ID: 1152845371

View in Genome Browser
Species Human (GRCh38)
Location 17:82596501-82596523
Sequence CCCCGGGACCGCGCACACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152845363_1152845371 -4 Left 1152845363 17:82596482-82596504 CCCTGGTGCCCTCGTCACGCCCC 0: 1
1: 0
2: 0
3: 17
4: 118
Right 1152845371 17:82596501-82596523 CCCCGGGACCGCGCACACGTGGG 0: 1
1: 0
2: 0
3: 1
4: 45
1152845358_1152845371 12 Left 1152845358 17:82596466-82596488 CCTGCCCCACCGGTTGCCCTGGT 0: 1
1: 0
2: 0
3: 13
4: 203
Right 1152845371 17:82596501-82596523 CCCCGGGACCGCGCACACGTGGG 0: 1
1: 0
2: 0
3: 1
4: 45
1152845362_1152845371 3 Left 1152845362 17:82596475-82596497 CCGGTTGCCCTGGTGCCCTCGTC 0: 1
1: 0
2: 1
3: 11
4: 162
Right 1152845371 17:82596501-82596523 CCCCGGGACCGCGCACACGTGGG 0: 1
1: 0
2: 0
3: 1
4: 45
1152845361_1152845371 6 Left 1152845361 17:82596472-82596494 CCACCGGTTGCCCTGGTGCCCTC 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1152845371 17:82596501-82596523 CCCCGGGACCGCGCACACGTGGG 0: 1
1: 0
2: 0
3: 1
4: 45
1152845364_1152845371 -5 Left 1152845364 17:82596483-82596505 CCTGGTGCCCTCGTCACGCCCCG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1152845371 17:82596501-82596523 CCCCGGGACCGCGCACACGTGGG 0: 1
1: 0
2: 0
3: 1
4: 45
1152845359_1152845371 8 Left 1152845359 17:82596470-82596492 CCCCACCGGTTGCCCTGGTGCCC 0: 1
1: 0
2: 0
3: 20
4: 161
Right 1152845371 17:82596501-82596523 CCCCGGGACCGCGCACACGTGGG 0: 1
1: 0
2: 0
3: 1
4: 45
1152845360_1152845371 7 Left 1152845360 17:82596471-82596493 CCCACCGGTTGCCCTGGTGCCCT 0: 1
1: 0
2: 0
3: 3
4: 112
Right 1152845371 17:82596501-82596523 CCCCGGGACCGCGCACACGTGGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152845371 Original CRISPR CCCCGGGACCGCGCACACGT GGG Intronic
901184478 1:7363895-7363917 CCCAGGGACCGGGAACACTTGGG + Intronic
901455652 1:9361471-9361493 CCCCGGGAAGGCACACACGCAGG - Intronic
1062911697 10:1216060-1216082 CCCCGAGACCTCCCCCACGTTGG - Intronic
1066427123 10:35317713-35317735 CCCTGGGAGCGCACACACTTAGG - Intronic
1076591136 10:131584395-131584417 ACCCGGGTCCGCGCAGACGCAGG + Intergenic
1083266071 11:61547397-61547419 CCCCGGGGCCGGGCACACAGTGG + Intronic
1083997070 11:66278005-66278027 CCCCGGCACCCCGCACCCCTCGG - Intergenic
1084146462 11:67267479-67267501 CCCTCGGACCGCGCTCAGGTCGG + Intronic
1091124211 11:133081939-133081961 CCAGGGGACCGCGCTCCCGTTGG - Intronic
1094843519 12:34351690-34351712 CCCCGGGAACCAGCACATGTGGG + Intergenic
1108314158 13:49221288-49221310 GCCGGGGACCGCGCAAACGCTGG + Intronic
1132398142 15:101489262-101489284 CCCCGGCCCCGCGCGCGCGTGGG - Intronic
1132555508 16:570225-570247 CCCCGGGCCCGCGCCGACCTGGG + Intronic
1136293478 16:29289468-29289490 CCTTGGGGCCCCGCACACGTTGG - Intergenic
1141101904 16:81203579-81203601 CCCCGGCACTGAGCACTCGTGGG - Intergenic
1142099358 16:88263474-88263496 CCTTGGGGCCCCGCACACGTTGG - Intergenic
1142727905 17:1829958-1829980 CCCCTGAGCCGCGCGCACGTCGG + Intronic
1144892314 17:18501076-18501098 CCCCGGGCCCACGCACACACAGG + Intergenic
1145139900 17:20443212-20443234 CCCCGGGCCCACGCACACACAGG - Intergenic
1151402720 17:73866416-73866438 CGCCGGGTCAGCGCACAGGTGGG + Intergenic
1152845371 17:82596501-82596523 CCCCGGGACCGCGCACACGTGGG + Intronic
1157557057 18:48619741-48619763 CCCCGGGCCCGCGCTCACCTGGG - Exonic
1160510691 18:79451895-79451917 CCCGGTGACCGTGCACAGGTGGG - Intronic
1163426976 19:17245427-17245449 GCCCGGCCCCGCGCACGCGTGGG - Exonic
1163535267 19:17872999-17873021 CCCCTCTAGCGCGCACACGTGGG - Intronic
1165924841 19:39320643-39320665 CGCCGGCACCGGGCACACATAGG + Intergenic
927053421 2:19350618-19350640 CCGCGGGACCGCGCAGGCGGTGG - Intergenic
932494708 2:72140618-72140640 CCCCGGGACCCCACAACCGTGGG + Intronic
948415363 2:237798951-237798973 CGCCGGGACCGGCCACACGCGGG - Intronic
1179960196 21:44763762-44763784 CCCAGGCACCGAGCACACCTGGG + Intergenic
1180049341 21:45324199-45324221 CCCCAGGACCCCACACAGGTGGG + Intergenic
1184046726 22:41976761-41976783 CCACGTGACCGCGCGCCCGTCGG - Intronic
1185051958 22:48558816-48558838 CCCAGGCACCTGGCACACGTGGG - Intronic
961574486 3:127823310-127823332 CCCGCGGGCCGGGCACACGTGGG - Intergenic
967184197 3:186931093-186931115 CCCCGGGGCTGTGCGCACGTGGG - Intronic
968662904 4:1806169-1806191 CCCCAGGGCCGGGCTCACGTTGG - Exonic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
970775464 4:19669124-19669146 CCCTGGGACAGAGCACATGTGGG + Intergenic
1002709970 5:181189539-181189561 CCGCGGGAGCGCGCGCGCGTGGG - Intergenic
1003644627 6:7904591-7904613 CCCCTGGGCGGAGCACACGTCGG + Exonic
1037297136 8:17413299-17413321 GCCCGGGACCCTGCAGACGTGGG - Exonic
1040501367 8:48008311-48008333 CCGAGGGACAGCGCGCACGTGGG - Intergenic
1041244894 8:55880296-55880318 CCCCGGGCCCGGTCACCCGTCGG - Intronic
1052264186 9:26552619-26552641 CTCCGGGACCACACACACCTTGG + Intergenic
1059470983 9:114504888-114504910 CCCCGGGAGCGCGGAGACGACGG + Exonic
1062125927 9:134862680-134862702 CACCGGGACCAGGCACAGGTCGG - Intergenic
1187616596 X:21001120-21001142 CCCCGGGCCCATGCACACGCAGG - Intergenic