ID: 1152847570

View in Genome Browser
Species Human (GRCh38)
Location 17:82611398-82611420
Sequence CACGTGAATCCAGGAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60712
Summary {0: 2, 1: 36, 2: 1350, 3: 14416, 4: 44908}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152847563_1152847570 9 Left 1152847563 17:82611366-82611388 CCCGGCTACTCAGGAGGCTGAGG 0: 1159
1: 100407
2: 205957
3: 239744
4: 153584
Right 1152847570 17:82611398-82611420 CACGTGAATCCAGGAGACAGAGG 0: 2
1: 36
2: 1350
3: 14416
4: 44908
1152847565_1152847570 8 Left 1152847565 17:82611367-82611389 CCGGCTACTCAGGAGGCTGAGGT 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947
Right 1152847570 17:82611398-82611420 CACGTGAATCCAGGAGACAGAGG 0: 2
1: 36
2: 1350
3: 14416
4: 44908
1152847561_1152847570 17 Left 1152847561 17:82611358-82611380 CCTGTAGTCCCGGCTACTCAGGA 0: 307
1: 42666
2: 160695
3: 220202
4: 208068
Right 1152847570 17:82611398-82611420 CACGTGAATCCAGGAGACAGAGG 0: 2
1: 36
2: 1350
3: 14416
4: 44908

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152847570 Original CRISPR CACGTGAATCCAGGAGACAG AGG Intronic
Too many off-targets to display for this crispr