ID: 1152859879

View in Genome Browser
Species Human (GRCh38)
Location 17:82690162-82690184
Sequence CTGAAGAATCAGAGGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 469}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152859873_1152859879 27 Left 1152859873 17:82690112-82690134 CCAAGGGAAACCAGAAGAGTAGC 0: 1
1: 2
2: 2
3: 41
4: 390
Right 1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG 0: 1
1: 0
2: 5
3: 43
4: 469
1152859874_1152859879 17 Left 1152859874 17:82690122-82690144 CCAGAAGAGTAGCTGTATTAATC 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG 0: 1
1: 0
2: 5
3: 43
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152859879 Original CRISPR CTGAAGAATCAGAGGGAGCA TGG Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
901098031 1:6698217-6698239 TTGAAGTATCAGTGGGAACAGGG + Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902099560 1:13974701-13974723 CTGAGGAAGCAAAGGAAGCAAGG + Intergenic
902650059 1:17831229-17831251 CTGGGGAATGAGAGGGAGTAGGG + Intergenic
903764568 1:25725851-25725873 CTGAAGAATGAGAGGGTGCTCGG + Intronic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
904456826 1:30652777-30652799 CTGAAGAAATAGAGTGAGCCAGG + Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
905184498 1:36186806-36186828 CTAGAGATTGAGAGGGAGCATGG + Intergenic
906004054 1:42454060-42454082 CTGAAGGATGAAAGGGAGCCAGG + Intronic
906130930 1:43455270-43455292 CAGAACAATCAGTGGGAGCTGGG - Intergenic
906270344 1:44472892-44472914 AAGAAGGATCAGAGGGAGAAAGG - Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
906552285 1:46674970-46674992 CTGAAGAAGCAAAGGCTGCAGGG - Intergenic
906735975 1:48128574-48128596 CTGAGAAATTGGAGGGAGCAAGG + Intergenic
906792224 1:48669044-48669066 CAGAAGAAACACAGGGAACACGG - Intronic
907074987 1:51570039-51570061 CTTGAAAATCAGAGGTAGCATGG - Intergenic
907333149 1:53684391-53684413 CCCAGGAGTCAGAGGGAGCAGGG - Intronic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909690293 1:78399259-78399281 CTGCAGAATCCAAGGGACCAGGG - Intronic
910750270 1:90621484-90621506 CTCAAGAAGAAGAGGGAGAAAGG - Intergenic
911439282 1:97905243-97905265 CTAAAGATGCAAAGGGAGCAAGG + Intronic
911885764 1:103297078-103297100 CTTAAGGATCAGAGGAATCAGGG + Intergenic
912522706 1:110256900-110256922 GTCAAGAATCAGAGGAAGAAAGG + Intronic
913008399 1:114657905-114657927 CTAAAGAAGGAGAGAGAGCATGG + Intronic
915277917 1:154802392-154802414 TTGAAAAAACACAGGGAGCAGGG + Intronic
915815749 1:158963009-158963031 CTGAGGATTCATAGGGAGGAGGG - Intronic
916008200 1:160680864-160680886 CTGAAACATCAGGGTGAGCAGGG - Intronic
916461070 1:165025017-165025039 CTGAGGAATTTGAGGGAGCCAGG + Intergenic
916838141 1:168570439-168570461 ATGAAGAATGAGAGAGAGCATGG - Intergenic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917503719 1:175609416-175609438 CTGAAGAATGAGAGAAAACATGG - Intronic
917685163 1:177408402-177408424 CTGAAGGATGAGAGTGAGCAGGG - Intergenic
917904689 1:179576729-179576751 TTGAAGAATCATAGGCAGGAAGG + Intergenic
918132499 1:181642033-181642055 CAAAATAATAAGAGGGAGCAGGG + Intronic
920454133 1:206085069-206085091 TTGAAGAAACTGAGGCAGCAAGG - Intronic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
921800741 1:219399568-219399590 CTGCAGTGTAAGAGGGAGCAGGG + Intergenic
922173713 1:223178564-223178586 CTAAAGCATCAGTGGGAACAGGG + Intergenic
922606402 1:226892340-226892362 CTCAGGAATCAGAGGAAGCCGGG + Intronic
923308439 1:232709955-232709977 TTGAAGCATCTGAGTGAGCAGGG - Intergenic
924640303 1:245827230-245827252 CTGTAGAGTCAGAGGGAGCTGGG - Intronic
1063422993 10:5928502-5928524 CTAAAGAGTGAGAGGGAGGAAGG - Intronic
1064259575 10:13774428-13774450 CTGAAGAAGAACAGGAAGCAGGG + Intronic
1064808017 10:19159720-19159742 CTGAAGTATCAGAGAGCCCAAGG + Intronic
1066492143 10:35904100-35904122 CTGAAAAATCAGGGAGACCAGGG + Intergenic
1066702483 10:38144868-38144890 CTCAAGAATCAGAGGTAAGAAGG + Intergenic
1066989984 10:42503845-42503867 CTCAAGAATCAGAGGTAAGAAGG - Intergenic
1067138132 10:43629781-43629803 CTACAGTTTCAGAGGGAGCACGG + Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067530174 10:47065205-47065227 CTGAAGCCTTAGCGGGAGCATGG - Intergenic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1069334117 10:67328182-67328204 CTGCAGTATGGGAGGGAGCATGG + Intronic
1070128701 10:73641757-73641779 CTGAAGACTGAGAGGGAGACAGG + Exonic
1070733048 10:78844939-78844961 CTGAGCAATGAAAGGGAGCAGGG - Intergenic
1071125790 10:82333332-82333354 CTGAGGAATCAGAGAGATCAAGG + Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072286162 10:93917610-93917632 CTGAAGAATGAGGGGGAGTGGGG + Intronic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1073685199 10:105745058-105745080 TTGAAGAATGAGAGAGAGAAGGG + Intergenic
1074572003 10:114632737-114632759 CCGATGAAACAGAGGGAGAAGGG - Intronic
1076778515 10:132711149-132711171 CTGAAGAGTCAGTGGGAGCGTGG + Intronic
1077721561 11:4635467-4635489 CTGAAGGGTGAGAGAGAGCATGG + Intergenic
1078127211 11:8579177-8579199 CTGAAGAATCAGTTAGAGTAGGG + Intronic
1078391528 11:10939187-10939209 ATGAAGGATGAGAGTGAGCAGGG - Intergenic
1078520842 11:12061696-12061718 CTCAGGGTTCAGAGGGAGCATGG + Intergenic
1078543408 11:12229172-12229194 CTGCAGCATCCCAGGGAGCAGGG - Intronic
1078722362 11:13896887-13896909 CTGAAGAGCCAGAGAGGGCAGGG - Intergenic
1078745751 11:14112821-14112843 TGGAAGAATTAGAAGGAGCAAGG - Intronic
1079746204 11:24133776-24133798 TTGAAAAATCAGTGTGAGCAAGG + Intergenic
1080208576 11:29758269-29758291 CTGACTGTTCAGAGGGAGCATGG - Intergenic
1080401614 11:31941612-31941634 GTCAAGAGGCAGAGGGAGCAAGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081362885 11:42201879-42201901 ATGAAGTATCACAGGGGGCAAGG - Intergenic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1081828052 11:46077733-46077755 CTGAAGAATCTGAGGTAGGCAGG - Intronic
1082131640 11:48497010-48497032 CTGAAGAATCTTAGTGAGGAAGG + Intergenic
1082273094 11:50193179-50193201 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1082849444 11:57752712-57752734 CTGAACATTGAGAGGAAGCAAGG - Intronic
1085315405 11:75541960-75541982 CCCAGGAATCAGAGAGAGCAGGG - Intergenic
1085315410 11:75541983-75542005 CCCAGGAATCAGAGAGAGCAGGG - Intergenic
1085315415 11:75542006-75542028 CCCAGGAATCAGAGAGAGCAGGG - Intergenic
1085315420 11:75542029-75542051 CCCAGGAATCAGAGAGAGCAGGG - Intergenic
1085315425 11:75542052-75542074 CCCAGGAATCAGAGAGAGCAGGG - Intergenic
1085315430 11:75542075-75542097 CCCAGGAATCAGAGAGAGCAGGG - Intergenic
1085534333 11:77208974-77208996 CTGAAGAATCAGAAGATACAAGG - Intronic
1086170050 11:83825960-83825982 CTGAAGCATCAGTGAGAGTAGGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086353448 11:85966892-85966914 TAGAAAATTCAGAGGGAGCATGG + Intronic
1086720567 11:90116255-90116277 CTCTAGAAGCAGAGGGAGCCAGG - Intergenic
1087334232 11:96823069-96823091 TTTATGAATCAGAGGGAGCAAGG + Intergenic
1088522810 11:110717592-110717614 CTGAAGAATGAGAATAAGCAAGG + Intergenic
1089150045 11:116357365-116357387 CTGATGGCTGAGAGGGAGCAGGG - Intergenic
1089961644 11:122622212-122622234 TTTAAGAAACAGAGAGAGCAGGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1093170877 12:15858967-15858989 CTGAGGGATCAAAGAGAGCAAGG - Intronic
1095052319 12:37565722-37565744 CTGAAAAATCAGAGAGCGCTTGG - Intergenic
1095257104 12:40051585-40051607 CTGAAGAGTCAGAGGGGCCTTGG + Intronic
1095683959 12:45010990-45011012 TGGATGCATCAGAGGGAGCATGG + Intergenic
1096617293 12:52840822-52840844 CTGCACCTTCAGAGGGAGCACGG + Intronic
1097231587 12:57515194-57515216 CTGAAGCATGACAGAGAGCAAGG - Exonic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1098281835 12:68870051-68870073 TTGAAGAATCACAGGAAGGATGG + Intronic
1099837596 12:87927011-87927033 TTTAAGAAGAAGAGGGAGCATGG - Intergenic
1099844828 12:88016834-88016856 CTGAGAAATCATAGGGAGTATGG + Intronic
1100359902 12:93867113-93867135 CTCAAGAATTAGAAGTAGCAGGG - Intronic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1102697715 12:114813250-114813272 CTGAGGAAGCAGAGGAAGTAGGG - Intergenic
1102755198 12:115334170-115334192 CTGGAGAAGGAGAGGAAGCAAGG + Intergenic
1102857001 12:116302708-116302730 CTGAAGAACTAGAGAGAGCCAGG + Intergenic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1103379043 12:120479631-120479653 CTGAAGAACCAGATGGTGCTAGG + Intronic
1103620816 12:122186140-122186162 CTGTAGCAGGAGAGGGAGCACGG - Intronic
1103924821 12:124417667-124417689 CTGAGGTATGAGAGGCAGCAGGG - Intronic
1103955445 12:124573961-124573983 CTGAAGGAGCAGAGGAAGCCGGG - Intergenic
1104198580 12:126565748-126565770 CTACAGAATGAGAGGGAGAAAGG - Intergenic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1106146156 13:27051676-27051698 GGGAAGAGTGAGAGGGAGCAAGG + Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1107695969 13:43000308-43000330 CTGAAAAAACAAAGTGAGCAGGG + Intergenic
1108863999 13:54899603-54899625 CTGAAAAATCAGAGCGTGCAAGG - Intergenic
1109977231 13:69854337-69854359 ATGAAGAAAGAGAGAGAGCATGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113289554 13:108889802-108889824 CTTAAGAATGAGAGGCAGTATGG - Intronic
1114299717 14:21364347-21364369 CTGAAGAACCAGTGGGGGAAGGG + Intronic
1114767396 14:25389497-25389519 GTTAAGAGTCAGAGGGAGGAAGG - Intergenic
1114913863 14:27236776-27236798 CAGGAGAATAAGAGCGAGCAAGG - Intergenic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117243940 14:53864658-53864680 TTGAAGACTCAAAGGGAGAAGGG - Intergenic
1119170893 14:72535691-72535713 ATGAGGAAGTAGAGGGAGCAAGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120252657 14:82077968-82077990 CTCAACAATCAGAGGGAGGTAGG - Intergenic
1120387659 14:83866349-83866371 CCGAAGAATAAGTGGTAGCAAGG - Intergenic
1121165119 14:91788375-91788397 CTGAAAAATAAAAGGGAGAATGG + Intronic
1121223297 14:92302578-92302600 CTGACGAACCAGACAGAGCAGGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121606413 14:95243576-95243598 TTGAAGAATCCAGGGGAGCATGG + Intronic
1121998709 14:98628032-98628054 CTAAAGTCTCAGAGGGAGCATGG + Intergenic
1122082982 14:99279817-99279839 CTTAGGGATCAGAGGGAGCATGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124831074 15:33150145-33150167 CAGAAGAATCACAGGGAGCTTGG - Intronic
1125795968 15:42404031-42404053 TTGAACAATCGGAGGGAACAAGG + Intronic
1126053344 15:44707395-44707417 CTGAATAATCAGAAGTAGCCAGG - Intronic
1127054804 15:55120722-55120744 CAAATGAAACAGAGGGAGCAAGG - Intergenic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1128864474 15:71103808-71103830 CTGAAGAGTCAGAGAGAGAGTGG - Intronic
1129379932 15:75158470-75158492 CTGAAGAGTCTGAGGGAGACAGG - Intergenic
1129463001 15:75709368-75709390 GTGAAGGAGCAGAGGGACCAGGG + Intronic
1129721878 15:77882033-77882055 ATGAAGGAGCAGAGGGACCAGGG - Intergenic
1130573652 15:85071368-85071390 GTAAAGAATCAGGGGCAGCAGGG - Intronic
1130579132 15:85118928-85118950 AATAAGAACCAGAGGGAGCACGG - Intronic
1130614337 15:85390376-85390398 ATGAAGATTCAGAGGAAGTATGG + Intronic
1130754912 15:86752971-86752993 CTGAAGAAAGGGCGGGAGCAAGG - Intronic
1131325130 15:91435959-91435981 CTGAAGTAGCATAAGGAGCATGG - Intergenic
1131663164 15:94540557-94540579 CTGAAGGATAAGAGGAACCAGGG + Intergenic
1131671358 15:94623098-94623120 CTGAAGAATGGTAGGGAGCCAGG + Intergenic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132659552 16:1055292-1055314 CTGAAGAATCAGGCGGAGCACGG - Intergenic
1132761138 16:1509162-1509184 CTGAAGCACCAGGAGGAGCAGGG + Intronic
1132838480 16:1966697-1966719 CTGAAGGATCACAGGTAGCCAGG - Intergenic
1133178088 16:4031261-4031283 CTGAAGAATTTAAGGGTGCAGGG + Intronic
1133313763 16:4869245-4869267 CTGAAGAATGAGAGACAGCCTGG + Intronic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1135089236 16:19499757-19499779 CTGAAGAAGCACAGGGACTAAGG + Intergenic
1135867315 16:26115810-26115832 CTGAAAGATCACAGGAAGCAGGG - Intronic
1136901979 16:34050277-34050299 GGGAAAAATCAGCGGGAGCAGGG - Intergenic
1137342177 16:47619216-47619238 CTGAAGAATGAAAGGAAGGAGGG + Intronic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1137726523 16:50660391-50660413 CTAAAACATCAGAGGGAGCATGG + Intergenic
1138814130 16:60184535-60184557 CTGGAGTCTTAGAGGGAGCATGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139274683 16:65716596-65716618 CTAAAGACTCAGTGGGAACAAGG + Intergenic
1139308826 16:66011196-66011218 CCCAGGAAACAGAGGGAGCATGG - Intergenic
1140242604 16:73217139-73217161 CAGATGAGTCAGAGGGAGCAGGG + Intergenic
1140509946 16:75499751-75499773 CTGAAGACTCAGCAGGACCATGG - Intergenic
1141693361 16:85608551-85608573 CTTAATAATCAGAGTGACCATGG + Intergenic
1143020586 17:3915448-3915470 GTGCAGAATCAGAGGCAGCGTGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1148533753 17:48420664-48420686 CTGGAGAATCAGGGGGTGCCAGG - Intronic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149695892 17:58615780-58615802 CTGAAGAATTAGAGGCAGCTTGG - Intronic
1149794354 17:59505718-59505740 CTGAAGATTCAGAGGAATCCAGG + Intergenic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1151221547 17:72616460-72616482 CTGCAGAATTAGAGGCAGCCTGG - Intergenic
1151418484 17:73982292-73982314 CTCAAGGAGAAGAGGGAGCAAGG + Intergenic
1151966535 17:77434467-77434489 CTGCAGACTCAGAGGCAGTACGG - Intronic
1152256535 17:79243276-79243298 CTGGAGTGTCAGAGTGAGCAGGG + Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152734564 17:81991123-81991145 CTGAAGACCGTGAGGGAGCAGGG + Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1152859887 17:82690212-82690234 CTGCAGAATTGGAGGGAGCACGG + Intronic
1152859909 17:82690370-82690392 CTGCAGAATTGGAAGGAGCATGG + Intronic
1152859917 17:82690450-82690472 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859927 17:82690530-82690552 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859939 17:82690610-82690632 CTGCAGAATTGGAGGGAGCATGG + Intronic
1153679657 18:7488579-7488601 CTGAGGAATGGGAGGGCGCATGG - Intergenic
1155101023 18:22609857-22609879 CTGACGGATGAGAGGCAGCAGGG + Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1160566814 18:79791018-79791040 AGGGAGAATCAGAGGGAGAATGG - Intergenic
1160893817 19:1393526-1393548 CAGAGGGATCAGAGGGAGCAGGG + Intronic
1162217630 19:9149534-9149556 CTGAAGGATGAGAGGGGGCCAGG + Intronic
1163055174 19:14712595-14712617 CCGAGCCATCAGAGGGAGCACGG - Intronic
1163532582 19:17859301-17859323 CATAAGAACCTGAGGGAGCAGGG - Intergenic
1164651734 19:29895609-29895631 CTTAAAAATCAGAGGGGACACGG + Intergenic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1166650876 19:44574143-44574165 TTAAGGAATCAGAGGGACCAAGG - Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167144603 19:47674139-47674161 CTGAAGGATCACAGGGAGGTAGG + Intronic
1167597154 19:50433778-50433800 GTGAAGACTCAGAGGGAGCCAGG + Intronic
1167728633 19:51236246-51236268 GTCAGGAAGCAGAGGGAGCAAGG + Intronic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
925256683 2:2495605-2495627 CTGAAGAGTAAGTGGGAACAGGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926081802 2:9993223-9993245 CTGAAGAATTGGAGGGTGAAGGG + Exonic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
926807668 2:16726201-16726223 CAGAAGAATCAGAAGAGGCAAGG - Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927067279 2:19486115-19486137 CTGAGAAATCAGAGGTACCATGG + Intergenic
927399677 2:22696520-22696542 TAGAGGACTCAGAGGGAGCATGG + Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
932099264 2:68882017-68882039 CTGAAGGATCAAAGGGATGATGG + Intergenic
932211714 2:69937045-69937067 CTGAAGAGTCAGACGAAGCCAGG + Intronic
933603823 2:84360561-84360583 CTGAAGAATCCAAGGCAACAAGG + Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
935717377 2:105951141-105951163 CTACAGATTCAGAGGCAGCAGGG + Intergenic
937065527 2:119013984-119014006 TTGAAGAAGAAGAGGAAGCAGGG + Intergenic
938180408 2:129177207-129177229 CGGAGGATTCAGAGAGAGCATGG - Intergenic
938954635 2:136286486-136286508 TTCAAGTTTCAGAGGGAGCATGG - Intergenic
939655620 2:144820381-144820403 TGGAAGCATCAGATGGAGCAGGG + Intergenic
939722533 2:145672266-145672288 CTGAAGAAACAGAGGCAAAAAGG - Intergenic
940033976 2:149293969-149293991 CTGAAGGATTAGAAGGAGCAGGG + Intergenic
940318241 2:152347161-152347183 CTGAAGAACAAGAGGGAGGGAGG - Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
941857587 2:170246636-170246658 CAGAGGCTTCAGAGGGAGCATGG + Intronic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942248214 2:174026234-174026256 CTGAACTCTCGGAGGGAGCACGG + Intergenic
942499821 2:176577883-176577905 CTGTAGTATCAGGGGGAGGAGGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
944992448 2:205253557-205253579 CTGAAGAGGCAGAGGAGGCAGGG - Intronic
945580425 2:211587550-211587572 CTAGAGACTTAGAGGGAGCATGG + Intronic
945977656 2:216283297-216283319 GTGGAGAATCAGAGGGAAAAGGG - Intronic
946171160 2:217896557-217896579 CATAGGATTCAGAGGGAGCATGG + Intronic
946770591 2:223084875-223084897 CTGAATAATGAGAGAGAGCCAGG - Intronic
946944734 2:224808973-224808995 CTGAAGTATTTGAGGGAGCAAGG + Intronic
946972263 2:225107709-225107731 CTGAAGAATGAGAGAGAAAAGGG - Intergenic
947286756 2:228525326-228525348 CTTAAGAATGAGAGGGAGGAGGG + Intergenic
1169061254 20:2662071-2662093 CTAAACCTTCAGAGGGAGCAGGG + Intronic
1169228448 20:3870861-3870883 CTGCAGAATGAGGGGAAGCAGGG - Exonic
1170130385 20:13012743-13012765 CTGAAGAATCACAATCAGCATGG + Intronic
1170456682 20:16540297-16540319 CTGGAGAGTGAGTGGGAGCAGGG + Intronic
1170703997 20:18728364-18728386 CTGAGGTTTCATAGGGAGCACGG - Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172232854 20:33348608-33348630 CTGAGGAGCCAGAAGGAGCAGGG + Intergenic
1173466690 20:43288528-43288550 ATGTAGAATCAGTGGGAGCCTGG + Intergenic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1174372295 20:50099665-50099687 CTAAAGAAGCTGAGGGAGCTTGG - Intronic
1174911167 20:54608969-54608991 ATGAAGAAACAGAGGGAGTTTGG - Intronic
1174915052 20:54645243-54645265 CTGAGGGTTCAGAGCGAGCATGG - Intronic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG + Intronic
1176925374 21:14743205-14743227 CTTCAGATTCAGAGGGAACAAGG + Intergenic
1177035211 21:16034264-16034286 TTGAAGAATCAGAGGCAACGTGG - Intergenic
1178016393 21:28351233-28351255 CTGAAGAAACAGTGTGGGCACGG - Intergenic
1179589241 21:42395160-42395182 CTGCAGAATCTCAGGGAGAAGGG - Intronic
1181174448 22:21027822-21027844 CTGGAGATTGAGAGGCAGCAGGG - Exonic
1181682279 22:24503736-24503758 ATGAAGAGTCAGAGAGAGTATGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182089083 22:27581791-27581813 CAGAAGAGGCAGAGGGAGCGCGG + Intergenic
1182114614 22:27748913-27748935 CTGCAGAATCAGAGGGGTCATGG + Exonic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183788699 22:40047215-40047237 TTGAATTATCAGAGGGAGAAAGG + Intronic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184999837 22:48238617-48238639 CTGAAGCCTGAGAGGGAGAATGG + Intergenic
949483290 3:4513783-4513805 CTGAAGAATCAGATAGACCTAGG + Intronic
949564298 3:5230712-5230734 ATGTAGAATCAGTGGGAGCCCGG - Intergenic
949959658 3:9301576-9301598 CTGTAGAATTACAGTGAGCACGG + Intronic
950104499 3:10379572-10379594 GGGAAGTATCAGAGGGTGCAGGG + Intronic
950354117 3:12389593-12389615 CTCAAGAATGAGAGTGAGCCAGG + Intronic
950722045 3:14890393-14890415 CGGAGGAAACAGTGGGAGCATGG - Intronic
950856361 3:16109396-16109418 CTGACAAATCTGAGGCAGCAGGG + Intergenic
950969921 3:17176082-17176104 CTGTAGAATCAGACAGAGCTGGG + Intronic
951455398 3:22886536-22886558 CTGATGAAGCACAGGGAGCCTGG + Intergenic
951616021 3:24545042-24545064 CAAAGGATTCAGAGGGAGCATGG + Intergenic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
951674244 3:25218712-25218734 CATAAGGATCACAGGGAGCAGGG - Intronic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
952685167 3:36139304-36139326 TTGAAGAATCAGAGCTGGCAAGG - Intergenic
953456835 3:43049028-43049050 CTGAAGAGTCAGGGGAAGGATGG + Intronic
954820901 3:53326741-53326763 ATGTAGAATCAGTGGGAGCCTGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956723769 3:72140231-72140253 ATGTAGAATCAGTGGGAGCTTGG + Intergenic
957012041 3:75017901-75017923 TTGCAGAATCAGAGGTAGCATGG + Intergenic
957156704 3:76552749-76552771 CTGAAGGATGAGACAGAGCATGG + Intronic
957422903 3:79994860-79994882 CAGAAATATCAGAAGGAGCATGG - Intergenic
958435231 3:94088110-94088132 CTGAAGGATGAAAAGGAGCAGGG - Intronic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960553276 3:119000705-119000727 TTGAAGACTCAAAGGGAGAAGGG + Intronic
961072614 3:123948893-123948915 CACCAGAATGAGAGGGAGCATGG + Exonic
962374778 3:134850738-134850760 ATGAAGAATCACAGCCAGCATGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962809522 3:138948877-138948899 CACAAGGATGAGAGGGAGCAAGG + Intronic
964266622 3:154904381-154904403 CTGAAGAATCAGTGTGCACAAGG + Intergenic
964604166 3:158541215-158541237 CTGAAGACTTAGAAGGAGCCAGG - Intronic
964892863 3:161557760-161557782 AGGAAGAATCAAAGGGAGTAGGG - Intergenic
965030417 3:163358442-163358464 TTGAAGAATTAGAGGGAGCAAGG - Intergenic
965292353 3:166899661-166899683 TAGAAGACTCAGAGGAAGCAGGG - Intergenic
965546738 3:169923750-169923772 CTGAAGTATAAGAGAAAGCATGG + Intronic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965917815 3:173872405-173872427 CTGAAGAAAAACAGGGAACATGG - Intronic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967527904 3:190514927-190514949 CTAAATACTGAGAGGGAGCAAGG + Intronic
967699119 3:192571004-192571026 CTGAAGAATCAGAAGGTTAATGG - Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
969493518 4:7513075-7513097 CTGAAGAATCAGACAGACCCAGG + Intronic
969694603 4:8727599-8727621 CTGCAGAGTCAGAGGGCTCAGGG + Intergenic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
973599585 4:52528820-52528842 CTGAGGAATCGGTGGGAGCTGGG + Intergenic
977652265 4:99484605-99484627 CAGAATACTGAGAGGGAGCATGG - Intergenic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
978846385 4:113277908-113277930 CTGCAGAATCTGCGGCAGCACGG - Exonic
979212346 4:118120318-118120340 CTCAGGAGGCAGAGGGAGCAGGG + Intronic
979647524 4:123088753-123088775 CTGAAGGAGAAGAGGAAGCAAGG - Intronic
980267629 4:130539091-130539113 CTGTAGTTTCAGAGGCAGCAAGG + Intergenic
980622760 4:135330567-135330589 GGGAAGTTTCAGAGGGAGCATGG - Intergenic
982918932 4:161249955-161249977 CGGAAGAAGCTGAGGCAGCAGGG + Intergenic
983932612 4:173469729-173469751 CTGAAGGATGAGTGGGAGGATGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
986134749 5:4965936-4965958 CTAAAGAAACAGAGGTGGCATGG + Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
986920944 5:12679637-12679659 CTAAGGTTTCAGAGGGAGCATGG - Intergenic
989713355 5:44428283-44428305 CTTAAGAATGAGAGTGAGCTTGG - Intergenic
990723451 5:58725442-58725464 ATAAATAATCAGAGGTAGCAAGG - Intronic
991285647 5:64972848-64972870 CTGATAGATCAGAGAGAGCAGGG - Intronic
991365195 5:65860644-65860666 CTCCAGAATCAGAGGTAGCCAGG - Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
994094792 5:95839069-95839091 CTTAGGCATTAGAGGGAGCATGG - Intergenic
995809882 5:116093598-116093620 CCTAAGACTCAGGGGGAGCATGG - Intronic
995910361 5:117179612-117179634 ATGAAGAAGCAGGGGAAGCAGGG + Intergenic
997422609 5:133781067-133781089 GTGAAGAGTCAGAGGAAGGAGGG - Intergenic
997452019 5:133991377-133991399 CTGAAGAGTTACAGGGAGGAAGG - Intronic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997681115 5:135751384-135751406 CTAAGGAACCACAGGGAGCAGGG - Intergenic
997799466 5:136845222-136845244 CAGAGGCTTCAGAGGGAGCATGG + Intergenic
998102671 5:139447221-139447243 CTGTAGAAACCGAGTGAGCAGGG - Intergenic
998632579 5:143916131-143916153 CTCAAGAAGTAGAGGAAGCAAGG + Intergenic
998945240 5:147331904-147331926 GAGAAGTTTCAGAGGGAGCATGG + Intronic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999320909 5:150614476-150614498 CTGACCCCTCAGAGGGAGCAGGG + Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999933188 5:156455974-156455996 GAGAAGTCTCAGAGGGAGCATGG + Intronic
999942923 5:156563911-156563933 CTGAAGAACTTGAGGGAGTAGGG - Intronic
1000483720 5:161812352-161812374 CTGAAGAATCAGAGTCTGAAGGG + Intergenic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1001217075 5:169866018-169866040 CTGAAGAGTCAGAGGGGCGAGGG + Intronic
1001217087 5:169866079-169866101 CTGAAGAGTCAGAGGGGCGAGGG + Intronic
1001581375 5:172800813-172800835 CTGAAGGATGAGAAGGACCATGG - Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002062918 5:176637067-176637089 CTCAGAAGTCAGAGGGAGCAGGG - Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004288292 6:14343204-14343226 AAGCAGATTCAGAGGGAGCACGG + Intergenic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG + Intergenic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007821285 6:44562166-44562188 CTCAAGAACCAGAGGGATCCTGG - Intergenic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010696802 6:78985372-78985394 CCGAAGAAGAAGAGAGAGCATGG - Exonic
1011633815 6:89352529-89352551 CTGAAGAGTCCGGGTGAGCAGGG - Exonic
1014191082 6:118497436-118497458 ATGTAGAATCAGTGGGAGCCCGG - Intronic
1015991241 6:138945620-138945642 CTGAAGAATATGAGGCTGCATGG + Exonic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017694341 6:156999587-156999609 CTTAAGAAACACAGGCAGCAGGG + Intronic
1018003468 6:159599749-159599771 TAGAGGATTCAGAGGGAGCATGG - Intergenic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1019265175 7:111115-111137 CGAAAGAAACAGAAGGAGCATGG - Intergenic
1019520628 7:1459151-1459173 CAGAAGAATCAAAGGGCGCCAGG + Intronic
1020007244 7:4789367-4789389 CTGAATTATCAGGGGCAGCAGGG - Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1021081819 7:16373738-16373760 TTGAAGAATTAGAGTAAGCATGG + Intronic
1021340545 7:19458114-19458136 GCCAAGGATCAGAGGGAGCATGG + Intergenic
1021475441 7:21055878-21055900 CTGAAGAACCAGTGACAGCAGGG - Intergenic
1021799789 7:24293597-24293619 GTGAAGAAGCAGAGGGATCAAGG - Intergenic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022384313 7:29887565-29887587 CTGGAGAACCAGTGTGAGCAGGG + Intronic
1022417791 7:30192767-30192789 CTGAAGGATCAGCAGGAGCTGGG + Intergenic
1023298137 7:38737987-38738009 CAGAAAAATAAAAGGGAGCAGGG - Intronic
1023882282 7:44327106-44327128 CTGAGGAAGCAGAGGGATCCTGG + Intronic
1023985099 7:45089384-45089406 CTGACCAAGCAGAGGGTGCAGGG + Intergenic
1024094254 7:45971807-45971829 CTGATGATTCAGAGTGAGGAGGG - Intergenic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1024147726 7:46534310-46534332 CTGAAGCATCAGAGACAGCTAGG + Intergenic
1025625143 7:63214541-63214563 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1026189030 7:68107663-68107685 CCGAAGGATCAGAGGAAGAAAGG + Intergenic
1026952393 7:74356330-74356352 CTGAAGAGGCAGAGGAGGCAGGG + Intronic
1027121942 7:75528094-75528116 CTGAAGACTCACAGGAAGCGAGG + Intergenic
1027266434 7:76497528-76497550 CAGAAGAGTCAGAGGCAGCGAGG - Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028795493 7:94897052-94897074 CTGAAGAATCAATGGAATCAAGG - Intergenic
1029150431 7:98476603-98476625 CTGAGAAATGAGAGGGAGCAGGG - Intergenic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030097511 7:105913765-105913787 CTGAAGAATTATTGGGAACAGGG - Intronic
1030549999 7:110946230-110946252 CAGAAGCATCAGAGTCAGCAGGG - Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031822892 7:126526822-126526844 GTGAAGATTCAGAGGAAGCATGG - Intronic
1032063404 7:128744670-128744692 GTGAGGAAGCAGAGGCAGCAGGG + Intronic
1032860837 7:135877847-135877869 CTGAATAATCAGAGAAAGGAGGG - Intergenic
1033520265 7:142153495-142153517 CTGAAGTTTCAGAGGAAGCCAGG + Intronic
1034712194 7:153203515-153203537 GGGCAGAAGCAGAGGGAGCAAGG + Intergenic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037514954 8:19620870-19620892 CAGGAGCATCAGAGGGAACATGG + Intronic
1038313732 8:26465435-26465457 CTTAATAGTCAGAGGGACCAGGG - Intronic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1038975906 8:32695794-32695816 TTAAAGAATCAGAGGGAGCAAGG + Intronic
1039191830 8:34984995-34985017 CTGATGATTCAGAGACAGCATGG + Intergenic
1039412691 8:37368535-37368557 AGGAAGAATGAGAGGGAGGAAGG + Intergenic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1041296017 8:56358457-56358479 CAGAAGACTGAGAGGGGGCATGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043255457 8:78131084-78131106 ATGAATCATCAGAGGGAACAGGG + Intergenic
1043655386 8:82658819-82658841 ATGAAGAAAAAGAGGGAGAATGG - Intergenic
1043727423 8:83628884-83628906 CAGAGCATTCAGAGGGAGCAGGG - Intergenic
1043973927 8:86564093-86564115 CTGAAGGAGGTGAGGGAGCAAGG - Intronic
1044489317 8:92793311-92793333 CTGAAGAGTCAGAGGGAAGTAGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1044811505 8:96068571-96068593 CTGAAGAATGAGAGGGGCCTAGG - Intergenic
1045510060 8:102806865-102806887 CTGATGAGTCAGCGGGAGCCCGG - Intergenic
1046664089 8:116980072-116980094 CTCAAGCCTCAGAAGGAGCAGGG - Intronic
1047629494 8:126691729-126691751 CTGAAGAAAGGTAGGGAGCAAGG - Intergenic
1048525466 8:135198352-135198374 ATGAAAAATCAGAGGGAGGGAGG + Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG + Exonic
1049738674 8:144223522-144223544 CTGAGAAACCAGAGGGAGCCAGG - Intronic
1050202862 9:3165955-3165977 ATGAAGAATAAAAGGGAGAAAGG - Intergenic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1051068608 9:13135490-13135512 GAGAAAAATCAGAGGTAGCAGGG - Intronic
1051080227 9:13285542-13285564 CAGAAGAATCAGAGAGAGCTGGG - Intergenic
1051185896 9:14461024-14461046 CTGAGGAACAAGAGGGTGCACGG - Intergenic
1051336617 9:16071434-16071456 CTGGAAAGTCTGAGGGAGCAAGG - Intergenic
1051730636 9:20139286-20139308 CTGAGGACTCACAGGGAGTAAGG - Intergenic
1053797951 9:41742940-41742962 CTGAAAAATCAGAGAGCGCTTGG + Intergenic
1054147246 9:61572017-61572039 CTGAAAAATCAGAGAGCGCTTGG - Intergenic
1054186365 9:61954995-61955017 CTGAAAAATCAGAGAGCGCTTGG + Intergenic
1054466983 9:65503054-65503076 CTGAAAAATCAGAGAGCGCTTGG - Intergenic
1054652140 9:67633528-67633550 CTGAAAAATCAGAGAGCGCTTGG - Intergenic
1054759713 9:68993366-68993388 CTGAAGGAAGTGAGGGAGCATGG - Intronic
1055667619 9:78568408-78568430 ATGAGGAAACACAGGGAGCAAGG + Intergenic
1055693122 9:78855671-78855693 CTGAAGAACCAGAAGTAGCAAGG + Intergenic
1056447337 9:86678580-86678602 CTGAAGTATGGGAGGGAGCCAGG + Intergenic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1056658346 9:88526885-88526907 CTAAGGTTTCAGAGGGAGCACGG + Intergenic
1056688103 9:88783419-88783441 CTGAAGAATGGGAGACAGCAAGG + Intergenic
1057727509 9:97578615-97578637 ATGAATAAGCCGAGGGAGCATGG + Intronic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058342123 9:103911129-103911151 TTGCAGAATCACAGGTAGCAAGG + Intergenic
1058553376 9:106139537-106139559 GGAAAGATTCAGAGGGAGCATGG + Intergenic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059880678 9:118685615-118685637 CTGAGGAAACAGAGAGGGCATGG + Intergenic
1059906483 9:118992167-118992189 CTGAAGAAGCTCAGGGAGCAGGG + Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1062097033 9:134708840-134708862 TGGAAGCTTCAGAGGGAGCACGG - Intronic
1062142604 9:134967880-134967902 CTGATTAATCAGGGGGAGGAAGG + Intergenic
1062456245 9:136640616-136640638 CGGAAGGATGAGAGGGAACAGGG - Intergenic
1185985351 X:4826658-4826680 ATGTAGAATCAGTGGGAGCCTGG + Intergenic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1190496646 X:51033412-51033434 CTGAGGAGTCTGAGGGAGGATGG - Intergenic
1190509326 X:51160525-51160547 CTGAGGAGTCTGAGGGAGGATGG + Intergenic
1190730027 X:53219797-53219819 CTGACTAATAAGAAGGAGCAGGG - Intronic
1191012537 X:55775477-55775499 CTGAAGAAGTAAAGAGAGCATGG + Intergenic
1191685383 X:63884657-63884679 CTGAAGAATCTCTGGGGGCAAGG - Intergenic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1192033940 X:67544275-67544297 CTAAAGACTCGGAGGAAGCAAGG + Intronic
1192233123 X:69279335-69279357 CAGAAGAGACAGAGGGAACAGGG - Intergenic
1192607242 X:72531068-72531090 CTGAAGAATTAGCCAGAGCAAGG + Intronic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1194225407 X:91250464-91250486 GTAAAGAATCAGAGGGGGCCGGG - Intergenic
1194771960 X:97916780-97916802 CTGAATAATGACAGGGAGAATGG + Intergenic
1195527437 X:105908148-105908170 CCTAAGAAGCAGAGGGAACAAGG + Intronic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197986126 X:132268333-132268355 CTGAAGAATGTGAGGAAGAATGG - Intergenic
1198301464 X:135337873-135337895 GTCAAGAAGGAGAGGGAGCAAGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199690053 X:150302680-150302702 CTCAAGAATGGGAGGCAGCAGGG - Intergenic
1199971989 X:152868008-152868030 CTGAGGAATGAGTGGGAGAAAGG - Intronic
1200022517 X:153224141-153224163 ATGTAGAATCAGCGGGAGCCTGG + Intergenic
1200561944 Y:4715373-4715395 GTAAAGAATCAGAGGGGGCCGGG - Intergenic
1201577485 Y:15476794-15476816 ATGTAGAATCAGTGGGAGCCCGG + Intergenic
1201628208 Y:16038933-16038955 CGGAAGAAAAAGAGGGAGCAGGG + Intergenic
1201693371 Y:16794449-16794471 ATGTAGAATCAGTGGGAACATGG - Intergenic
1201730254 Y:17194220-17194242 CTCAGAATTCAGAGGGAGCAAGG + Intergenic
1202075359 Y:21031950-21031972 CTTGAGAACCACAGGGAGCAGGG - Intergenic
1202193622 Y:22272526-22272548 CTGAAGATCCAGAGGGCACATGG + Intergenic