ID: 1152859776

View in Genome Browser
Species Human (GRCh38)
Location 17:82689398-82689420
Sequence CAAGCCAGCCAGGTTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 200}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152859776_1152859784 22 Left 1152859776 17:82689398-82689420 CCTGGAGAAACCTGGCTGGCTTG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1152859784 17:82689443-82689465 CACTGGAAATCAGGTTCACCTGG 0: 1
1: 0
2: 0
3: 9
4: 132
1152859776_1152859788 29 Left 1152859776 17:82689398-82689420 CCTGGAGAAACCTGGCTGGCTTG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1152859788 17:82689450-82689472 AATCAGGTTCACCTGGGGCTGGG 0: 1
1: 0
2: 4
3: 18
4: 193
1152859776_1152859789 30 Left 1152859776 17:82689398-82689420 CCTGGAGAAACCTGGCTGGCTTG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1152859789 17:82689451-82689473 ATCAGGTTCACCTGGGGCTGGGG 0: 1
1: 0
2: 1
3: 30
4: 292
1152859776_1152859786 24 Left 1152859776 17:82689398-82689420 CCTGGAGAAACCTGGCTGGCTTG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1152859786 17:82689445-82689467 CTGGAAATCAGGTTCACCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 236
1152859776_1152859787 28 Left 1152859776 17:82689398-82689420 CCTGGAGAAACCTGGCTGGCTTG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1152859787 17:82689449-82689471 AAATCAGGTTCACCTGGGGCTGG 0: 1
1: 0
2: 2
3: 12
4: 190
1152859776_1152859785 23 Left 1152859776 17:82689398-82689420 CCTGGAGAAACCTGGCTGGCTTG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1152859785 17:82689444-82689466 ACTGGAAATCAGGTTCACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 171
1152859776_1152859782 13 Left 1152859776 17:82689398-82689420 CCTGGAGAAACCTGGCTGGCTTG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1152859782 17:82689434-82689456 CCAGCCTGTCACTGGAAATCAGG 0: 1
1: 0
2: 2
3: 7
4: 141
1152859776_1152859778 5 Left 1152859776 17:82689398-82689420 CCTGGAGAAACCTGGCTGGCTTG 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1152859778 17:82689426-82689448 AGCCTCTCCCAGCCTGTCACTGG 0: 1
1: 0
2: 4
3: 38
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152859776 Original CRISPR CAAGCCAGCCAGGTTTCTCC AGG (reversed) Intronic