ID: 1152846100

View in Genome Browser
Species Human (GRCh38)
Location 17:82600691-82600713
Sequence GTGGGCAGAACAGAGACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152846100_1152846106 7 Left 1152846100 17:82600691-82600713 CCAGCAGTCTCTGTTCTGCCCAC 0: 1
1: 0
2: 0
3: 32
4: 314
Right 1152846106 17:82600721-82600743 TGTGGACTGACCCAGGACACAGG 0: 1
1: 0
2: 1
3: 9
4: 206
1152846100_1152846104 0 Left 1152846100 17:82600691-82600713 CCAGCAGTCTCTGTTCTGCCCAC 0: 1
1: 0
2: 0
3: 32
4: 314
Right 1152846104 17:82600714-82600736 ACACCTCTGTGGACTGACCCAGG 0: 1
1: 0
2: 0
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152846100 Original CRISPR GTGGGCAGAACAGAGACTGC TGG (reversed) Intronic
900804180 1:4756530-4756552 TAGGGCAGAACAGAGATGGCTGG + Intronic
902570783 1:17345909-17345931 GTGGCCTGAACAGAGGCTCCTGG - Intronic
902735032 1:18394834-18394856 GATGGCAGAGCAGAGACTGTAGG + Intergenic
902886506 1:19408522-19408544 GTGGAGAGAACAGAGCCGGCAGG - Intronic
903297325 1:22352009-22352031 GGGGGAAGAACAGAGACAGGAGG - Intergenic
903393827 1:22984120-22984142 GAGGGCAGAATAGTGACTGCTGG - Intergenic
903913958 1:26749552-26749574 GTGGGGAGAAGAAAGACTGCTGG - Intronic
903970626 1:27116636-27116658 GTGGACAGTACAAAGACTGGGGG - Intronic
904196941 1:28792813-28792835 GTGGCCAGAGAAGAAACTGCAGG + Intergenic
904385738 1:30140832-30140854 GCTGGCAGAGCAGTGACTGCTGG - Intergenic
905234770 1:36538360-36538382 GTGGGAAGGACAGAGAATGATGG + Intergenic
905442852 1:38005721-38005743 GGGAGGAGAACAGAGGCTGCGGG - Intergenic
906636059 1:47411533-47411555 GTGGGTAGAGCAGGGACTGCAGG - Intergenic
906781359 1:48575798-48575820 ATGGGCAGGAGAGTGACTGCAGG - Intronic
907440483 1:54475395-54475417 GTGGTGGGTACAGAGACTGCCGG - Intergenic
908842779 1:68295674-68295696 GTGGGCAGGCCATAGACTGGCGG - Intergenic
908907922 1:69037862-69037884 TGGGGCAGAAAAGAGAGTGCAGG + Intergenic
911906196 1:103570996-103571018 CTGCACAGATCAGAGACTGCTGG - Intronic
911909660 1:103616832-103616854 CTGTACAGATCAGAGACTGCTGG - Exonic
913207573 1:116555117-116555139 GTGGTCAGAAAAGGGACTGTAGG + Intronic
913310076 1:117481078-117481100 CTGGGCAGAACAGTGGATGCTGG - Intronic
915281983 1:154829149-154829171 GTGGGCAGGACAGAGAGGCCAGG - Intronic
915310747 1:155004793-155004815 GTGGGCACAACACAACCTGCTGG + Intronic
915507699 1:156367934-156367956 CAGAGAAGAACAGAGACTGCAGG - Intergenic
915859053 1:159422608-159422630 TAGGGCAGGACAGAGACTGGTGG + Intergenic
919042569 1:192410318-192410340 CAGGGCAGAAAAGAGACTGGAGG - Intergenic
919060441 1:192625326-192625348 TGGGGCAGAACAGTGAATGCAGG - Intergenic
919727542 1:200893937-200893959 GTGGGAAGATCAGAGAGTGGGGG + Intronic
921047458 1:211487674-211487696 ATGAGCAGAATAGGGACTGCAGG - Intronic
922612107 1:226938425-226938447 GGAGGCAGAACATGGACTGCGGG + Intronic
922884091 1:229004699-229004721 GTGGGCAGAACACAGACGTGAGG + Intergenic
923520892 1:234734359-234734381 GACGGCTGAACAGAGACTTCTGG + Intergenic
924162474 1:241246896-241246918 TTGCGCAGAACTGAGAGTGCTGG + Intronic
924594593 1:245434487-245434509 GTGGCCATAGCAGATACTGCTGG + Intronic
1063024940 10:2168478-2168500 GGGGGCAGACCAGGGGCTGCAGG - Intergenic
1063179836 10:3588159-3588181 GTGGGCAGATTGGAGAGTGCAGG + Intergenic
1064048574 10:12041939-12041961 GTTGGCAGAGCAGAGCCAGCTGG - Intronic
1065748463 10:28863314-28863336 GTGGGCAGATCACCGACTCCAGG - Intronic
1066605362 10:37161620-37161642 GTGGGCACTCCAGAGACTACCGG + Intronic
1066607625 10:37196252-37196274 GTGGGCACTCCAGAGACTACCGG + Intronic
1067726472 10:48774743-48774765 ATGGGCAGTGGAGAGACTGCAGG + Intronic
1069633296 10:69910596-69910618 GGGGGCAGCACAGGGGCTGCTGG - Intronic
1069719523 10:70540755-70540777 CTGGGCTGCACATAGACTGCTGG - Intronic
1070476749 10:76836417-76836439 GTGGGCTGAGCAGGGGCTGCAGG + Intergenic
1070695034 10:78556700-78556722 GGGATCAGAACAGAGACTGTGGG - Intergenic
1070874053 10:79784653-79784675 GGGGACAGAAGAGAGAATGCAGG - Intergenic
1071083240 10:81838064-81838086 GTGTGCAGAAGAAAGACTCCTGG + Intergenic
1071336412 10:84604095-84604117 AAGGGCAGACCAGAGACTGCAGG - Intergenic
1071640985 10:87306792-87306814 GGGGACAGAAGAGAGAATGCAGG - Intergenic
1071654251 10:87431144-87431166 GGGGACAGAAGAGAGAATGCAGG + Intergenic
1072168584 10:92838289-92838311 GTGGGAAGAACACAGCCTGGTGG - Intronic
1073084643 10:100880292-100880314 GAAGGCAGAACAGAGACCCCTGG + Intergenic
1074087911 10:110222643-110222665 GAGGACAGAACAGAGACTATGGG + Intronic
1075409084 10:122214183-122214205 TTGGGCAGAAGAGAGTCTGATGG - Intronic
1077020237 11:414039-414061 GTAGGCAGAGGAGAGAGTGCAGG - Intronic
1077073509 11:689051-689073 GTGGGGTGAACAGAGCCTGCAGG - Intronic
1077930063 11:6721564-6721586 GCAGGCAGAACAGGCACTGCAGG - Intergenic
1077945972 11:6898970-6898992 ATGGGCAGAACACGGACAGCAGG + Intergenic
1080493574 11:32794348-32794370 TTGGGCAGGATTGAGACTGCGGG - Intronic
1083272161 11:61578041-61578063 GGGGGCAGAAGGGAGGCTGCAGG + Intronic
1084359847 11:68662052-68662074 GTGGGAAGAGCTGAGACTTCCGG - Intergenic
1085109806 11:73877397-73877419 GTGGTGAGTACAGAGACTTCTGG - Intronic
1089283313 11:117389781-117389803 GTGGCTAGAACAGAGTCTGTCGG + Intronic
1089393383 11:118117276-118117298 GAGACCAGAACAGAGACTGCTGG - Intronic
1089682677 11:120128104-120128126 GTGGGCAGAACAGACATTGGAGG + Intronic
1090511001 11:127375077-127375099 GTGGGCAGAAGAGTGAATGGGGG - Intergenic
1091969458 12:4773418-4773440 GTGGGCAAAGAAGAGATTGCAGG + Intronic
1092130944 12:6112778-6112800 CTGGGCTGAACTGAGGCTGCAGG + Intronic
1093010284 12:14100237-14100259 GTCTGCAGGTCAGAGACTGCTGG - Intergenic
1094221665 12:28000711-28000733 TTGGGCAGAACTGAGACTCGTGG + Intergenic
1094364890 12:29669869-29669891 GTGGGCAGAACAGAGAGAACTGG + Intronic
1094723160 12:33085820-33085842 GTGGGAAGAAGAGAGACTAAGGG + Intergenic
1096079656 12:48825047-48825069 GAGGGCAGAACAGAGAGGGGAGG + Intronic
1097125330 12:56770061-56770083 TTAGGCAGAACAGAGGCAGCTGG + Intronic
1097506453 12:60478827-60478849 GTGGGCAGTAGAGAGAATCCAGG - Intergenic
1097684371 12:62677710-62677732 GTGGGCAGAACAGGCCCAGCGGG + Intronic
1103975035 12:124696909-124696931 GTGGGTATAAAGGAGACTGCAGG + Intergenic
1104305754 12:127609846-127609868 GTGGGCAGCACGGAGAGTGTTGG - Intergenic
1104516414 12:129431260-129431282 GTGGGAACAACACAGACTCCAGG - Intronic
1106714293 13:32372483-32372505 GGTGGCAGAAGAGAGAGTGCAGG + Intronic
1108363260 13:49686724-49686746 CAGGGCAGAAGAGAGAGTGCTGG - Intronic
1109845948 13:67991087-67991109 GTGGGAAGAAGAGAGAGTGGGGG + Intergenic
1110742099 13:79009436-79009458 GAGGGCAGGAGAGAGACTTCTGG + Intergenic
1113540178 13:111101006-111101028 TCAGGCAGAAGAGAGACTGCTGG - Intergenic
1113558239 13:111255548-111255570 CCTGGCAGAACAGAGGCTGCAGG - Intronic
1113922208 13:113919506-113919528 GCGGGCAGCACAGGGCCTGCGGG - Intergenic
1116410278 14:44612960-44612982 GTTTGCAGATAAGAGACTGCAGG + Intergenic
1117343110 14:54808306-54808328 GTGGGCAGAGCAGGCCCTGCTGG - Intergenic
1119544586 14:75462275-75462297 GTGGAAAGACCAGAGACTCCTGG - Intronic
1119744187 14:77032836-77032858 GGGGGCAGGAGAGAGAGTGCAGG - Intergenic
1122721230 14:103723755-103723777 GTTGGCAAAACAGAGTCTGGTGG - Intronic
1123804296 15:23855166-23855188 GTGGGCAGGAGAGGGTCTGCTGG + Intergenic
1127540979 15:59938761-59938783 GTGGGCAGCAGACAGACTGGAGG + Intergenic
1128065820 15:64763814-64763836 GTGGGGGGAATAGAGACTGGGGG + Intronic
1128647743 15:69389478-69389500 GTGGGCAGAGAAGAGAAAGCAGG + Intronic
1129057808 15:72834297-72834319 GGAGTCAGAACAGAGACTTCTGG + Intergenic
1129181672 15:73881814-73881836 GGGGGCAGAAGATAGTCTGCAGG - Intronic
1129515824 15:76156840-76156862 GGGGGCAGATCACAGCCTGCAGG - Intronic
1129640743 15:77375342-77375364 GTGGCCAGCACAGAGGCTGTTGG - Intronic
1129682490 15:77665674-77665696 GTGGGCAGGTCAGCGTCTGCAGG - Intronic
1131636085 15:94234578-94234600 CTGAGCAGAGAAGAGACTGCTGG + Intronic
1132073686 15:98801376-98801398 GGGGGCAGAACAAAGAGAGCGGG + Intronic
1132376341 15:101330552-101330574 ATGGGCAGACCAGAGACAGCAGG - Intronic
1132525015 16:410152-410174 GTGGGCAGAGCGGAGGGTGCAGG - Intronic
1132860820 16:2070937-2070959 GAGGGCAGAGCTGAGACGGCAGG + Intronic
1133349660 16:5093152-5093174 GCGGGCAGGACAGAGGGTGCGGG + Intronic
1133900001 16:9965187-9965209 GCTGGCAGAACAAAGACTGCAGG + Intronic
1133937322 16:10279849-10279871 GCGGGCAGAGGAAAGACTGCTGG - Intergenic
1134383220 16:13747632-13747654 GTGGCCTGAATAGACACTGCAGG + Intergenic
1137680119 16:50334782-50334804 GTGGGGAGGACGGAGGCTGCTGG - Exonic
1138246172 16:55468680-55468702 GTGAGCAGAACAGAGAGTGGGGG + Intronic
1139574027 16:67830166-67830188 GTGGGCAGGACTGGGTCTGCTGG - Intronic
1140071382 16:71653343-71653365 CTTGTCAGAACAGGGACTGCTGG + Intronic
1141835769 16:86538299-86538321 TTGGGCAGAACAGAGCTTCCAGG + Intronic
1142672139 17:1492148-1492170 GTGGGCAGAACCGTGAATACTGG - Intronic
1143101289 17:4506158-4506180 GTGAGCGGGACAGAGGCTGCAGG - Intronic
1143477118 17:7209033-7209055 AGGGGAAGAACAGAGACAGCAGG + Intronic
1144913107 17:18699378-18699400 GTGGGCAGCACAGAGACCTTGGG + Intronic
1145086565 17:19947050-19947072 GTGGGCGGGACAGAAACTTCTGG - Intronic
1146589455 17:34116130-34116152 GTGCTCAGAAAAGGGACTGCAGG - Intronic
1146617912 17:34371306-34371328 GTGGGTGGAACACAGACTGCAGG - Intergenic
1148440909 17:47711212-47711234 GTGGGCAGAACAGGGAAAGGAGG - Exonic
1151147776 17:72057305-72057327 GTGGCCAGAATAGACTCTGCTGG + Intergenic
1151585624 17:75006689-75006711 GTGGCCAGAACAGAGGGTGGAGG + Intergenic
1152219958 17:79058174-79058196 ATGGGCAGTCCAGAGACAGCAGG - Intergenic
1152458693 17:80430285-80430307 GTGGGCAAAGCACAGGCTGCAGG - Intronic
1152637321 17:81435452-81435474 GTGGTCAGGACACAGGCTGCTGG - Intronic
1152846100 17:82600691-82600713 GTGGGCAGAACAGAGACTGCTGG - Intronic
1153179296 18:2415006-2415028 GTGGGCAGAGCAGAGGGTGCTGG + Intergenic
1155845410 18:30699504-30699526 CTGAGCAGAGCAGAGAATGCTGG + Intergenic
1156496549 18:37529527-37529549 GTGGGTGGAACAGAGGCTGGGGG + Intronic
1157525671 18:48378659-48378681 TTGGAAAGAACAGAGACTGCAGG + Intronic
1157785035 18:50474138-50474160 GTGGGCAGTGGAGAGCCTGCAGG - Intergenic
1158443545 18:57499135-57499157 GTGGGTAGAGGAGAGCCTGCGGG - Intergenic
1158749558 18:60243255-60243277 GTGTTAAGAACAGAGACTGGGGG - Intergenic
1159873008 18:73779427-73779449 TAGGGCAGAACAGAGACACCAGG + Intergenic
1160757476 19:765187-765209 CTGGGCAGAGCAGAGACTGAGGG + Intergenic
1160792308 19:928347-928369 GGGTGAAGAACAGAGACTCCTGG - Intronic
1160902942 19:1438262-1438284 GAGGGCAAAACACAGGCTGCAGG - Intergenic
1161011397 19:1961019-1961041 GTGGGCAGAGGAGAGGCTTCGGG + Intronic
1162090573 19:8277006-8277028 GTGGGGAGAACAGAACCTGCAGG - Intronic
1162092806 19:8291834-8291856 GTGGGGAGAACAGAACCTGCAGG - Intronic
1162420815 19:10565309-10565331 GAGGGCACAAGAGAGACAGCGGG + Intronic
1162780790 19:13006152-13006174 GTGGGAAGAACAGAGCTGGCCGG + Intronic
1165789481 19:38483051-38483073 GTGGGCAGGACGAAGACGGCAGG - Exonic
1166460759 19:42986080-42986102 CAGGGCAAAACAGAGCCTGCAGG - Intronic
1166478052 19:43146058-43146080 CAGGGCAAAACAGAGCCTGCAGG - Intronic
1167589941 19:50398983-50399005 GGAGGCAGAACACAGGCTGCAGG + Exonic
1167619684 19:50553860-50553882 GTGTGCAGAACGGAGAGTGGGGG - Intronic
1167751983 19:51387105-51387127 GGGGGCAGAACTGGGACTACAGG - Intronic
925383805 2:3447815-3447837 GAGGTCAGACCAGAGACTCCAGG + Intronic
925389800 2:3487039-3487061 GTGGGGAGAAGCCAGACTGCAGG + Intergenic
926389546 2:12374220-12374242 GGTGGCAGAAGAGAGACTGAAGG - Intergenic
927122575 2:19981176-19981198 GTGGGCAGAAGAGAGATTATAGG - Intronic
927633172 2:24792092-24792114 GTAGGCAGAACAGAAGCTGCTGG - Intronic
927664793 2:25023507-25023529 CTTGGCAGAACAGAGAAAGCTGG - Intergenic
927871469 2:26627052-26627074 GGGGGCCAAACAGAGACTCCAGG + Intronic
928304035 2:30151023-30151045 GTGGGCAGTACAGAAACAGGTGG + Intronic
930442281 2:51424596-51424618 GTGAGCAGAGCACAGCCTGCTGG - Intergenic
930872633 2:56184221-56184243 GTGTGCAGGGCAGAGAGTGCGGG + Exonic
932091408 2:68809283-68809305 ATGGGCAGAGCATAGAATGCCGG + Intronic
932091644 2:68811149-68811171 GTGGGCAGAGTATAGAATGCTGG + Intronic
932488372 2:72102242-72102264 ATGGGCAAAAGAGAAACTGCAGG - Intergenic
933686054 2:85141939-85141961 GTTGGCAGTAGGGAGACTGCAGG + Intronic
933817039 2:86076638-86076660 GTGGGCAGAGAAGTGACTTCGGG + Intronic
933865033 2:86508463-86508485 CTGGGCAGAACAGGTACTGGGGG + Intronic
934477407 2:94602661-94602683 GTGGGCAGGAAAGAGCCTGTTGG - Intronic
935549177 2:104433620-104433642 GGGGGCAGAATAGAGCCTGTTGG - Intergenic
936005408 2:108882835-108882857 GTGTGCAGATCTGGGACTGCTGG + Intronic
936069327 2:109354736-109354758 TTGTGAAGAACAGAGGCTGCGGG - Intronic
937235560 2:120429898-120429920 GTGGCCTGAGCAGAGACTGCTGG - Intergenic
937242847 2:120473739-120473761 GTTGGCAACACGGAGACTGCAGG + Intergenic
937543868 2:122990399-122990421 GTGGGCAGAACAAGCACAGCGGG + Intergenic
938246643 2:129782302-129782324 GCCGGCAGAACAAAGACTGGAGG + Intergenic
939105654 2:137945506-137945528 GGGTGCAGAACAGAGACTATGGG + Intergenic
939267462 2:139891908-139891930 GTGAGCAGAGCACAGCCTGCTGG + Intergenic
939321923 2:140634525-140634547 GTGTGCAGAACAAAGAATGAGGG + Intronic
939586189 2:144008893-144008915 GTGGGCAGAAATCAGACTGCAGG + Intronic
940117774 2:150228053-150228075 GTGTGCAGAACAGAAAAAGCAGG + Intergenic
940162943 2:150733321-150733343 GAGGGAAGAACAGAGACAGGTGG + Intergenic
940795077 2:158069349-158069371 GTGTGCAGAAGAGATATTGCAGG + Intronic
941173565 2:162169520-162169542 GTGTGCAGAACAGAGAGAGAAGG + Intergenic
941463193 2:165794509-165794531 GTAGCCAGAACACAGTCTGCTGG + Exonic
941704158 2:168640127-168640149 GTGGGGTAAAGAGAGACTGCTGG + Intronic
942349753 2:175039836-175039858 GTGGGGAGAACAGTCACAGCTGG - Intergenic
946083592 2:217149304-217149326 GTGAGCAGAACAGCTACTGGAGG - Intergenic
946641963 2:221793348-221793370 GTGGGAAGAACAAAGCCAGCCGG + Intergenic
947713183 2:232327239-232327261 GCGGGCAGCACTGAGGCTGCAGG - Intronic
948670437 2:239564969-239564991 GTGGGTAGAGAACAGACTGCTGG + Intergenic
948713325 2:239839543-239839565 GTGGGCAGAACAAACCCAGCGGG + Intergenic
1168789465 20:566519-566541 GAGGGCAGCAAAGAGAATGCAGG - Intergenic
1169128787 20:3151798-3151820 GTGGGAACAAAAGAGACAGCAGG + Intronic
1170745775 20:19097806-19097828 GTGGGGAGAAAAGAAAATGCAGG - Intergenic
1170816718 20:19720456-19720478 GTGGGAAGAACCGAGATTCCAGG + Intronic
1171955333 20:31457636-31457658 ATGAGCAGGACAGTGACTGCAGG - Intergenic
1173175511 20:40762002-40762024 ATGGGAAGAACAGAAACTACCGG - Intergenic
1173249695 20:41358007-41358029 GAGGGCAGAGAAGAGGCTGCTGG - Exonic
1175035077 20:55992638-55992660 GTGTGCAGAGGACAGACTGCAGG - Intergenic
1177144705 21:17394874-17394896 GTGGGCAGAATGGAGGCTTCTGG + Intergenic
1177255263 21:18653093-18653115 GTGGGCTCAACAGAGAATACAGG - Intergenic
1177527837 21:22319631-22319653 GTGGGCAGAACAGGCTCAGCAGG + Intergenic
1178696094 21:34793661-34793683 GTGGTCAGTATAGGGACTGCAGG + Intronic
1179584278 21:42365031-42365053 GTGGGCAAGACAGAGTCTGCCGG - Intronic
1182649965 22:31843677-31843699 GTGGGAAGGACAGAGGCTGTAGG - Exonic
1183285717 22:36961563-36961585 GTCAGCAGAACAGAGAGGGCTGG - Intergenic
1183583713 22:38740155-38740177 TTGGGCATAACAGAGGCTGCAGG + Intronic
1184242470 22:43218408-43218430 GCGAGCAGAACAGAGCCTGCAGG - Exonic
1184751041 22:46486937-46486959 GGGGCCAGAACAGAAACTGTTGG - Intronic
1185139403 22:49092060-49092082 TTGGGCAGCCCAGAGACTCCTGG + Intergenic
1185234337 22:49703467-49703489 GTGGGGAGATCAGAGACAGGCGG - Intergenic
949588198 3:5464506-5464528 GTGGGAAGAACAGAGCCTACAGG - Intergenic
950809606 3:15638394-15638416 CTGCACAGATCAGAGACTGCTGG + Intronic
953406080 3:42660447-42660469 TTGGGAAGAGCAGAGGCTGCTGG + Intronic
957293891 3:78311411-78311433 GTGAGCAGAAGAGAGAATGAAGG + Intergenic
959303681 3:104633482-104633504 GTGGGAAGAAAGGAGATTGCTGG - Intergenic
959890622 3:111551294-111551316 GTGGGAAGAACTGAGAGTCCAGG + Intronic
960593685 3:119389298-119389320 ATGGGAAGAACATAAACTGCAGG - Intronic
961172791 3:124810333-124810355 GAGGGCAGAATAGGGACTTCTGG + Intronic
962871315 3:139495288-139495310 TTGCACAGATCAGAGACTGCTGG - Intergenic
963836298 3:150061328-150061350 GAGGGCAGAAAGGACACTGCTGG - Intergenic
964661346 3:159123606-159123628 GTGGGCAGGACAGGGGCTGGGGG + Intronic
964757481 3:160101641-160101663 GTGGGGAGGACGGAGGCTGCTGG + Intergenic
967095011 3:186170441-186170463 CTTGTCAGAACACAGACTGCTGG - Intronic
969272510 4:6112556-6112578 CTTTGCAGTACAGAGACTGCTGG - Intronic
969948663 4:10811210-10811232 GTTGGCAGAACACAGATTACCGG + Intergenic
971254417 4:25001206-25001228 GTGAGCAGAATAGTGAGTGCAGG + Exonic
971461301 4:26900934-26900956 GTGGGGAGAAAAGACAATGCTGG - Intronic
971591409 4:28473722-28473744 TTGGCCAGAACAAAGGCTGCAGG - Intergenic
972464319 4:39339256-39339278 ATGCCCAGAAGAGAGACTGCTGG + Intronic
976389961 4:84497505-84497527 GTGGGCAGAACAGGCACGGCAGG + Intronic
981478433 4:145211218-145211240 TGGGGCAGCACAGAGACTTCTGG - Intergenic
983715305 4:170775771-170775793 GTGGGCACCACAGAGCCTGAGGG + Intergenic
984906642 4:184633683-184633705 CTGGGCAAAACCCAGACTGCTGG + Intronic
985383444 4:189420091-189420113 GTGTGCAGAAGAGAAACTGGCGG - Intergenic
985633047 5:1023502-1023524 GTGGGAAGAGCAGAGACAACGGG - Intronic
985835845 5:2271546-2271568 GTGGGCAGACCTGTGCCTGCAGG + Intergenic
988403632 5:30795829-30795851 GTACCCAGAAGAGAGACTGCTGG - Intergenic
988524424 5:31974586-31974608 GTCGGCAGAAGACAGACTCCTGG + Intronic
988829447 5:34973096-34973118 GAGGGCAGAAAACAGAGTGCAGG - Intergenic
993497555 5:88624584-88624606 GCGGGCAAAACTGAGAATGCAGG - Intergenic
995148477 5:108813762-108813784 GAGGGAAGAAGAGACACTGCTGG - Intronic
995621401 5:114029957-114029979 GTGGGCAGAACTTAGAATGGTGG + Intergenic
997464776 5:134079860-134079882 GAGGCCAGAACAGAGAATACAGG + Intergenic
997474395 5:134134192-134134214 CTGGGCAGAGCAGAGACTCTGGG + Intronic
997690558 5:135824964-135824986 GTTGGGAGCACAGACACTGCAGG + Intergenic
997761795 5:136455945-136455967 GTGGTCAAAACAGACACTGCTGG + Intergenic
997768197 5:136526200-136526222 GTGGTCTGATCAGATACTGCAGG - Intergenic
998136483 5:139676919-139676941 GGGGGCAGAATAGAGACAGGTGG - Intronic
998337678 5:141387944-141387966 CCGGGCAGAACAAAGACAGCAGG - Exonic
998338788 5:141398187-141398209 CCGGGCAGAACAAAGACAGCAGG - Exonic
999256408 5:150212076-150212098 GAGGGCAGGACAGGGACCGCAGG - Intronic
1000262903 5:159605879-159605901 TTGGGCAACACACAGACTGCTGG - Intergenic
1001554102 5:172624615-172624637 GTGGCCAGAACAGAGCCAGGAGG + Intergenic
1001819168 5:174696260-174696282 GTGAGCAGAACACAGCCTGAGGG - Intergenic
1001882602 5:175257767-175257789 GAGGGGTAAACAGAGACTGCAGG - Intergenic
1002526512 5:179818653-179818675 CAGGGCAGGACAGAGACTGCAGG - Intronic
1002880831 6:1251008-1251030 GTGGGCTGAGCACAGGCTGCAGG - Intergenic
1003219013 6:4140468-4140490 TTGTGCAGAACAGAGAAGGCAGG - Intergenic
1004072503 6:12313737-12313759 GTGGGCAGAGGAGAGCCTGGGGG + Intergenic
1004142894 6:13037114-13037136 GTGGGCAGAGCAGAGAATCATGG - Intronic
1004635786 6:17466319-17466341 GTTGTCAGAACTCAGACTGCTGG + Intronic
1006825312 6:36930418-36930440 GTGGGCTGAGCATAGACTGGAGG - Intergenic
1006987821 6:38188399-38188421 GCGGGCAGAGCAGGGACTGGTGG - Intronic
1007985875 6:46206432-46206454 CTGCACAGATCAGAGACTGCTGG - Intergenic
1010017784 6:71124568-71124590 GTGGGCTGAGCATAGACTGGTGG - Intergenic
1010057245 6:71581183-71581205 GAGGGGAGAACAGATACTGGGGG - Intergenic
1011735694 6:90308845-90308867 GATGGCAGAACAGAGTGTGCAGG + Intergenic
1012124341 6:95408829-95408851 ATGGGAACAACAGACACTGCAGG + Intergenic
1012431799 6:99171860-99171882 GTGGCCAGTACAGAGAGGGCAGG + Intergenic
1013385702 6:109628215-109628237 GTGAACAGAACAGATACTGGAGG - Intronic
1013571463 6:111430618-111430640 GTGGGGAGGACAGAGGCTGCTGG + Intronic
1013645968 6:112141678-112141700 GTGGCCACATCAGAGTCTGCTGG + Intronic
1013941133 6:115664280-115664302 ATGGGAATAACAGACACTGCAGG + Intergenic
1014755804 6:125301395-125301417 GTGGGAAGAACAGAATCTGTCGG - Intronic
1015155658 6:130092675-130092697 GTGGGCAGAACTTTGACTGTAGG + Intronic
1016091088 6:139980182-139980204 GTGGGCAGTTCAGGGACTGGAGG - Intergenic
1016518282 6:144921646-144921668 GTGCCCTGATCAGAGACTGCAGG - Intergenic
1016884908 6:148950163-148950185 CTTGGCAAAACACAGACTGCTGG + Intronic
1018854346 6:167664748-167664770 GTGAGCAGAGCAGAGAATCCAGG + Intergenic
1018854474 6:167665836-167665858 GTGAGCAGAGCAGAGAATCCAGG - Intergenic
1019002024 6:168761780-168761802 GTGAGGAACACAGAGACTGCAGG - Intergenic
1019603023 7:1894758-1894780 CTGGGCAGGACAGAGTCTGGAGG + Intronic
1019606416 7:1912443-1912465 GTGGCCACTGCAGAGACTGCAGG + Intronic
1019926608 7:4197132-4197154 CTGGCCAGGACAGAGACTGGTGG + Intronic
1021036347 7:15803980-15804002 GTGGCCAGAAAAGTGACTGAAGG - Intergenic
1021555592 7:21914991-21915013 GTGGGGAGAGCAGAGCCTGTTGG - Intronic
1021608783 7:22435950-22435972 GTGGGCAGAACACGGTCTGGTGG + Intronic
1022760955 7:33350545-33350567 ATGGGTAGAACATAGACTGAAGG - Intronic
1023913246 7:44569938-44569960 GTGTGCTGGACAGAGCCTGCGGG - Intronic
1023986157 7:45097729-45097751 GAGGGCAGAACAGATAGGGCAGG + Intergenic
1026030609 7:66789873-66789895 GTGTGCAGAACTGAGAAGGCTGG - Intronic
1026674581 7:72418137-72418159 ATGGGAAGAACAGACACTGGGGG - Intronic
1027141484 7:75660947-75660969 GTGGGAAGAGCAGTCACTGCAGG + Intronic
1029371466 7:100153613-100153635 GTGGCCAGACCAGAGACCCCAGG - Intronic
1029625601 7:101718569-101718591 CTGGGCAGAGCAGAGACTCTAGG + Intergenic
1030116434 7:106065410-106065432 GTTCCCAGAACAGAGGCTGCAGG - Intergenic
1031840227 7:126728831-126728853 GTGGGCAGAACAGGGAATAAGGG - Intronic
1032884014 7:136117913-136117935 GTGTGCAGGACAGAGAGGGCTGG - Intergenic
1033762501 7:144451063-144451085 GTAGCCATAAAAGAGACTGCAGG - Intergenic
1033801531 7:144907763-144907785 GTGGGCTGAGGAGAGACAGCAGG - Intergenic
1035746263 8:1963785-1963807 CAGGGCAGGACAGAGACTGGGGG - Intergenic
1036380470 8:8233184-8233206 GTGGGCAGGACAGAGGGTGTGGG - Intergenic
1036687962 8:10924372-10924394 GTGAGCAGAGCAGAGCCAGCCGG - Intronic
1036699683 8:11004035-11004057 GTGAGCAGAGCAGCGACAGCAGG + Intronic
1036849097 8:12189476-12189498 GTGGGCAGGACAGAGGGTGTGGG + Intronic
1036870458 8:12431750-12431772 GTGGGCAGGACAGAGGGTGTGGG + Intronic
1037920497 8:22802217-22802239 GTGGAGAGATCAGAGACTGAGGG - Intronic
1038833753 8:31094645-31094667 GTGGGCAGAACAGAGATAATAGG - Intronic
1039925495 8:41927947-41927969 TTTGGCAGAACAGAGTATGCAGG - Intergenic
1040011549 8:42665159-42665181 GTGGGCAGAATCCAGACTGATGG - Intergenic
1040293514 8:46137500-46137522 GTGAGAAGCAGAGAGACTGCAGG - Intergenic
1041536110 8:58927242-58927264 GAGGGCAGAACTGTGAATGCTGG + Intronic
1042104066 8:65305692-65305714 GTTGGCACATCACAGACTGCTGG - Intergenic
1042181582 8:66092989-66093011 ATGGGAATAACAGACACTGCGGG - Intronic
1042809027 8:72803835-72803857 GTTGGAAGAACAGAGAAAGCAGG + Intronic
1043414830 8:80036173-80036195 TTGGGCAGAAAAGAGACTTGAGG + Intronic
1043552152 8:81386600-81386622 GTAGGCAGAAGTGAGGCTGCTGG + Intergenic
1044255518 8:90055987-90056009 GTGGGCAGAAGGGAGGCTTCTGG - Intergenic
1046559908 8:115823296-115823318 GTTGGCAGAAGAGAGAATGAGGG + Intergenic
1047022887 8:120795423-120795445 GTGGTCAGGACAGAGAGAGCTGG - Intronic
1048430122 8:134362413-134362435 GCGGGCAGAGTAGACACTGCAGG + Intergenic
1049171184 8:141161728-141161750 GTGGTTAGCACAGAGCCTGCTGG + Intronic
1050422705 9:5483520-5483542 CTGGGCAAAACAGAGACTATGGG + Intergenic
1052609617 9:30756910-30756932 TTGGGCAAAGCAGAGACTGTGGG + Intergenic
1053135710 9:35649325-35649347 GGGGACAGGACAGAGACAGCAGG + Exonic
1056040808 9:82664752-82664774 GAGGGCAGAAAAGAGACAGAGGG + Intergenic
1057520481 9:95755808-95755830 GTGGGCAGCTCAGAGGCAGCTGG + Intergenic
1058901559 9:109446774-109446796 GAGAGCAGAACAGAGGCTTCTGG - Intronic
1061842767 9:133369205-133369227 GTGTGCAGAACTGACACTGCAGG - Intronic
1061992323 9:134166177-134166199 GTGGGCAGTGCACAGAATGCCGG - Intergenic
1062656507 9:137606576-137606598 GAGGACAGAACAGAGACTGTGGG - Intronic
1062702412 9:137914210-137914232 GAGGGAAGAGCAGAGAATGCTGG - Intronic
1186811111 X:13189537-13189559 GTGGGCTGAACATGGCCTGCAGG - Intergenic
1187009365 X:15264549-15264571 GTGGGCAGAAAAACGCCTGCAGG + Intronic
1187470687 X:19566857-19566879 GAGATCAGACCAGAGACTGCAGG + Intronic
1188604824 X:32015443-32015465 CTGGTCACAACAAAGACTGCCGG + Intronic
1189335712 X:40169765-40169787 GGGGGAAGAACCGAGACTGCTGG + Intronic
1190397000 X:49995166-49995188 TTGGGCAGAACAGTGACTGAAGG + Intronic
1194784987 X:98072086-98072108 GAAGACAGAACAGAAACTGCGGG + Intergenic
1194852613 X:98888211-98888233 GTGAGCATAACACAGTCTGCAGG + Intergenic
1195538271 X:106033708-106033730 GTGGGGAGAACAAATCCTGCGGG + Intronic
1198276491 X:135098988-135099010 GTGGGCGGAGCTGAGAATGCAGG - Intergenic
1198310014 X:135421760-135421782 GTGGGCGGAGCTGAGCCTGCGGG + Intergenic
1198439302 X:136646454-136646476 GTGGGCAGAAGTCAGACTGTAGG + Intergenic
1201784198 Y:17756657-17756679 CTGCACAGATCAGAGACTGCTGG + Intergenic
1201817355 Y:18149330-18149352 CTGCACAGATCAGAGACTGCTGG - Intergenic
1201961237 Y:19682605-19682627 GTTAGCAGAACAAAGACTGTAGG - Intergenic