ID: 1152848057

View in Genome Browser
Species Human (GRCh38)
Location 17:82614436-82614458
Sequence CACCTTGTCCTGTCACAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 224}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152848045_1152848057 28 Left 1152848045 17:82614385-82614407 CCCGACACAGGGAGTGAAGCTCC 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG 0: 1
1: 0
2: 1
3: 18
4: 224
1152848048_1152848057 7 Left 1152848048 17:82614406-82614428 CCAGGCTCCGCACCCAGTGACCC 0: 1
1: 0
2: 1
3: 21
4: 238
Right 1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG 0: 1
1: 0
2: 1
3: 18
4: 224
1152848046_1152848057 27 Left 1152848046 17:82614386-82614408 CCGACACAGGGAGTGAAGCTCCA 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG 0: 1
1: 0
2: 1
3: 18
4: 224
1152848051_1152848057 -5 Left 1152848051 17:82614418-82614440 CCCAGTGACCCTGGCTTCCACCT 0: 1
1: 0
2: 0
3: 21
4: 265
Right 1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG 0: 1
1: 0
2: 1
3: 18
4: 224
1152848052_1152848057 -6 Left 1152848052 17:82614419-82614441 CCAGTGACCCTGGCTTCCACCTT 0: 1
1: 0
2: 1
3: 34
4: 368
Right 1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG 0: 1
1: 0
2: 1
3: 18
4: 224
1152848050_1152848057 0 Left 1152848050 17:82614413-82614435 CCGCACCCAGTGACCCTGGCTTC 0: 1
1: 0
2: 3
3: 22
4: 322
Right 1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG 0: 1
1: 0
2: 1
3: 18
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152848057 Original CRISPR CACCTTGTCCTGTCACAGGC CGG Intronic
901124436 1:6919140-6919162 CATCTGGCCCTGTCAGAGGCAGG - Intronic
901953796 1:12769905-12769927 CACCTTCTCCTTCCACAGGGAGG + Intergenic
902041162 1:13493404-13493426 GACCTTCTACTGTCACAGGTGGG + Intronic
902395188 1:16128646-16128668 CACCTCCTCCTGTCCCAGGAAGG - Intronic
902427237 1:16333557-16333579 CGTCTTGCACTGTCACAGGCTGG - Intronic
902451932 1:16501679-16501701 CACCCTGTCCTGTCACCAGGTGG + Intergenic
902501023 1:16911985-16912007 CACCCTGTCCTGTCACCAGGTGG - Intronic
902772491 1:18653650-18653672 CACCATGTCCAGGCACAGGTCGG + Intronic
903067900 1:20711049-20711071 CACCTTGTTCTGTGACTTGCTGG + Intronic
903330259 1:22593510-22593532 CTCCTTGTCCTGCCACGGGACGG - Exonic
903664617 1:24998718-24998740 CACCTTGTCTGAGCACAGGCAGG - Intergenic
903831708 1:26179162-26179184 TACCTTGTCCAGGCACAGGCCGG + Intronic
906686925 1:47768932-47768954 CTCCTTGGCCTGTCTCAGGCTGG - Intronic
908646375 1:66282433-66282455 CTCCTTGTGATGTCAGAGGCTGG - Intronic
910651997 1:89579427-89579449 CACCTTGGCCTCTCAAATGCTGG - Intronic
913329234 1:117653484-117653506 CCTCCTGTGCTGTCACAGGCAGG - Intergenic
915423863 1:155807456-155807478 CACCTTGTCCTCCCAAAGTCTGG - Intronic
916216128 1:162396759-162396781 CACCTTCACCTGACACAAGCAGG + Exonic
919567766 1:199210011-199210033 CACCTGGACCTGTCAGAGGTGGG - Intergenic
921102805 1:211945096-211945118 CTCGTTGTCCTGGCACAGTCAGG - Intronic
1063369198 10:5509891-5509913 CACCCAGTCCTGGCACGGGCAGG + Intergenic
1064292439 10:14048199-14048221 CTCCGGGTCCTGTCACTGGCTGG - Intronic
1065611533 10:27475996-27476018 CACCTGGGCCTGCCTCAGGCTGG - Intergenic
1067110947 10:43399423-43399445 CACATTGTTCCCTCACAGGCAGG - Intronic
1067554545 10:47259458-47259480 CACCCAGTCCTGTTATAGGCAGG - Intergenic
1068570400 10:58621615-58621637 CACCATGCCCTGCCCCAGGCTGG - Intronic
1069667397 10:70172053-70172075 AACCCTGTCCTGTCACAGAAAGG + Intergenic
1070120385 10:73570658-73570680 CACCTTGACCTCCCAAAGGCTGG + Intronic
1070565504 10:77601065-77601087 CATCTTGGCCCTTCACAGGCAGG + Intronic
1071075138 10:81740889-81740911 CACCAGGGCCTGTCACAGGGTGG + Intergenic
1072629100 10:97133301-97133323 CACCTTGGCCTCCCAAAGGCTGG - Intronic
1072951046 10:99846939-99846961 CCCCTTGTCCTTTCACTTGCAGG + Exonic
1074428779 10:113375025-113375047 CACCTTCCCCTGGCCCAGGCTGG + Intergenic
1075704851 10:124494532-124494554 CTCCTTCTCCTGGCACAGGTGGG + Intronic
1075734424 10:124655179-124655201 CACAGTGTCCTGTCACATTCAGG + Intronic
1076611703 10:131730081-131730103 CTCCTGGGCCTGCCACAGGCTGG + Intergenic
1077228317 11:1447907-1447929 CACGCTGTCCTGCCTCAGGCCGG + Intronic
1077538201 11:3134473-3134495 CACCTTGAGCCTTCACAGGCTGG - Intronic
1079137782 11:17785939-17785961 CACCTGATCCTGTTTCAGGCTGG + Intergenic
1083636781 11:64125125-64125147 CACTCTCTCCTGGCACAGGCCGG - Intronic
1084120683 11:67067180-67067202 CACCTTGGGCGGGCACAGGCTGG - Intronic
1084337339 11:68467049-68467071 GACATTGTCATGTCACAGACTGG + Intronic
1085028255 11:73252902-73252924 CACCTGGAGCTGTCACAGGCTGG - Intergenic
1085445503 11:76598229-76598251 CATCTTGCCCTGTCACAGACTGG - Intergenic
1086037863 11:82438712-82438734 CACCTTGTGCAGCCTCAGGCAGG - Intergenic
1086669378 11:89528280-89528302 CAGCTTGCCATGTCTCAGGCAGG + Intergenic
1087880981 11:103416135-103416157 CACCAGGGCCTGTCCCAGGCTGG + Intronic
1088790563 11:113222548-113222570 CACTTAGTGCTGTCACAGGTTGG + Intronic
1089791901 11:120951687-120951709 TACCCTGTCTTGTCCCAGGCTGG - Intronic
1090036716 11:123255652-123255674 ACCCTTGTCCTGGCCCAGGCAGG + Intergenic
1090421984 11:126581738-126581760 CACCATGTCCTGTAATAGACAGG + Intronic
1093301917 12:17469670-17469692 CAGGTTGTTCTGTCAGAGGCAGG - Intergenic
1095799025 12:46252322-46252344 CACCGGGGCCTGTCACAGGGTGG + Intronic
1104307472 12:127622336-127622358 CACCTTGTAGTGACAGAGGCAGG - Intergenic
1105013709 12:132773290-132773312 CTCCTTCTTCTGTCCCAGGCAGG - Exonic
1105677158 13:22684127-22684149 CACCTGGGCCTGTCAGGGGCTGG - Intergenic
1107432017 13:40348792-40348814 CACCTTGCCCTCTCACATGCTGG + Intergenic
1107567229 13:41617645-41617667 CACCAGGGCCTGTCACAGGGCGG - Intronic
1107728031 13:43319676-43319698 CACCTCCTCCCGGCACAGGCAGG + Intronic
1108559258 13:51627071-51627093 TACCTGGTCCAGCCACAGGCTGG - Intronic
1110120277 13:71871223-71871245 CTCCTTGTCCTGTCACTGAAAGG - Intergenic
1110130875 13:72008413-72008435 CACCGTGTCCTGTCATGGGGTGG - Intergenic
1113030966 13:105993155-105993177 CACCATGCCCAGTCACAAGCAGG + Intergenic
1113134449 13:107074082-107074104 CACTTTGACATGTCACAGGGAGG + Intergenic
1113254425 13:108491889-108491911 CACCTTGTCCTTTGACACGCCGG - Intergenic
1114621441 14:24098659-24098681 TACCTTGTCCTGTCAGGGGCTGG - Exonic
1116687090 14:48053448-48053470 CCCCCTGTCCTGTCATAGGCAGG + Intergenic
1117920382 14:60722055-60722077 CACCTTCACCTGGCGCAGGCGGG + Intronic
1118898093 14:69963699-69963721 CACCTTGACCTCCCACAGGAAGG - Intronic
1121105551 14:91277261-91277283 CACCTTGGCCTCCCAAAGGCTGG + Intronic
1121122338 14:91383761-91383783 CACATTGTGCTGTGACAGGGAGG + Intronic
1122882106 14:104694851-104694873 CGTCTTGTCTTGGCACAGGCAGG + Intronic
1123035846 14:105471632-105471654 CACCTAGTCCTGTCACTGCTGGG - Intergenic
1125476943 15:40054153-40054175 AACCTGGACCTGTGACAGGCAGG + Intergenic
1125530678 15:40411500-40411522 CATCTTGGCCTGTCTCAGCCAGG - Intronic
1126170050 15:45687877-45687899 CACCTGGTCCTGCCTCAGCCAGG + Intronic
1126475523 15:49061917-49061939 CACATTGACTTGTAACAGGCAGG + Intergenic
1127251516 15:57243533-57243555 CACCTTCACCTCTCACAGGTAGG + Exonic
1127328102 15:57915027-57915049 CACCCTTTCCAGTCACATGCTGG + Intergenic
1128760764 15:70214779-70214801 AACCTGGTCCTGCCACAGGGTGG + Intergenic
1129539771 15:76340260-76340282 CACCCTGTCCTGGCAGACGCTGG + Exonic
1131133733 15:89916975-89916997 CATCTTGTCCTGACAAAGTCTGG + Intergenic
1132146495 15:99432751-99432773 CACCGTATCCAGTCACTGGCTGG + Intergenic
1132651747 16:1024298-1024320 GACATTGTCCCGTCACAGGTGGG + Intergenic
1133155703 16:3874021-3874043 CACCTTCTGGTGTCACAGGAAGG + Intronic
1135052409 16:19203714-19203736 CACCTTTGCCTGGCACAGGGTGG + Intronic
1136412243 16:30084341-30084363 CACCCTGTGTTGTCACAGGGAGG - Intronic
1140884238 16:79228925-79228947 CACCGTGCCCTGTCTCAGACTGG - Intergenic
1141016878 16:80459087-80459109 CACCTTGTCATGTTACAGATGGG - Intergenic
1144193568 17:12868902-12868924 CACCTTGGCCTCCCAAAGGCTGG + Intronic
1145790039 17:27620842-27620864 CACCTTCTCATTTCACAGGCAGG + Intronic
1146224284 17:31052233-31052255 CACCCTTTCCTGTCACATGATGG + Intergenic
1147783711 17:42962780-42962802 CACCTTGGCCTCCCAAAGGCTGG - Intronic
1148071196 17:44909838-44909860 CACCTCTTCCTGTCACTGGGAGG - Intronic
1149054217 17:52343490-52343512 CACCTGGGCCTGTCACGGGGTGG - Intergenic
1150917948 17:69455578-69455600 AAACCTGTCCTGTCAAAGGCGGG + Intronic
1152418919 17:80181560-80181582 CACCTTGGCCTGGCGCAGGTAGG - Exonic
1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG + Intronic
1153547005 18:6218508-6218530 TACCTGGTCCTGTCCCAGCCTGG + Intronic
1154247662 18:12713997-12714019 CACCTTGGCCTTTCAAATGCTGG + Intronic
1155073556 18:22336395-22336417 CAGCCAGTCCTGTCTCAGGCCGG - Intergenic
1155809984 18:30220227-30220249 CACCATGGCCTGTCAGGGGCTGG + Intergenic
1155983872 18:32209236-32209258 CACCTTGGCCTCCCAAAGGCCGG - Intronic
1156117466 18:33803158-33803180 CCCCGTGTGCTGTGACAGGCGGG + Intergenic
1159184464 18:64950563-64950585 CACATTGTCATGGCACTGGCGGG + Intergenic
1159465419 18:68776645-68776667 CACCGTGGCCTGTCAGAGGGTGG + Intronic
1160426258 18:78781256-78781278 CACCTGGGCCTGTCGCAGTCAGG - Intergenic
1160468379 18:79103160-79103182 CACCTTGTTCTTTCCCAGGTGGG + Intronic
1160849562 19:1183838-1183860 CACCTTGGCCCTTCCCAGGCAGG + Intronic
1161237191 19:3204008-3204030 CACATTGTCCTGAAGCAGGCTGG - Exonic
1161361780 19:3854092-3854114 CACTGTGCCCTGACACAGGCAGG + Intronic
1161670791 19:5607789-5607811 CACCTTGTCATTTCACAGTTGGG - Intronic
1166245944 19:41525695-41525717 CACCAGGTCCTGTCAGAGGGTGG + Intergenic
1166581261 19:43902085-43902107 CAACTTCTCCTCTCACACGCAGG - Intergenic
1166768700 19:45267384-45267406 CACCTTGGCCAGTACCAGGCAGG + Intronic
1167747002 19:51357737-51357759 CACCTCGGCCTCTCAAAGGCAGG + Intronic
1168265317 19:55220327-55220349 CTCTTTGTCATCTCACAGGCAGG + Intergenic
925117264 2:1390174-1390196 CACCGGGGCCTGTCAGAGGCTGG - Intronic
926243470 2:11105124-11105146 AACCTCGTCCTGTCACAGCGTGG - Intergenic
929519640 2:42636289-42636311 CACCTTGGCCTCCCAAAGGCTGG - Intronic
930006537 2:46901825-46901847 CAGCTTCTCCTGCCACATGCAGG - Intergenic
931899643 2:66773130-66773152 CATCTTGTCCTATCCCTGGCTGG + Intergenic
932193447 2:69761747-69761769 CATCTTGCTCTGTCACAGACGGG - Intronic
933164401 2:79060140-79060162 CACTTGGTCCTCTCACTGGCTGG - Intergenic
933195768 2:79387737-79387759 GACCTTTTCCTGGCAAAGGCAGG + Intronic
935332371 2:101986424-101986446 CTCTGTGTCCTGTCACGGGCTGG - Intergenic
935707151 2:105866795-105866817 TACTTGGTCCTGACACAGGCTGG + Intronic
936252118 2:110874974-110874996 TCCCTTGTCCTGCCACCGGCAGG + Intronic
937205418 2:120233514-120233536 CACCTCGTCCTGTTAGAGGAGGG + Intergenic
937999455 2:127720248-127720270 GACCTTGTCCTGGAAAAGGCTGG + Exonic
943882169 2:193159432-193159454 GACCTTGCCCTGTCACATTCTGG + Intergenic
947620164 2:231584904-231584926 CACCTTGGCCTCCCACATGCTGG + Intergenic
947730912 2:232431179-232431201 CACCTTGGCCTCCCAAAGGCGGG - Intergenic
948213996 2:236215397-236215419 CACCCTGTCCTCTGACAGTCCGG + Intronic
948621421 2:239237280-239237302 CACCTAAACCTGGCACAGGCTGG + Intronic
948913543 2:241018609-241018631 CACCCAGACCTGTCACAGGGCGG + Intronic
1170258681 20:14377424-14377446 CACCTTGTCCTGTCACTGTTTGG + Intronic
1170592969 20:17785170-17785192 CACAGTCTGCTGTCACAGGCTGG - Intergenic
1170594127 20:17792725-17792747 CACCATGTTCGGTCACTGGCAGG - Intergenic
1170933754 20:20792308-20792330 CACCTTGTCCAGTCTTTGGCAGG - Intergenic
1171781025 20:29417842-29417864 CACCTTGTCCTGTCTCACTGCGG - Intergenic
1172095980 20:32460731-32460753 CACCTCAGACTGTCACAGGCTGG - Intronic
1172483124 20:35283473-35283495 CACCTTGCCCAGTCAGTGGCAGG + Intronic
1172906906 20:38377216-38377238 GCCCTTGTCCTGTCTCAGGCAGG + Intergenic
1174158925 20:48536578-48536600 CACCTTGTGCTGTCTCACCCTGG - Intergenic
1175468385 20:59208416-59208438 CACCTGTGCCTGTCACAGGACGG - Intronic
1176379876 21:6106965-6106987 CACCATGTTCTGGCACAGTCTGG + Intergenic
1176520685 21:7821886-7821908 CACCCTGTCCTGTCAGAGACTGG + Intronic
1176667203 21:9698806-9698828 CACCTAGTTCTGTCATTGGCTGG + Intergenic
1177094655 21:16817994-16818016 CACCTCGGCCTGTCAAAGGCTGG + Intergenic
1177117593 21:17104901-17104923 AACTCTGTCCTGTCTCAGGCAGG - Intergenic
1177209382 21:18051084-18051106 CACCAGGTCCTGTCAGGGGCTGG - Intronic
1178654708 21:34451898-34451920 CACCCTGTCCTGTCAGAGACTGG + Intergenic
1179743598 21:43431272-43431294 CACCATGTTCTGGCACAGTCTGG - Intergenic
1181054195 22:20252391-20252413 CACCTTGGGCTGTCCCAGGGAGG - Intronic
1181510944 22:23388501-23388523 CAGCTTTCCCTGGCACAGGCGGG + Intergenic
1182031045 22:27159704-27159726 CACCTTCTCCAGTCACAGATGGG - Intergenic
1182420461 22:30246212-30246234 CACCTGCTCCCGTCCCAGGCCGG + Intronic
1184412447 22:44332772-44332794 CACCTTCCCCTGTCCCTGGCCGG + Intergenic
1184659509 22:45959452-45959474 CAGCTTGTCCTGTTGCTGGCGGG - Intronic
1184802874 22:46773238-46773260 GCCCGTGTCCTGTCACAGGGTGG + Intronic
1184982383 22:48103720-48103742 CACTTTGCCCTTTCCCAGGCTGG + Intergenic
1185049480 22:48546314-48546336 CACCTTGCCCTGGGACGGGCAGG - Intronic
953852854 3:46479213-46479235 CAGCCTGACCTGTGACAGGCAGG + Intronic
954257339 3:49415940-49415962 CACCTTGTCCCCTCATAGGATGG + Exonic
957969650 3:87366536-87366558 CACCTTGGCCTCCCAAAGGCTGG - Intergenic
961087828 3:124084310-124084332 CACCATGACCTGTCACAGGGAGG - Intronic
962149095 3:132873610-132873632 CAAGTTGTCCTTTCACAGTCTGG - Intergenic
963794397 3:149617173-149617195 CACCTTGTCATGGCACAAGGTGG - Intronic
965221883 3:165936414-165936436 CACCTGGGCCTGTCAGAGGGTGG + Intergenic
966917396 3:184592678-184592700 CATCTGCTCCTGGCACAGGCAGG + Intronic
966918560 3:184597950-184597972 AACCTTGTCCTGTCCCACACAGG - Intronic
971818366 4:31519671-31519693 CACCTTGGCCTCCCAAAGGCTGG - Intergenic
975584110 4:75933103-75933125 AGTCTTGTTCTGTCACAGGCTGG - Intronic
978015692 4:103743291-103743313 CACTGGGTCCTGTCACGGGCTGG + Intergenic
979474159 4:121135123-121135145 CACCATGTCCTGTCACAGACTGG + Intronic
981808874 4:148750554-148750576 CAATGTTTCCTGTCACAGGCTGG + Intergenic
983257147 4:165412634-165412656 CACTCAGTCCTGTCTCAGGCAGG + Intronic
985407805 4:189653528-189653550 CACCTAGTTCTGTCATTGGCTGG - Intergenic
985447024 4:190028145-190028167 CACCTTGTCCTGTCTCACTGAGG - Intergenic
985512116 5:318794-318816 CACCTTTGCCTCCCACAGGCAGG - Intronic
985520507 5:372053-372075 CACCTTCTCCCCTCACAGGAAGG + Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985811687 5:2094781-2094803 CACCTTGTCCTTTCCCAGCCAGG - Intergenic
988089216 5:26513851-26513873 CACCAGGGCCTGTCACAGGTTGG - Intergenic
989499540 5:42149738-42149760 CACCATCTGCTTTCACAGGCTGG - Intergenic
990751928 5:59025859-59025881 CACCTTGGCCTGTCATAAACAGG - Intronic
991134623 5:63166976-63166998 CTTCTTGTCCAGTCACAGGATGG - Intergenic
994676898 5:102834712-102834734 CTCCTTTTCTTTTCACAGGCAGG - Intronic
994970328 5:106729851-106729873 CACCATGACCTGTCATAGGGTGG + Intergenic
995427264 5:112039353-112039375 CACCAGGGCCTGTCACAGGATGG + Intergenic
996872964 5:128212420-128212442 CCCCTTTTCATGTCCCAGGCAGG - Intergenic
999764050 5:154724913-154724935 CACCTTGGCCTCCCAAAGGCTGG + Intronic
1001535121 5:172492659-172492681 CACCCTTTCCTTCCACAGGCTGG - Intergenic
1001655359 5:173344891-173344913 CACCTGGTGCCGTCACATGCGGG + Intergenic
1001796528 5:174506725-174506747 CACCTTGGCCTCCCAAAGGCTGG - Intergenic
1005561865 6:27048684-27048706 CACCTTGGCCTCTCAAAAGCTGG + Intergenic
1007620443 6:43210223-43210245 CACCTTGGCCTGCCAAAGTCTGG + Intronic
1013176436 6:107681302-107681324 CACCTTGGCCTCCCAAAGGCTGG + Intergenic
1014302585 6:119701085-119701107 CACCTGACCCTGTAACAGGCAGG + Intergenic
1016863863 6:148747384-148747406 GACCTTTTCCTGGCACGGGCAGG + Exonic
1020249756 7:6458174-6458196 CACCATGTCCAGTTTCAGGCTGG + Intronic
1023076214 7:36485227-36485249 CACTTTCTCCTGTCACAGTAAGG + Intergenic
1024551116 7:50562916-50562938 CACCTTGGCCTCCCAAAGGCTGG - Intronic
1024634577 7:51276586-51276608 CACCTTGTGCAGTCCCTGGCGGG - Intronic
1028526034 7:91787849-91787871 CACCTTGTCCAGTGACTTGCAGG - Intronic
1029276106 7:99405332-99405354 CACGATGTTCTGTCACAGCCAGG + Intronic
1031320489 7:120320530-120320552 CACTTTATCCTGTCAAAGACAGG + Intronic
1031529097 7:122854566-122854588 CACCTTGTTCTGGCACAGCTAGG - Intronic
1031612010 7:123839142-123839164 CACCGTGGCCTGTCAGAGGTGGG - Intronic
1033172497 7:139096353-139096375 CCCCCTCTCCTCTCACAGGCTGG + Intronic
1034704168 7:153125606-153125628 CACCTTGTCCTCTGGCAGCCAGG + Intergenic
1035314796 7:157991110-157991132 CGCCTTGGCTTGTGACAGGCTGG - Intronic
1037042751 8:14257638-14257660 CACCTGGGCCTGTCATAGGGCGG - Intronic
1039591382 8:38752724-38752746 CTCCTTCTTGTGTCACAGGCAGG + Intronic
1048267499 8:133000332-133000354 CCCCTTGCCCTCCCACAGGCTGG + Intronic
1049462842 8:142738128-142738150 CACCCTGGGCTGTCATAGGCTGG + Intergenic
1050529740 9:6578148-6578170 GATCTTGCTCTGTCACAGGCTGG + Intronic
1053052858 9:34976378-34976400 CACCTATCCCTGTCACAGCCTGG + Intronic
1053458160 9:38247192-38247214 CACCATCTCCTGTTTCAGGCTGG - Intergenic
1054955694 9:70907268-70907290 CACCTTGTCCTGCCTCAGCTGGG - Intronic
1055039326 9:71851884-71851906 CACCTTGGCCTCTCAAATGCTGG + Intergenic
1055895363 9:81168417-81168439 CACCTGGGCCTGTCACCGGCGGG + Intergenic
1056807041 9:89736909-89736931 AACCATGTCCTGAAACAGGCAGG - Intergenic
1057005408 9:91553327-91553349 CACCTTGCCCTGTCCCAGCTGGG - Intergenic
1057299698 9:93870713-93870735 CACCCTCTCCTCTCACAGGTGGG + Intergenic
1057957939 9:99426210-99426232 ATCCTTGTCCTGTCACTGGATGG + Intergenic
1058320785 9:103627973-103627995 GAGCTTGTCATGTCACAGGAAGG + Intergenic
1058736603 9:107899745-107899767 GGCCATGTCCTGTCCCAGGCTGG + Intergenic
1060265382 9:122108929-122108951 CACCTGGCCCTGCCTCAGGCAGG + Intergenic
1060519503 9:124286376-124286398 CACCTTCTCATTTCACAGCCGGG - Intronic
1203658894 Un_KI270753v1:22954-22976 CACCTAGTTCTGTCATTGGCTGG - Intergenic
1186223534 X:7374582-7374604 CATCTTGTCCAGCCACAGCCTGG - Intergenic
1188667164 X:32838402-32838424 CACCATGGCCTGTCAGAGGGTGG - Intronic
1190107996 X:47572921-47572943 CACCTCGTCCTGGCTAAGGCTGG + Exonic
1191103638 X:56759135-56759157 CACATTGTCCTGGCACATGCAGG - Intergenic
1199082337 X:143590966-143590988 CACCTTTCCCTGGCACTGGCTGG - Intergenic
1200047180 X:153409218-153409240 CACCTAGCCCTCTCACAGTCCGG - Intergenic
1200250978 X:154553591-154553613 GACCCTGTCCTGGAACAGGCAGG - Intronic
1201377165 Y:13335174-13335196 CACCAGGGCCTGTCAAAGGCTGG + Intronic
1201681846 Y:16654780-16654802 CACCAGGTCCTGTCAGGGGCTGG - Intergenic
1201862114 Y:18610271-18610293 CACCTTGGCCTGTCAAGTGCTGG + Intergenic
1201871209 Y:18710109-18710131 CACCTTGGCCTGTCAAGTGCTGG - Intergenic
1202084304 Y:21119555-21119577 CACCTTGGCCTCTCAAATGCCGG + Intergenic