ID: 1152847341

View in Genome Browser
Species Human (GRCh38)
Location 17:82609713-82609735
Sequence GTGAACAATAAGGGGCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152847334_1152847341 13 Left 1152847334 17:82609677-82609699 CCAGTCTAAGCAGCAGAGAAGAA 0: 1
1: 0
2: 1
3: 27
4: 410
Right 1152847341 17:82609713-82609735 GTGAACAATAAGGGGCCTATGGG 0: 1
1: 0
2: 0
3: 5
4: 96
1152847333_1152847341 14 Left 1152847333 17:82609676-82609698 CCCAGTCTAAGCAGCAGAGAAGA 0: 1
1: 0
2: 3
3: 20
4: 348
Right 1152847341 17:82609713-82609735 GTGAACAATAAGGGGCCTATGGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152847341 Original CRISPR GTGAACAATAAGGGGCCTAT GGG Intronic
905317102 1:37089710-37089732 GAGAAGAAAAAGGGGCATATGGG + Intergenic
910989699 1:93042281-93042303 GTGAACACCAAGTGGCCAATGGG - Intergenic
911211414 1:95142615-95142637 GTGTACAACAAGTGGCCAATGGG - Intronic
911659756 1:100488105-100488127 TTTAACATTTAGGGGCCTATGGG + Intronic
913273590 1:117117576-117117598 GTGAACCAAAAAGGGCCTAAAGG + Intronic
915744864 1:158148091-158148113 GTGAACACCAAGTGGCCGATGGG + Intergenic
1063894446 10:10665098-10665120 GTGAACAATGAAGGGGCTCTGGG - Intergenic
1066221830 10:33342743-33342765 TTGAACAATATGGGGGCTAGGGG + Intergenic
1067550145 10:47228637-47228659 GTGAACACCAAGTGGCCAATGGG + Intergenic
1070235625 10:74622505-74622527 GTATTCAATAAGGGACCTATTGG - Intronic
1070289301 10:75104299-75104321 CTGAAAGATAAGGGGCCCATGGG - Intronic
1071487325 10:86111095-86111117 GAGAAACATAAGGGGCCTACAGG - Intronic
1072036669 10:91569218-91569240 GTGAACATGAAGTGGCCGATGGG - Intergenic
1072472704 10:95728124-95728146 TTGAACAATGTGGGGGCTATAGG + Intronic
1075233320 10:120703364-120703386 ATCAACAGTAAGGGGCTTATGGG - Intergenic
1079529035 11:21426897-21426919 GTGAATAATATGGAGCTTATGGG + Intronic
1080678377 11:34449262-34449284 CTGAACAAGAAGGGGCCCACGGG - Exonic
1085357274 11:75850007-75850029 GTGAACACCAAGTGGCCAATGGG - Intronic
1085910322 11:80816984-80817006 GAGAACAAATAGGTGCCTATAGG - Intergenic
1086318488 11:85618834-85618856 GTAAACAATAATAGGCCTAAGGG + Intronic
1095267938 12:40181664-40181686 GTGAACAATAAAGAACCAATGGG - Intergenic
1095486674 12:42692277-42692299 GTGAACACAAAGTGGCCAATGGG + Intergenic
1108312095 13:49203869-49203891 GTTAATCCTAAGGGGCCTATAGG + Intronic
1109479172 13:62926434-62926456 TTGAATAACATGGGGCCTATGGG + Intergenic
1111290023 13:86154690-86154712 GTGAACAATCAGTGGAGTATTGG - Intergenic
1119724916 14:76916323-76916345 CTGTACAATAAGAGGCCTGTGGG - Intergenic
1120002877 14:79323419-79323441 TTGAATAATAATGGGCCTTTTGG - Intronic
1120421293 14:84289526-84289548 GTGAACTATAAAGGCCATATTGG - Intergenic
1121651638 14:95563181-95563203 GTGAACACCAAGTGGCCAATGGG + Intergenic
1129200680 15:73997098-73997120 GTGAACACCAAGTGGCCAATGGG - Intronic
1133075178 16:3274647-3274669 GTGAACACCAAGTGGCCAATGGG - Intronic
1133275531 16:4636201-4636223 GGGGACAATAGGGGGCCTCTGGG - Intronic
1136033307 16:27519216-27519238 GTGGAAAAGAAGGGGCCTACTGG + Intronic
1146818616 17:35965797-35965819 GTGAAGAAGAAGGGTCCTAAAGG + Intergenic
1152847341 17:82609713-82609735 GTGAACAATAAGGGGCCTATGGG + Intronic
1153797474 18:8637622-8637644 TTGAACAACAAGGGGGCTAGAGG + Intronic
1153800640 18:8665336-8665358 GTGAACACCAAGTGGCCAATGGG - Intergenic
1161348930 19:3781896-3781918 CTGAACAAAAAGGGGCTTACAGG + Intronic
1164461540 19:28453241-28453263 GTGAACATAAAGTGGCCAATAGG + Intergenic
1166952977 19:46442598-46442620 GTGAACACCAAGTGGCCAATGGG + Intergenic
1168646877 19:58065009-58065031 TTGAACAATGAGGGGGCTAGGGG - Intronic
936115477 2:109699327-109699349 GTGAACAATGCGGGGGCTAGGGG + Intergenic
940471460 2:154105193-154105215 GTGAACAATCACGGCCCTACTGG - Intronic
941035175 2:160560348-160560370 GTGGACAATATAGGGCATATGGG - Intergenic
941250988 2:163162185-163162207 GTGAACAACAAGTGGCCAATGGG - Intergenic
941945107 2:171087896-171087918 GAGAACAAGAAAGGGCCTAAGGG - Intronic
944522174 2:200583049-200583071 GTGATCAGAAAGGGGCATATTGG + Intronic
1169537507 20:6561030-6561052 GTGAACACCAAGTGGCCAATGGG - Intergenic
1171213729 20:23336620-23336642 GTGAACACCAAGTGGCCAATGGG + Intergenic
1173485620 20:43438860-43438882 GTGAACACCAAGTGGCCAATGGG + Intergenic
1179637554 21:42723117-42723139 GGGACCAAGGAGGGGCCTATGGG - Intronic
1180252010 21:46596259-46596281 GGGAACAGTAATGGGCCCATGGG + Intergenic
1185086166 22:48742193-48742215 GTGAAGGATGAGGGGCCTGTGGG - Intronic
1185086181 22:48742236-48742258 GTGAAGGATGAGGGGCCTGTGGG - Intronic
953271642 3:41451236-41451258 GGGAACAAGAGGGGGCCTTTGGG + Intronic
954613560 3:51958463-51958485 GAGAACAATAAGGGGAAGATGGG + Intronic
954891998 3:53939279-53939301 GTGACCACAAAGGGGCCTGTGGG - Intergenic
957952945 3:87148314-87148336 GTGAACAGCAAGTGGCCAATGGG + Intergenic
972362710 4:38343317-38343339 TTGAACAATAAGGGGATTAGGGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977376070 4:96205614-96205636 GTGAACAGTAGGGGACCTATGGG - Intergenic
978722092 4:111922704-111922726 GTGAACATGAAGGGGGATATGGG - Intergenic
982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG + Intronic
982187365 4:152816118-152816140 GAGAACAATTAGGAGCCTACTGG - Intronic
983102804 4:163645822-163645844 GTAAACAATAAGGGTCCTTTGGG + Intronic
984675788 4:182545841-182545863 TTGAACAATTAGGGGGCTAGAGG + Intronic
985279479 4:188271008-188271030 GTAAACAGTAAGGGTCCTAGGGG - Intergenic
992068557 5:73129249-73129271 GTGAACACAAAGTGGCCAATGGG - Intronic
997396256 5:133562379-133562401 GAGAACTATAAAGGGGCTATTGG + Intronic
999362550 5:150998161-150998183 GTGAACACCAAGTGGCCAATGGG - Intergenic
1007527568 6:42509870-42509892 GTGAACCTTAAGGGGCCTAGGGG - Intergenic
1009455909 6:63855760-63855782 GTGAAGAAGATGGGGGCTATTGG + Intronic
1011067396 6:83342154-83342176 GTGAACACTAATTGGCCAATGGG + Intronic
1015014720 6:128398204-128398226 GTGAACACCAAGTGGCCAATCGG - Intronic
1015118530 6:129675944-129675966 CTGATCAATAAGGGGCCACTGGG + Intronic
1018327006 6:162681759-162681781 GTGAACACCAAGTGGCCAATGGG + Intronic
1021288637 7:18815815-18815837 GAAAACAATAAGGGACATATGGG - Intronic
1025572262 7:62589377-62589399 GTGAGCAATTTGAGGCCTATGGG - Intergenic
1028469266 7:91186519-91186541 GTGAACCATTAGGAGCCAATTGG - Intronic
1030115979 7:106062627-106062649 GTGTACACCAAGTGGCCTATGGG - Intergenic
1030769959 7:113462589-113462611 GAGACCATTAAGGGGACTATTGG - Intergenic
1032369966 7:131339204-131339226 TTGAACAATGTGGGGCCTAGGGG - Intronic
1035043097 7:155945192-155945214 GTGAGCAGGAAGGGGCCAATGGG + Intergenic
1036462907 8:8969953-8969975 GTGAACACCAAGTGGCCAATGGG - Intergenic
1039304719 8:36249131-36249153 GTGAACATTCAGGGGCCCAAGGG - Intergenic
1042912157 8:73838925-73838947 GTGAACACCAAGTGGCCAATGGG + Intronic
1046773223 8:118137154-118137176 GTGAACACCAAGTGGCCAATGGG - Intergenic
1047914845 8:129571979-129572001 GTTCACATAAAGGGGCCTATTGG + Intergenic
1050493028 9:6209574-6209596 GTGGACAATGAGAGTCCTATAGG - Intergenic
1051231667 9:14961684-14961706 GTGACCACCAAGGGGCCAATGGG + Intergenic
1052039514 9:23721984-23722006 TTGAACAATTCGGGGGCTATGGG - Intronic
1058037817 9:100272590-100272612 GCAAACAAATAGGGGCCTATTGG - Intronic
1058782689 9:108354078-108354100 GAGAACAACAAGGGGGATATCGG - Intergenic
1059805534 9:117796092-117796114 GTAAACAATATGGTGCATATAGG + Intergenic
1061995552 9:134181082-134181104 GTGAAGAACAGGGGGCCAATGGG - Intergenic
1187437942 X:19289796-19289818 AAGAACAATAAGGGGTCTGTGGG - Intergenic
1192566570 X:72169064-72169086 GTGAACACCAAGTGGCCAATGGG - Intergenic
1192759684 X:74084294-74084316 GAGGCCAATAAGGGGGCTATAGG + Intergenic
1196781707 X:119389456-119389478 GTGAACATCAAGTGGCCAATGGG + Intergenic
1197716980 X:129716524-129716546 GTGAACACCAAGTGGCCAATGGG - Intergenic
1197739760 X:129880887-129880909 GTGAACACCAAGTGGCCAATGGG - Intergenic
1198054813 X:132983351-132983373 GTGACCAAAAAGGGTCCTAAAGG + Intergenic