ID: 1152845146

View in Genome Browser
Species Human (GRCh38)
Location 17:82595121-82595143
Sequence TGCATCCCACGTTGCCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152845146_1152845150 -2 Left 1152845146 17:82595121-82595143 CCATGGGGGCAACGTGGGATGCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1152845150 17:82595142-82595164 CAGCAGGGTTTGGTGTGCCGTGG 0: 1
1: 0
2: 0
3: 11
4: 151
1152845146_1152845155 6 Left 1152845146 17:82595121-82595143 CCATGGGGGCAACGTGGGATGCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1152845155 17:82595150-82595172 TTTGGTGTGCCGTGGGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 251
1152845146_1152845153 4 Left 1152845146 17:82595121-82595143 CCATGGGGGCAACGTGGGATGCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1152845153 17:82595148-82595170 GGTTTGGTGTGCCGTGGGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 176
1152845146_1152845154 5 Left 1152845146 17:82595121-82595143 CCATGGGGGCAACGTGGGATGCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1152845154 17:82595149-82595171 GTTTGGTGTGCCGTGGGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 163
1152845146_1152845151 -1 Left 1152845146 17:82595121-82595143 CCATGGGGGCAACGTGGGATGCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1152845151 17:82595143-82595165 AGCAGGGTTTGGTGTGCCGTGGG 0: 1
1: 0
2: 2
3: 10
4: 144
1152845146_1152845152 0 Left 1152845146 17:82595121-82595143 CCATGGGGGCAACGTGGGATGCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1152845152 17:82595144-82595166 GCAGGGTTTGGTGTGCCGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152845146 Original CRISPR TGCATCCCACGTTGCCCCCA TGG (reversed) Intronic