGTATTTTGATCATGCCCAGG + Intergenic
962838928 3:139215935-139215957 GTTGTAATTTTTTCATATCCTGG + Intronic
963075616 3:141343718-141343740 GTTGTACTTTGATCCATGCCTGG - Intronic
963980526 3:151531492-151531514 GTTCTAATTTGATCACACTGTGG - Intergenic
965090815 3:164160783-164160805 GTTCTAATTTGATTACACCATGG + Intergenic
966649679 3:182285659-182285681 AATTTAATTTGAACAAACCCAGG + Intergenic
967419307 3:189256346-189256368 GTTCTAATTTGATTACACCGTGG + Intronic
970443117 4:16101746-16101768 GTTAAAATTTGAACAAACACTGG + Intergenic
972112491 4:35581867-35581889 GTTATAATTTCATCAAAACCAGG - Intergenic
972273992 4:37539872-37539894 GTTGTAAAATGATCAAAACAGGG + Intronic
973003260 4:44977924-44977946 GTTGGCATTGGATCAAACCCCGG - Intergenic
974537119 4:63186992-63187014 GCTATTATTAGATCAAACCCTGG + Intergenic
974720134 4:65727457-65727479 GTTCTAATTTGATCACACTGTGG - Intergenic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
977033328 4:91916443-91916465 GTTGTGATATGAGCTAACCCAGG - Intergenic
986069446 5:4267788-4267810 GGTGTAATTGGATAAAACCAAGG + Intergenic
986924210 5:12726769-12726791 TTTATAATTTTATCATACCCTGG - Intergenic
987181207 5:15370344-15370366 GTTTTAAGTTGATCACAGCCAGG + Intergenic
989819005 5:45771765-45771787 GTTGGAAATTCCTCAAACCCAGG - Intergenic
994235039 5:97353366-97353388 GTTCTAATTTGATCATACTGTGG + Intergenic
994377272 5:99029440-99029462 GTAGTAAAATGATCAAACCTAGG + Intergenic
995545662 5:113227957-113227979 GGTCTAATTTAGTCAAACCCAGG + Intronic
996151337 5:120039054-120039076 GTTTTAGTTTGATCAATCTCAGG - Intergenic
996639753 5:125738193-125738215 GTTGTAGTTTGATCACACTGTGG + Intergenic
999533692 5:152492208-152492230 GTTGTGCTTTGACCCAACCCTGG + Intergenic
1003805762 6:9724664-9724686 GCTATTATTAGATCAAACCCTGG + Intronic
1008130561 6:47716079-47716101 TTTGCAATTTAATTAAACCCTGG + Intronic
1010911009 6:81556438-81556460 GTTCTAATGTGACCATACCCTGG + Intronic
1011973569 6:93261473-93261495 CTTGTCATTTGATTAAAACCAGG - Intronic
1012157517 6:95838296-95838318 ATTGAAGTTAGATCAAACCCAGG + Intergenic
1012193474 6:96309974-96309996 GTTGCAATTTGATAAAACAGAGG - Intergenic
1021301008 7:18973146-18973168 TTTGTAATTTTATTTAACCCTGG - Intronic
1023363378 7:39438694-39438716 GTTCTAATTTGATCACACTGTGG + Intronic
1027797612 7:82714073-82714095 ACTTTAATTTGATCAAACACAGG + Intergenic
1037192776 8:16147492-16147514 GTTGTAATTTTTTCACAGCCTGG - Intronic
1037637764 8:20715734-20715756 ATTGTAATTTGGTGAAACCCAGG - Intergenic
1038114573 8:24538914-24538936 GTTGTAATTTGATGGAAAGCTGG + Intergenic
1044005472 8:86932146-86932168 GCTATTATTAGATCAAACCCTGG - Intronic
1054844017 9:69773347-69773369 TTTGTTATGTGATAAAACCCAGG - Intergenic
1056010573 9:82325515-82325537 GTTCTAATTTGATCACACAGTGG + Intergenic
1186540020 X:10390938-10390960 GCTTGAATTTGATCAAAGCCAGG - Intergenic
1188084408 X:25885091-25885113 GTTGTAATTTGATTACACTGTGG - Intergenic
1189117076 X:38353943-38353965 GTTGTTATCTGATCTAACTCTGG - Intronic
1190592019 X:52012449-52012471 ATCGTTATTTGCTCAAACCCAGG - Intergenic
1191788477 X:64943167-64943189 GTTCTAATTTGATCACACTGTGG + Intronic
1193579124 X:83241163-83241185 GTAATAATTTGATCAAAACATGG + Intergenic
1194203814 X:90986313-90986335 GTTCTAATTTGATTAAACTGTGG - Intergenic
1194640075 X:96393158-96393180 TATGTAATTTGATGAAATCCAGG - Intergenic
1197071014 X:122297901-122297923 GTTCTAATTTGATTAAACTGTGG + Intergenic
1197087451 X:122495795-122495817 GTTCTAATTTGATCACACTGTGG + Intergenic
1198154256 X:133943002-133943024 GTAGGAATTTGATCAGACACAGG - Intronic
1198561062 X:137850665-137850687 TTTGGAATTGGATCAAACCAAGG - Intergenic
1198809304 X:140519364-140519386 GTTGTCTTTTGATCAATCTCCGG + Intergenic
1199307975 X:146290228-146290250 GTTTTAATTTGATTGTACCCTGG + Intergenic
1200549648 Y:4561762-4561784 GTTCTAATTTGATTAAACTGTGG - Intergenic
1201530509 Y:14985826-14985848 GCTGTTGTTAGATCAAACCCTGG + Intergenic
1201568618 Y:15391459-15391481 GTTATTGTTAGATCAAACCCTGG - Intergenic