ID: 1152859947

View in Genome Browser
Species Human (GRCh38)
Location 17:82690662-82690684
Sequence GAGTGTGCACGTGTGTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 6, 2: 18, 3: 122, 4: 646}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152859943_1152859947 -10 Left 1152859943 17:82690649-82690671 CCCGGGGAGCAGAGAGTGTGCAC 0: 1
1: 2
2: 0
3: 23
4: 218
Right 1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG 0: 1
1: 6
2: 18
3: 122
4: 646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152859947 Original CRISPR GAGTGTGCACGTGTGTGCAG GGG Intronic
900137385 1:1123691-1123713 GTGTGTGTAGGTGTGTGCACAGG - Intergenic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137409 1:1123918-1123940 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900137421 1:1124052-1124074 GTGTGCGCAGGTGTGTGCACAGG - Intergenic
900137425 1:1124102-1124124 GTGTGCGCAGGTGTGTGCACAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137437 1:1124188-1124210 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900187884 1:1341044-1341066 AGGTGTGCATGTGTGTGCAGGGG - Intronic
900215478 1:1479381-1479403 GTGTGTGCCCATGTGTGCAGGGG - Intronic
900215483 1:1479407-1479429 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900222743 1:1518080-1518102 GTGTGGGCCCGTGTGTGCAGGGG - Intronic
900222916 1:1518829-1518851 GACTGTGCCCGAGTGTGCAGGGG - Intronic
900222921 1:1518854-1518876 GACTGTGCCCATGTGTGCGGGGG - Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900295258 1:1945927-1945949 ATGTGTGCACGTGTGTGTGGGGG + Intronic
900353221 1:2247255-2247277 GTGTGTGCACAGGTGTGCATGGG + Intronic
900358736 1:2277689-2277711 GTGTGTGCACGTGTGCCCATGGG - Intronic
900358745 1:2277760-2277782 GTGTGTGCACGTGTGCCCATGGG - Intronic
900358952 1:2278806-2278828 CTGTGTGCACGTGTGCGCATGGG - Intronic
900392021 1:2437834-2437856 GTGTGTGCACGTGTGTGGTTTGG - Intronic
900489176 1:2937957-2937979 GTGTGTGTACATGTGTGCATGGG - Intergenic
900526030 1:3129114-3129136 GAGTGTGCACGTGCGTGTGTGGG + Intronic
900796262 1:4710446-4710468 GAGTGTGTACGTGTGTGACTGGG - Intronic
900818955 1:4871568-4871590 GTGTGTGCATGTGTGTGTACAGG - Intergenic
900953658 1:5873791-5873813 AGGTGTGCACTTGTGTGCAGGGG - Intronic
901107461 1:6768265-6768287 CAGGGTGCACGTGCCTGCAGAGG - Intergenic
901316445 1:8312982-8313004 CAGTGTGCCCGTGTGTGCCCGGG + Intergenic
902489584 1:16771477-16771499 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
902538310 1:17134643-17134665 GTGTGTGGGCGTGTGTGCACAGG - Intergenic
903283929 1:22265614-22265636 AAGTGTGCATGTGTGTGCAGGGG - Intergenic
903883651 1:26529411-26529433 CAGTGTGAATGTGTGTGCTGGGG + Intergenic
904012930 1:27400118-27400140 GGGTGTGTACATGTGTGCAAGGG - Intergenic
904030220 1:27528857-27528879 GAGTGTGGCTGTGTGTCCAGGGG + Intergenic
904172415 1:28600576-28600598 GTGTGTGTGTGTGTGTGCAGTGG + Intronic
905347270 1:37319536-37319558 GTGTGTGCGCGTGTGTGCCTGGG + Intergenic
905516249 1:38564172-38564194 GAGTGTGCATGTGTGTGAGGAGG + Intergenic
905892993 1:41528680-41528702 GAGGGTGAACGTGAGGGCAGGGG - Intronic
905971647 1:42146341-42146363 GAGTGCTCTCGTGTGTGTAGGGG - Intergenic
906692906 1:47804457-47804479 AAGGGAGCAGGTGTGTGCAGTGG - Intronic
909318311 1:74251665-74251687 GTGTGTGCACGTGTGGGAGGAGG + Intronic
909351558 1:74659349-74659371 AACTGTGCATGTGTGTGCACAGG - Intronic
910437325 1:87218539-87218561 GTGTGTACACGTGTGTGCACGGG - Intergenic
914240989 1:145852976-145852998 GTATGTGCATGTGTGTGGAGGGG - Intronic
914244682 1:145876803-145876825 CACTGGGCAGGTGTGTGCAGGGG - Exonic
914941493 1:152027128-152027150 GAGTGTGCATGTGTTTCCTGTGG + Intergenic
915328589 1:155094190-155094212 GAGGGTGCACATGTGTACAAAGG - Intergenic
915721263 1:157987601-157987623 GAGTGGGTACGTGTGTGGGGGGG - Intergenic
916352810 1:163871066-163871088 GTGTGTGAATGTGTGTGCATAGG + Intergenic
916693329 1:167212146-167212168 GTGTGTGTACCTGTGTGTAGAGG + Intergenic
917990630 1:180374264-180374286 GAGTGTGCATGTGAGTGTAAGGG - Intronic
918324562 1:183396947-183396969 GAGTGTGAAGGTGTTAGCAGTGG - Intronic
919685418 1:200479533-200479555 GTGTGTGTCAGTGTGTGCAGAGG - Intergenic
919770031 1:201152211-201152233 GTGTGTGCACCTCTGTCCAGTGG + Intronic
920047608 1:203143551-203143573 GTGTGTGTTTGTGTGTGCAGGGG + Intronic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
920710201 1:208287602-208287624 GTGTGTGCACATGTCTGCACAGG - Intergenic
921644211 1:217594789-217594811 GTGTGTGCACATGTGTGTAAAGG + Intronic
921922724 1:220686929-220686951 GGGTGTGTACCTGTGTGCAGTGG - Intergenic
922765839 1:228156371-228156393 GTGTATGCATGTGTGTGCATGGG + Intronic
923530853 1:234811048-234811070 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
924458369 1:244236486-244236508 GACTGTGCATGTGAGTGCAGAGG - Intergenic
1062794875 10:337204-337226 GTGTGTGCAAGTGTGTGTGGTGG + Intronic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1062960694 10:1571676-1571698 GAGTGTGCAGGTGAGTGGACAGG + Intronic
1062960703 10:1571748-1571770 GAGTGTGCAGGTGAGTGGACAGG + Intronic
1062960738 10:1572033-1572055 GAGTGTGCAGGTGAGTGGACAGG + Intronic
1062960743 10:1572057-1572079 GAGTGTGCAGGTGAGTGGACAGG + Intronic
1062960747 10:1572093-1572115 GAGTGTGCAGGTGAGTGGACAGG + Intronic
1062960752 10:1572129-1572151 GAGTGTGCAGGTGAGTGGACAGG + Intronic
1062988794 10:1795760-1795782 GAGTGTGCATGTTTGTGTAGGGG - Intergenic
1063159630 10:3409825-3409847 GTGTGTGCACAGGTGTGCACAGG - Intergenic
1063541645 10:6940017-6940039 GTGTGTGCGCGTGTGTGTAAGGG - Intergenic
1063613136 10:7580095-7580117 GAGTGCGGAGGTGAGTGCAGAGG - Intronic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1064645134 10:17453414-17453436 GAGTGTGCGTGTGTTTGAAGAGG - Intronic
1064646807 10:17467949-17467971 GATTTTGCACCTGTGTTCAGAGG + Intergenic
1065196918 10:23275574-23275596 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1067061295 10:43079170-43079192 GAGTGTGCATGTGTGAGCTGTGG - Intronic
1067719301 10:48715077-48715099 GAGTGAACACCTGTGTGGAGAGG + Intronic
1069653693 10:70071089-70071111 GTGTGTGCGCGTGTGCACAGGGG + Intronic
1069744245 10:70705012-70705034 GAGTGTGCGAGTGTGTGAAGGGG - Intronic
1070082776 10:73205329-73205351 GAGTGTGTGTGTGTGTGGAGAGG - Intronic
1070394484 10:76000391-76000413 GGGTGTGCATCTGTGTGCACAGG + Intronic
1070610657 10:77930104-77930126 GTGTGAGTGCGTGTGTGCAGGGG - Intergenic
1070647486 10:78211810-78211832 GTGTGTGTACGTGTGTGATGAGG + Intergenic
1070823608 10:79377951-79377973 GAGGGTGCACGTGTGAGATGAGG + Intergenic
1070823633 10:79378262-79378284 GAGGGTGCACGTGTGCGGTGTGG + Intergenic
1071484126 10:86086670-86086692 AAGTGTCCATGTGTGTGCATGGG + Intronic
1071513789 10:86283548-86283570 GTGTGTGCATGTGTGTGTAAGGG - Intronic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1072758457 10:98036582-98036604 GTGTGTGCATGTGTGAGGAGGGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073299193 10:102460566-102460588 GATTGTGCAGGTGTGGGAAGAGG + Intergenic
1074267587 10:111920225-111920247 GTGTGTGCATGTGTGTGGATGGG - Intergenic
1074707501 10:116148112-116148134 GTGTGTGCATGTGTGTGGGGTGG + Intronic
1074877092 10:117622004-117622026 GAGAGTCCACCTGAGTGCAGGGG + Intergenic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075508102 10:123043931-123043953 GTGTGTGCATGTGTGTACACAGG - Intronic
1075654860 10:124154498-124154520 GAGTGTGCATGTGTGTGTGGGGG - Intergenic
1075654889 10:124154709-124154731 GAGTGTGCATGTGTGTGAGTGGG - Intergenic
1075654946 10:124155138-124155160 GAGTGTGCATGTGTGAGCATGGG - Intergenic
1076042450 10:127262278-127262300 GTGTGTGTACCTGTGTGCTGAGG + Intronic
1076238827 10:128887091-128887113 GAGGGTGCAGGTGTGAGCACAGG - Intergenic
1076258836 10:129050026-129050048 GAGTGTGCTCGTCTGTAAAGTGG - Intergenic
1076605628 10:131687596-131687618 GAGTGTGCACCTGTGTGTGCTGG - Intergenic
1076759752 10:132597097-132597119 GTGTTTGCATGTGTGTGCATGGG + Intronic
1076778820 10:132712768-132712790 GGGTGTGTGCATGTGTGCAGGGG + Intronic
1076858835 10:133130128-133130150 GAGTGGGCAGAGGTGTGCAGGGG - Exonic
1077009423 11:373588-373610 GAGTGTGCGCAAGTGTGCACAGG - Intronic
1077091289 11:779501-779523 GTGTGTGCACCTGTGTCCACAGG + Intronic
1077144588 11:1039249-1039271 GTGTGTGCATGTGTGTGTATAGG + Intergenic
1077219421 11:1408980-1409002 GTGTGTGTATGTCTGTGCAGGGG + Intronic
1077227240 11:1443692-1443714 GCGTGTGCCTGTGTGTGCACAGG + Intronic
1077529236 11:3087517-3087539 GTGGGTGCAGGTGTGTGCAGGGG - Exonic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078738057 11:14039422-14039444 GTGTGTGTATGTGTGTGTAGGGG + Intronic
1079296574 11:19240658-19240680 GCCTGTGCACGTGTGTGTAAGGG - Intronic
1079533703 11:21485690-21485712 GAATGTTCAGGTGGGTGCAGTGG - Intronic
1080333766 11:31173723-31173745 GTGTGTGTAAGTGTGTGAAGAGG - Intronic
1080363078 11:31539078-31539100 AAGTGTGTATGTATGTGCAGGGG + Intronic
1080884201 11:36350335-36350357 GTGTATGCATGTGTGTGCCGGGG + Intronic
1081644442 11:44779830-44779852 ATGTGTGCATGTGTGTGCATAGG - Intronic
1081644459 11:44779974-44779996 GTGTGTGCAGGTATGTGCAAAGG - Intronic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081742167 11:45448437-45448459 GAGTGTCCACTTCGGTGCAGGGG + Intergenic
1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG + Exonic
1081995608 11:47361685-47361707 GCGTGTGTACGTGTGTACAAAGG + Intronic
1082567089 11:54693878-54693900 GAGAGTCCGTGTGTGTGCAGTGG + Intergenic
1082969793 11:59007794-59007816 GTGTGTGCACGTGTGTCCCCAGG + Intronic
1083266092 11:61547529-61547551 GAGTGCGTGCGTGTGTGCATTGG - Intronic
1083924087 11:65795482-65795504 GAGTGAGCACGTGTGCCCAGGGG - Exonic
1084265729 11:68004201-68004223 GCGCGCGCGCGTGTGTGCAGGGG + Intronic
1084477935 11:69399388-69399410 ATGTGTGCATGTGTGTGTAGGGG + Intergenic
1085173139 11:74465587-74465609 GACTGTGTGTGTGTGTGCAGTGG - Intronic
1085781226 11:79410942-79410964 GTGTGTGTATGTGTGTGTAGAGG - Intronic
1086905404 11:92412849-92412871 GGCTGTGCATGTGTGTGTAGGGG - Intronic
1086911357 11:92476091-92476113 GTGTATACAAGTGTGTGCAGGGG + Intronic
1086924731 11:92627887-92627909 GAGTGAGCAAGGCTGTGCAGAGG + Intronic
1086924818 11:92628858-92628880 GTGCATGCACGTGTGTGCACAGG + Intronic
1087161471 11:94951849-94951871 GTATGTGCATGTATGTGCAGGGG + Intergenic
1088214553 11:107493341-107493363 GTGTGTGTATGTGTGTGCAGAGG - Intergenic
1088566672 11:111179952-111179974 GTGTGTGTACATGCGTGCAGTGG + Intergenic
1088901257 11:114119378-114119400 GTGTGTGCACATGTGTGTACAGG + Intronic
1088990586 11:114950142-114950164 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089398477 11:118151107-118151129 GTGTGTGCACGTGTGTAAGGGGG - Intronic
1089560906 11:119342669-119342691 GAGGGTGTAAGGGTGTGCAGTGG - Exonic
1089610030 11:119663958-119663980 GTGTGTGCACGTGTCAGCAGAGG + Exonic
1089611696 11:119672869-119672891 GAGTCTGCGCAGGTGTGCAGTGG + Intronic
1089632253 11:119791196-119791218 GTGTGTGCACATGTGGGCAGGGG + Intergenic
1089832514 11:121341076-121341098 GAGCTTGTATGTGTGTGCAGTGG - Intergenic
1090081168 11:123613721-123613743 GAGTGTGCATGTGTGTGCCTTGG - Intronic
1090428828 11:126629233-126629255 GACTGTGCACATGTGGGTAGAGG + Intronic
1090482588 11:127081278-127081300 GTGTGTGTGCGTGTGTGCACAGG + Intergenic
1090795873 11:130135360-130135382 GAGTGTGGAGGTGGATGCAGGGG + Intronic
1091225154 11:133952522-133952544 TTGTGTGCACGTGCGTGGAGTGG - Intronic
1091670332 12:2447800-2447822 GTGTGTGCATGTGGGAGCAGTGG - Intronic
1091681212 12:2528492-2528514 GGGTGTGCACAAGTGTGCAGAGG - Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1091845680 12:3654551-3654573 GAGTGTGTACGTGTGAACTGAGG - Intronic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1092976119 12:13746503-13746525 GAGAATGCACATCTGTGCAGGGG - Intronic
1093546928 12:20359636-20359658 GAGTGTGTGTGTGTGTGAAGTGG - Intergenic
1094486188 12:30927428-30927450 CAGTGTGCACATGTGTGAATTGG + Intronic
1094738664 12:33263630-33263652 GTGTGTGCATGTGTTTTCAGTGG + Intergenic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1096531228 12:52244062-52244084 GCCTGTGCAGGTGTCTGCAGTGG + Intronic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1096994048 12:55828093-55828115 GATTTTTCACGTGTGTCCAGCGG - Exonic
1098553569 12:71792851-71792873 GAATGTGAACATGTGTGCACAGG - Exonic
1098919180 12:76287244-76287266 GTGTGTGCGTGTGTGTGCAGAGG + Intergenic
1099145286 12:79035753-79035775 GAGTCTGCAGGGGTGAGCAGGGG - Intronic
1101198070 12:102406084-102406106 CACCGTGCACGTGTGTGCATGGG - Intronic
1101316211 12:103631595-103631617 CAGTGTGCAACTGTGTGCATGGG + Exonic
1101724952 12:107381317-107381339 GTGTGTTCACCTGTCTGCAGAGG - Intronic
1102419412 12:112792064-112792086 GTGTGTCTACGTGTGTGCACTGG + Intronic
1102422365 12:112814078-112814100 GAGTGTGCACGAGTGTGTAGGGG + Intronic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102743610 12:115230520-115230542 GTGTCTGCGCGTGTGTGCAAGGG - Intergenic
1104112955 12:125721228-125721250 CTGTGTGTACGTGTGTGCATAGG + Intergenic
1104124096 12:125828794-125828816 GTGTGTGTATGTGTGTGCATGGG + Intergenic
1104807630 12:131599628-131599650 GTGTGTGTATGTGTGTGCACAGG - Intergenic
1104929610 12:132331265-132331287 GTGTATGCACATGTGTGTAGGGG + Intergenic
1105014763 12:132779726-132779748 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105014807 12:132779996-132780018 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105024530 12:132839392-132839414 GAGGTTGCAAGTTTGTGCAGGGG - Intronic
1105024613 12:132839715-132839737 GAGTTTGCACGTTTGTGCAGGGG - Intronic
1105781085 13:23705783-23705805 GAGTGGGAATGTGTGGGCAGAGG - Intergenic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106430851 13:29679069-29679091 GTGTGTGTATGTGTGTGGAGAGG + Intergenic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1106897195 13:34316454-34316476 GTGTGTGCACGTGTGGCAAGGGG + Intergenic
1107625572 13:42279242-42279264 GGGTGTGCACGTGCGTGCACTGG - Intronic
1107842032 13:44467987-44468009 GTGTGTGCGCGTGTGTGTATAGG - Intronic
1108104687 13:46996484-46996506 GTGTGTGCACCCATGTGCAGAGG + Intergenic
1108537457 13:51399724-51399746 GTGTGTGTGCGTGTGTGTAGTGG + Intronic
1109521194 13:63512271-63512293 GTGTGAGCAAGTGAGTGCAGGGG - Intergenic
1110616820 13:77551002-77551024 GAGTGGGAACGTGGATGCAGGGG - Intronic
1111739819 13:92189574-92189596 GTGTGTGCACGTGTATGGAAAGG - Intronic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1112491765 13:99872172-99872194 GAGTGTGCCCATGTGTGCATGGG - Intronic
1113459941 13:110474939-110474961 GTGTGTGATCGTGTGTGCACAGG - Intronic
1113598931 13:111554654-111554676 GGGTGTGAACGTGTGTGGGGAGG - Intergenic
1113613810 13:111666543-111666565 GTATGTGCATGTGTGTGCATTGG + Intronic
1113667888 13:112153600-112153622 GAGAGTGCGGGTGTGTGCTGTGG + Intergenic
1113870563 13:113557184-113557206 GTGTGTGCACATGTGTGTAGGGG + Intergenic
1113893854 13:113751273-113751295 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1113893857 13:113751314-113751336 GTGAGTGCATGTGTGTGCATGGG + Intergenic
1114185701 14:20400296-20400318 GCGTGTGTGTGTGTGTGCAGTGG + Intronic
1114830283 14:26132836-26132858 CAGTGTGGAAGTGTGTGCAAGGG + Intergenic
1115056120 14:29129272-29129294 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1117868838 14:60176439-60176461 GAGTGAGCATGTGTGGACAGGGG + Intergenic
1117896990 14:60497386-60497408 GAGTGTGTGTGTGTGTGCATTGG - Intronic
1118384907 14:65247917-65247939 GCGTGTGCGTGTGTGTGCAAGGG - Intergenic
1118616906 14:67580181-67580203 GAGTGGGCACGTGTAGGCAGTGG - Intronic
1119282378 14:73420463-73420485 GTGTGTGCATGTGTGTGTATAGG + Intronic
1120753781 14:88222626-88222648 GAGACTGCACATGTGTGTAGGGG + Intronic
1120878913 14:89399390-89399412 GAGTGTCCACGTGGCCGCAGAGG + Intronic
1121287449 14:92747594-92747616 GAGTATACACGTGTGTACAGGGG - Intronic
1122130548 14:99602709-99602731 CAGCGTCCACGTGTGTGCGGTGG - Intronic
1122152791 14:99733785-99733807 GATGATGCACGTGTGTGCACGGG - Intergenic
1122455239 14:101845225-101845247 GAATGTGCATGTGTGTCCACAGG + Intronic
1122828623 14:104384356-104384378 GAATGTGCACATGTGTGAAGGGG + Intergenic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1124869277 15:33524115-33524137 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1125556087 15:40586249-40586271 GGGTGTGCTGGTGTGTGCTGCGG - Intergenic
1126408332 15:48345906-48345928 GGCTGTGCACGTGTGTGAGGAGG - Intergenic
1127311733 15:57758084-57758106 GAGTGTGTGCGTGTGTTGAGAGG + Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127638223 15:60891310-60891332 GTGTGTGTGCATGTGTGCAGTGG + Intronic
1128581070 15:68810412-68810434 GAGTGTGTGTGTGTGGGCAGTGG + Intronic
1128999545 15:72320472-72320494 GTGTGTGCCTGTGTGTGCGGTGG - Exonic
1129707784 15:77804621-77804643 GTGTGTGCAAGGATGTGCAGGGG + Intronic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1131326954 15:91456797-91456819 TAGTGAGCATGTGTGTTCAGAGG + Intergenic
1132162437 15:99555767-99555789 GAGTTTGCTGGTGTGTGCAGTGG + Intergenic
1132261971 15:100433708-100433730 GTGTGTGCACATGTGTGCATGGG - Intronic
1132545814 16:532886-532908 TGGTGTGCAGGTGTGTCCAGTGG - Intronic
1133222196 16:4323562-4323584 GAGTGTGCGTGTGTGTGCCGGGG + Intronic
1134203658 16:12219915-12219937 GTGTGTACACGTGTGTGCGCTGG - Intronic
1134319307 16:13148343-13148365 TAGTGTGGATGTGTTTGCAGGGG - Intronic
1134835561 16:17357829-17357851 TAGTGTACACGTGTGTGCAATGG - Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135165403 16:20134640-20134662 GTGTGTGTATGTGTGTACAGGGG + Intergenic
1136107366 16:28039703-28039725 GGATGTGCATGTGTGTGCACAGG - Intronic
1136516526 16:30771964-30771986 GAGGGCTCAGGTGTGTGCAGGGG + Exonic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1136938142 16:34495260-34495282 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
1136961672 16:34853297-34853319 GTGTGTGTGTGTGTGTGCAGAGG - Intergenic
1137400190 16:48146966-48146988 GTGTGTGCATGTGTGTGCGTGGG - Intronic
1137849515 16:51725241-51725263 GTGTGTGTGTGTGTGTGCAGTGG - Intergenic
1138340534 16:56286189-56286211 GTGTGTGCAGATGTGTGTAGCGG - Intronic
1138522376 16:57578224-57578246 GTGTGTGCATGTGTGTGTATGGG + Intronic
1138708858 16:58946180-58946202 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1139042189 16:63011308-63011330 GAGTGAGTAGGTGTGTGGAGAGG + Intergenic
1139429215 16:66902095-66902117 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
1140513581 16:75526223-75526245 GAGTGTGCATGTGTGTGTGTGGG + Intergenic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1141567511 16:84913057-84913079 GTGTGTGTGTGTGTGTGCAGTGG + Intronic
1141688080 16:85581620-85581642 GCATGTGCATATGTGTGCAGGGG + Intergenic
1141928870 16:87187164-87187186 ATGTGTGCATGTGTGTGGAGGGG + Intronic
1141928981 16:87188206-87188228 ATGTGTGCACGTGTGAGTAGGGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1141983431 16:87564012-87564034 GGGTGTGTGCGTGTGTGCACGGG + Intergenic
1141983690 16:87565849-87565871 GTGTGTGCGTGTGTGTGTAGGGG + Intergenic
1142296525 16:89226765-89226787 GAGTTCTCACGTGTGTGCTGAGG - Exonic
1142363625 16:89638662-89638684 GGGTGTGTGTGTGTGTGCAGGGG - Intergenic
1142363631 16:89638687-89638709 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
1142363670 16:89638848-89638870 GGGTGTGTGTGTGTGTGCAGGGG - Intergenic
1142477421 17:197693-197715 GTGTGTACATGTGTGTGTAGTGG + Intergenic
1142483584 17:233143-233165 ACGTGTGCGTGTGTGTGCAGAGG + Intronic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142627600 17:1202490-1202512 GAGTGGGCACGTGTGTGTTTGGG - Intronic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1142744074 17:1946434-1946456 GCATGTGTACGTGTGTGCACAGG + Intronic
1142803736 17:2360947-2360969 GAGTGTGTATGTGTGTGGGGCGG - Intronic
1143321360 17:6070846-6070868 GAGTGAGCGGGTGCGTGCAGGGG + Intronic
1143591542 17:7888191-7888213 GACTGTGTGCGTGTGTGCAGGGG - Intronic
1143601216 17:7947526-7947548 GTGGGTGCAAGTGTGTTCAGGGG - Intronic
1144648545 17:16991476-16991498 GGGTGTGGGCGTGTGCGCAGGGG - Intergenic
1146928383 17:36760852-36760874 GTGTGTGCATGTGTGTGGATGGG + Intergenic
1147317136 17:39626475-39626497 GAGTGTGCAGGGGTGTGCCGGGG - Intergenic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1148228352 17:45915262-45915284 GAGTGTGTATGTGTGTGGTGTGG + Intronic
1148285188 17:46383355-46383377 GAGTTAGCATGTGTGTCCAGAGG + Intergenic
1148307351 17:46600951-46600973 GAGTTAGCATGTGTGTCCAGAGG + Intronic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1148813529 17:50310502-50310524 GACTGAGCAGGTGTGGGCAGGGG - Intergenic
1148867489 17:50636258-50636280 TGCTGTGCACGTGTGTGCACAGG + Intronic
1149051895 17:52314887-52314909 GAGTGTGTATGTGTGTGTTGAGG - Intergenic
1149117985 17:53122190-53122212 GTGTGTGTATGTGTGTGTAGAGG + Intergenic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1150288383 17:63966811-63966833 GAACGTGTACGTGTGTGCATGGG + Intronic
1150359943 17:64523104-64523126 GAATGTGCAGGTGTATACAGAGG - Intronic
1150593002 17:66579536-66579558 CAGTTTTCACATGTGTGCAGTGG - Intronic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151512407 17:74569334-74569356 GTGCGTGCATGTGTGTGGAGGGG + Intergenic
1151826586 17:76527333-76527355 GAGACTGCACGAGTGTGCACAGG + Intergenic
1151881903 17:76900977-76900999 GTGTGTGCATGTGTGTACATGGG + Intronic
1151933401 17:77247205-77247227 GAGTGTGCGCGTCTGCGCACCGG + Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191887 17:78893139-78893161 GTGCGTACATGTGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152273678 17:79341244-79341266 GTGTGTACATGTGTGTGCACAGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152293447 17:79453690-79453712 GTGTGTGCCGGTGTGTGCAGAGG + Intronic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152733457 17:81984995-81985017 GTGTGTGCAGGTGTGTGGGGGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152737865 17:82006158-82006180 GTGGGTGCACGTGTGTGCACGGG + Intronic
1152859882 17:82690184-82690206 GAGTGTGCATGTGTGTCCAGGGG + Intronic
1152859893 17:82690264-82690286 GAGTGTGTTTGTGTGTCCAGGGG + Intronic
1152859900 17:82690313-82690335 GAGTGTGCATGTGTGTTCCTGGG + Intronic
1152859904 17:82690342-82690364 GAGTGTGTACGTGTGTCCAGGGG + Intronic
1152859910 17:82690392-82690414 GAGTGTGCACATGTGTTCTCAGG + Intronic
1152859919 17:82690472-82690494 GAGTGTGCACGTGTGTTGCCGGG + Intronic
1152859929 17:82690552-82690574 GAGTGTGCACGTGTGTTGCCGGG + Intronic
1152859934 17:82690582-82690604 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859941 17:82690632-82690654 GAGTGTGCACATGTGTTCCCGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152859953 17:82690711-82690733 GAGTGTGCATGTGTGTTCCTGGG + Intronic
1152859958 17:82690741-82690763 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859969 17:82690820-82690842 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859975 17:82690869-82690891 GAGTGTGCACGTTTGCCCCGGGG + Intronic
1152961928 18:85015-85037 GAGTGTGCCTGTGTGAGCACAGG - Intergenic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153539545 18:6139480-6139502 GTGTGTGCATGTGTGTTTAGGGG - Intronic
1153618101 18:6952437-6952459 TACTGTGCATGTGTGTGCGGGGG + Intronic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154227451 18:12519329-12519351 GTGTGTGCACATGTGTGTATAGG - Intronic
1156669612 18:39452568-39452590 GTATGTGCATGTGTGTGTAGGGG - Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158783579 18:60681061-60681083 GACTGTGCATGTGTGAGCACAGG + Intergenic
1159903873 18:74073133-74073155 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
1159944739 18:74435922-74435944 GTGTGTGCACATGAGTGCACGGG - Exonic
1159963649 18:74575739-74575761 GTGTGTGCGCGTGTGTGAAGGGG + Intronic
1159982147 18:74795939-74795961 GTGTGTGCGCGTGTGCACAGCGG - Intronic
1160039567 18:75333455-75333477 GACTGTGCAAGTGGGTGCCGCGG + Intergenic
1160201720 18:76801830-76801852 AAGTGCGCACGGGTGTGCGGGGG + Intronic
1160357892 18:78244193-78244215 GTGTGTGCGCGTGTGTGAAGTGG - Intergenic
1160404551 18:78636675-78636697 GAGTGTGCATGGGTGTGTAGAGG + Intergenic
1160605815 18:80048846-80048868 GAGTGTGGGCATGTTTGCAGGGG + Intronic
1160891931 19:1383710-1383732 GAGTGCGCACGTGGGGGCCGCGG - Exonic
1161245635 19:3250033-3250055 GGGGGTGTATGTGTGTGCAGGGG + Intronic
1161251673 19:3284181-3284203 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1161280860 19:3444796-3444818 GCGTGTGTGTGTGTGTGCAGGGG - Intronic
1161443153 19:4304017-4304039 GCGGGTGTACGTGTCTGCAGGGG - Intergenic
1162015320 19:7843328-7843350 GAGTGTGCATGTGTGTGTATAGG + Intronic
1162015345 19:7843646-7843668 GTGTGTGCATGTGTGTGTATAGG + Intronic
1162129534 19:8517566-8517588 GTGTGTGTGCGTGTGTGCAGGGG + Intergenic
1164519482 19:28967634-28967656 GAGTGTGCATGTGTGTGGGTGGG + Intergenic
1165211136 19:34236755-34236777 GGGTGTGGGCGAGTGTGCAGAGG - Intergenic
1166120898 19:40685884-40685906 GAGGGTGTATCTGTGTGCAGTGG + Intronic
1166196185 19:41207340-41207362 GAGTGTGTATGTGTGTGTGGAGG - Exonic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1167118718 19:47503659-47503681 GAGTGTGCCATTGTATGCAGGGG - Intronic
1167669922 19:50844856-50844878 CAGTGAGGATGTGTGTGCAGGGG + Intergenic
1168059203 19:53882070-53882092 GTGTGTGCACGTGTGGGGGGCGG + Intronic
924991855 2:319291-319313 GTGTGGGCACGTGTGTGCCTGGG + Intergenic
925059230 2:878332-878354 GAGTGTGCGTGTGTGTGTAGGGG - Intergenic
925059258 2:878487-878509 GAGTGTGCATGTGTATGTAGGGG - Intergenic
925059265 2:878527-878549 GGGCGTGCATGTGTGTGTAGTGG - Intergenic
925126629 2:1461699-1461721 CTGTGTGCACGTGTGTGTATGGG - Intronic
925160157 2:1677922-1677944 GAGTGTGTGTGTGTGTGCAGCGG + Intronic
925461881 2:4070312-4070334 GAGTGTGCACATTTGTGCTTGGG + Intergenic
925462033 2:4072006-4072028 AAGTGTGCATGTGTGTGTGGTGG + Intergenic
925465888 2:4107070-4107092 GCGCGTGCATGTGTGTGTAGGGG + Intergenic
925587054 2:5474884-5474906 GAGTGTGCGCAGGTGTGGAGAGG - Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927779607 2:25928854-25928876 GTGCGTGTGCGTGTGTGCAGGGG - Exonic
928269664 2:29844854-29844876 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
928592058 2:32827386-32827408 GAGTGTGCACATGTGTACTTGGG - Intergenic
928915360 2:36464681-36464703 GAGAGTGTACATTTGTGCAGAGG + Intronic
929011017 2:37444876-37444898 GGGTGTGTATGTGTGTGTAGGGG - Intergenic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929543443 2:42840450-42840472 GTGTGTGTGTGTGTGTGCAGGGG + Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
931176451 2:59859614-59859636 GTGTGTGCATATGTGTGAAGGGG - Intergenic
931656853 2:64517358-64517380 CAGTGTGACCGTGTGTTCAGGGG + Intergenic
931755412 2:65369730-65369752 GAGCCTGCACCTGTGTGCAATGG + Intronic
931937357 2:67214031-67214053 GGGTGTGTATGTGTGTGTAGGGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932300673 2:70664729-70664751 GAGTGTGCAAGTGTGTGTGTGGG + Intronic
932627636 2:73311096-73311118 GTGTGTGTACGTGTGTGTATGGG + Intergenic
933009945 2:77048229-77048251 GTGTGTGCATGTGTGTGTAATGG + Intronic
933074878 2:77911098-77911120 GAGTGTGCACTTCTTTGCAGAGG + Intergenic
933949445 2:87315488-87315510 GTGTGTGCATGTGTGTGCACGGG + Intergenic
934856601 2:97733727-97733749 GTGTGGGCACATGTGTGCACAGG - Intronic
934859277 2:97750176-97750198 GGGTGTACACATGAGTGCAGTGG - Intergenic
934948294 2:98558034-98558056 GAATTTGCATGTGTGTACAGAGG + Intronic
935430165 2:102967378-102967400 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
936073712 2:109388078-109388100 GTGTGTGCATGTGTGTGCACAGG - Intronic
936075672 2:109400199-109400221 ATGTGTGCAAGTGTGTGTAGGGG - Intronic
936330747 2:111546109-111546131 GTGTGTGCATGTGTGTGCACGGG - Intergenic
937060298 2:118975914-118975936 GAGTGTGAGTGTGTGTGCATGGG - Intronic
937216174 2:120315042-120315064 GTGTGTGGACGAGTGTGCCGGGG - Intergenic
937451231 2:122003381-122003403 GAGAGTGCAGGTGGGTGGAGAGG - Intergenic
937904166 2:127044557-127044579 GAGTGTGAATGTGTGTGAATGGG - Intergenic
938917786 2:135960758-135960780 AAGTGTGGTTGTGTGTGCAGTGG - Intronic
939312995 2:140509057-140509079 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
941264961 2:163349242-163349264 GTGTGTGTGCGTGTGTGTAGAGG - Intergenic
941574405 2:167212908-167212930 GTGTGTGTGTGTGTGTGCAGAGG - Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942873389 2:180763441-180763463 GAGTGTGTGCATGTGTGCATGGG - Intergenic
943107592 2:183566137-183566159 GCGTGTGCACTGGAGTGCAGTGG + Intergenic
944083603 2:195818695-195818717 GTGTGTGGATGAGTGTGCAGAGG - Intronic
944479185 2:200137613-200137635 TGGTGTGCATGTGTGTGAAGGGG - Intergenic
945255185 2:207797310-207797332 GAGTGTGCCCTTGAGTGCACAGG - Intergenic
946048530 2:216841542-216841564 AAGTGTCTACGTGTGTGCATGGG + Intergenic
946311069 2:218882978-218883000 GTGTGTGTGCCTGTGTGCAGTGG + Intronic
946405905 2:219491964-219491986 CAGTGTGGATGTGTGTACAGGGG - Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947386623 2:229596974-229596996 GCGTGTGCATGTGTGTGCGCAGG - Intronic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
947917575 2:233843864-233843886 GTGTGTGCACGTGTGTGGCAGGG + Intronic
948271023 2:236673308-236673330 GAGTGTGTACATGTGTGGGGGGG + Intergenic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948661564 2:239510096-239510118 GTGTGTGTGCGTGTGTGCAGTGG + Intergenic
1170008211 20:11692178-11692200 GGTTGTGCATGTGTGTACAGGGG + Intergenic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170210774 20:13844380-13844402 GTGTGTGTGCGTGTGTGTAGCGG + Intergenic
1170776535 20:19379575-19379597 GGGTGTGCACCTGTGAGCACAGG - Intronic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171183491 20:23108491-23108513 GTGTGTGCACGTAGGTGCACAGG + Intergenic
1172100730 20:32483109-32483131 GAGTGTGCCCGAGAGTGGAGGGG - Intronic
1173590285 20:44219736-44219758 GAGGGTGCCCCTGTGAGCAGTGG - Intergenic
1173882289 20:46424615-46424637 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1173997516 20:47350241-47350263 GTGCGTGCATGTGTGTGCACGGG - Intronic
1174551788 20:51367437-51367459 GACCGGGCACCTGTGTGCAGGGG + Intergenic
1174638663 20:52023933-52023955 GAGAATGCACATGTGTGAAGGGG - Intergenic
1174786984 20:53442180-53442202 GTGTGTGTACGTGTGTGTAAAGG + Intronic
1175218219 20:57402585-57402607 GGCTGTGCCCTTGTGTGCAGAGG + Intronic
1175270706 20:57731934-57731956 GAGAGAGCACGGGTGTGAAGGGG + Intergenic
1175537079 20:59722308-59722330 GGGTGGGCACCTCTGTGCAGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175776384 20:61656396-61656418 GAGTGAGCAGGTGTATGCTGAGG + Intronic
1175793856 20:61758915-61758937 GTGTGTGCACCTGTGTGCATGGG + Intronic
1175793859 20:61758953-61758975 GAGTGTGCACATGTGCGCATGGG + Intronic
1175850420 20:62087930-62087952 GAGTGTGCAGGTGAGTGTACAGG - Intergenic
1175872600 20:62215582-62215604 CGGTGTGCAGGTGTGTGCAGGGG + Exonic
1176020018 20:62957857-62957879 GCGTGTGCAAGTGTGTGTATGGG + Intronic
1176046189 20:63094033-63094055 GAGAGCTCACGTGTGTGCACAGG - Intergenic
1176275993 20:64269694-64269716 GAGTGTAGACGTGTGTGGTGTGG + Intronic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1177321285 21:19524387-19524409 GAGTTTGCATGTGTGGGGAGTGG + Intergenic
1178514162 21:33231602-33231624 GAGTGTGCAAGTGTGAGCCATGG - Intronic
1178706078 21:34874147-34874169 GTGTGTGTGCGTGTGTGCAAGGG - Intronic
1178750477 21:35297721-35297743 GTGTGTGCATGTGTGTGAGGGGG - Intronic
1178844728 21:36165424-36165446 GTGTGTGCATGTGTGTGTATGGG + Intronic
1179583651 21:42361246-42361268 GTGTGTGCTGCTGTGTGCAGGGG + Intergenic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1179914203 21:44465941-44465963 GAGCATGCACGTGTGTGTACAGG - Intergenic
1181085687 22:20438334-20438356 GAGTGCGCAGGAGTGCGCAGGGG - Intronic
1183186670 22:36295406-36295428 GTGTGTGTGTGTGTGTGCAGAGG + Intronic
1183278190 22:36914564-36914586 GTGTGTGCAGGTGTGTGTACTGG + Intronic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183350322 22:37331203-37331225 GGGTGGGCAGGTGGGTGCAGAGG - Intergenic
1183359931 22:37378195-37378217 GCATGTGCTTGTGTGTGCAGGGG + Intronic
1183614847 22:38937641-38937663 GTGGGTGCACGTGTGTGCATGGG + Intergenic
1184026025 22:41857176-41857198 GAGTGTGGACGGGAGTGAAGAGG + Intronic
1184264730 22:43341076-43341098 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
1184695428 22:46136417-46136439 GAGCAGGCACGTGTGTGCACAGG - Intergenic
1184914944 22:47562951-47562973 GTGTGTGTATGTGTGTGTAGGGG + Intergenic
1185023687 22:48395507-48395529 GTGTGTGCATGTGTGTGCACAGG - Intergenic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185100402 22:48837638-48837660 GTGTGCGCACGTGTGTGCATGGG - Intronic
1185233032 22:49694159-49694181 GTGGGTGCAGGTGAGTGCAGGGG - Intergenic
1185285604 22:49998446-49998468 GGCTGTGCACGTGTGTGCATGGG + Intronic
949377264 3:3404725-3404747 CAGTGAGGACGTGTGTTCAGAGG - Intergenic
949497280 3:4644397-4644419 GGTTGTGCAACTGTGTGCAGTGG + Intronic
950139653 3:10606597-10606619 GTGGGTGGACGTGTGTGCAGCGG + Intronic
950356560 3:12415198-12415220 GAGTGGGCATATGTGTGGAGAGG - Intronic
951136107 3:19106407-19106429 GAATGTCCAATTGTGTGCAGTGG - Intergenic
951479894 3:23148967-23148989 GAGTGTGCATGTCTGTGCACAGG + Intergenic
951479999 3:23150284-23150306 TTGTGTGTGCGTGTGTGCAGTGG + Intergenic
951649753 3:24938029-24938051 GTGTGTGCGCATGTGTGCATAGG - Intergenic
952276581 3:31883185-31883207 GTGTCTGCAGGTGTGTGTAGGGG - Intronic
952291965 3:32025885-32025907 GAGTCTGTGTGTGTGTGCAGCGG - Intronic
952384433 3:32829654-32829676 GTGTGTGCGTGTGTGTGCATTGG + Intronic
952877072 3:37955058-37955080 GAAGGTGCACCTGTGTGCAGGGG + Intronic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953294507 3:41700435-41700457 GAGTGTGAATGTGTGTGGAGGGG - Intronic
953881621 3:46693952-46693974 GAGTGTGCGCGTGGGTGCGTAGG - Intergenic
953890063 3:46744692-46744714 AAATGAGCACGTGTGTGGAGGGG - Exonic
953906500 3:46870999-46871021 GAGTGTGGATATGTGTGCACAGG - Intronic
954834318 3:53452213-53452235 GAGTGAACAGTTGTGTGCAGAGG - Intergenic
955121366 3:56062636-56062658 GTGTGTTCATGTGTGTGCAATGG - Intronic
955340971 3:58124650-58124672 GAGTGGGCAGGTGACTGCAGCGG - Intronic
955450879 3:59065344-59065366 GAGTGCCCAAGTGTGAGCAGGGG - Intergenic
956129180 3:66038452-66038474 GAGTGCGCGAGCGTGTGCAGGGG - Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
957108551 3:75923804-75923826 GAGTTTGCACATGTGTGCACTGG + Intronic
957597289 3:82283624-82283646 AAGTGTGCACTTGTGTGTGGTGG - Intergenic
957616212 3:82530818-82530840 GAGAGAGCAAGTGTGTGCTGAGG + Intergenic
959959195 3:112277006-112277028 GTGTGTGCAAATGTGTGCATGGG + Intronic
960052903 3:113254624-113254646 GGGTGTGCATGCGTGTGCACCGG - Intronic
960084019 3:113571481-113571503 GTGTGTGTGTGTGTGTGCAGAGG - Intronic
960223150 3:115140539-115140561 GAGTGTGTATGTGTGTGTGGTGG + Intronic
961219154 3:125186334-125186356 GTGTGTGCATGTGTGGGCGGTGG - Intronic
961793734 3:129394551-129394573 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
961793740 3:129394619-129394641 CAGTGTGTGTGTGTGTGCAGGGG - Intergenic
961793750 3:129394686-129394708 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
961793766 3:129394831-129394853 GTGTGTGTATGTGTGTGCAGGGG - Intergenic
961810039 3:129516612-129516634 GTGTGTGTGTGTGTGTGCAGGGG - Intronic
962366785 3:134792113-134792135 GCGTGTGTGTGTGTGTGCAGGGG + Intronic
962385328 3:134928147-134928169 GAGAATGCACGTGTGTGCGTGGG - Intronic
962809400 3:138947903-138947925 GACTGTGTATGTGTGTGCACAGG + Intronic
964663614 3:159149168-159149190 GATTGTGCCCGTGTGAGCACCGG - Intronic
965542834 3:169887652-169887674 GAGTATGTATGTGTGTGGAGAGG - Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967078877 3:186030423-186030445 GAGTGTGGACATCTTTGCAGGGG + Intergenic
967241253 3:187441687-187441709 GTGTGTGTGCGTGTGTGTAGGGG - Intergenic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
968627632 4:1634337-1634359 GTGTGTGGACGGGTGTGGAGGGG - Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968711463 4:2122416-2122438 CAGGGTGCACCTGTGTTCAGAGG + Intronic
969116174 4:4872035-4872057 CAGTGTGCTCGTGTGTGCAATGG - Intergenic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
969301432 4:6299573-6299595 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301444 4:6299645-6299667 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301452 4:6299693-6299715 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301465 4:6299770-6299792 GTGTGTGAATGTGTGTGTAGGGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
970765001 4:19537952-19537974 GAGTGAGTACATGTGGGCAGTGG - Intergenic
972348219 4:38211541-38211563 GAGACTGCACGAGTGGGCAGGGG + Intergenic
974714116 4:65644221-65644243 GAGTGTGTATGTGTGTGCATGGG - Intronic
974889196 4:67858669-67858691 GGGTGTGCAGGTGTGTACATGGG - Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
976995640 4:91430469-91430491 CAGTATGCACATGTGTGCATGGG + Intronic
977713055 4:100149359-100149381 GAGTGTGCATGTTTGTGCATAGG + Intergenic
978360194 4:107923472-107923494 GTGTGTGTATGTGTGTGTAGGGG - Intergenic
979550383 4:121984379-121984401 GAGTGTGCAGCTCTGTGGAGGGG + Intergenic
979725282 4:123953768-123953790 GAGTGACCACATGTGTGCTGGGG + Intergenic
980730161 4:136812965-136812987 GAGTGGGGAGGTGTGGGCAGTGG - Intergenic
982548357 4:156763106-156763128 GAGTGTGACTGTGTGTGCAGAGG - Exonic
983231614 4:165134780-165134802 GACTTTGCATGTGTGTGCATGGG + Intronic
983518317 4:168679456-168679478 GAGTATGGACGTGTGTGGGGGGG + Intronic
984043364 4:174766016-174766038 GAGGGTGTAAGTGTGTGTAGAGG - Intronic
984867305 4:184292714-184292736 GAGTGTGTATGTGTGTGTGGAGG + Intergenic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985555732 5:557119-557141 GAGGGTGGCCCTGTGTGCAGAGG + Intergenic
985564912 5:610799-610821 GTGTGTGCAACAGTGTGCAGGGG - Intergenic
985581367 5:697004-697026 GCGTGTGCCTGTGTGTGCATGGG + Intergenic
985681948 5:1260269-1260291 GTGTGTGCACAGGTGTGCAAGGG - Intronic
985730591 5:1545497-1545519 ATGTGTGCAGGTGTGTGCACAGG - Intergenic
985730604 5:1545634-1545656 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985730616 5:1545740-1545762 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985842016 5:2313841-2313863 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
985976154 5:3420350-3420372 GAGAGTACACCTGTGGGCAGGGG + Intergenic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
986306172 5:6518663-6518685 GAGTGTTCTTGTGTGAGCAGGGG + Intergenic
986517729 5:8581217-8581239 GAGGGGGCAGGTGTGAGCAGAGG - Intergenic
988520876 5:31944733-31944755 GCGTGTGCACGTGTGTCCCCAGG + Intronic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
989740504 5:44765679-44765701 GTGTGTGCACATGTGTGTATCGG - Intergenic
990257412 5:53985227-53985249 GAGTGTGAGAGTGTGAGCAGAGG - Intronic
990355240 5:54960419-54960441 GGTTGTGCAGGTGTGTGCAGTGG - Intergenic
990944645 5:61237185-61237207 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
991219872 5:64200995-64201017 AAGTGTGCATGTGTGTGGATAGG - Intronic
991579672 5:68141169-68141191 ATGTGTGTACATGTGTGCAGGGG - Intergenic
993134874 5:83947389-83947411 GTGTGTGTGTGTGTGTGCAGAGG + Intronic
993431280 5:87834704-87834726 GAGTGCACACGTGTGTTTAGTGG - Intergenic
993501861 5:88674649-88674671 GAGTGTGTGCGTGTGCGCGGGGG - Intergenic
993612078 5:90066753-90066775 GTGTGTGTATGTGTGTGCATGGG - Intergenic
994939755 5:106307352-106307374 GAGTGTGCCCTGGTGTGGAGTGG - Intergenic
995936151 5:117517521-117517543 GTGTGTGCGCCTGTGTGCAAAGG - Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
997725586 5:136117499-136117521 GTGTGTGTGTGTGTGTGCAGGGG - Intergenic
997827172 5:137116761-137116783 CAGTGTGCATGTGTGTGTTGGGG - Intronic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
999823001 5:155247477-155247499 CAGTGTGGATGTGTGTTCAGAGG + Intergenic
1000456704 5:161458129-161458151 GAGGGTGACCATGTGTGCAGTGG - Intronic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001552853 5:172617173-172617195 GCGTGTGTGGGTGTGTGCAGGGG - Intergenic
1001944890 5:175770693-175770715 CAGGGTGCACGTTTGTGCACAGG - Intergenic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002840619 6:902272-902294 GTGTGTGCATGTGTGTTGAGGGG + Intergenic
1003038342 6:2664455-2664477 CAGTGTGCATGCGTGTGCTGGGG - Exonic
1003502145 6:6711717-6711739 GAGTGTGAACGTATTTGAAGAGG - Intergenic
1003558734 6:7163740-7163762 GTGTGAGCACGTGTGTGCCTGGG + Intronic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1005430445 6:25751120-25751142 GGGTGTGCATGGGTGTGTAGGGG + Intergenic
1005485765 6:26297825-26297847 GAGTGTGTATGTGTGTGGTGGGG - Intergenic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1007363575 6:41374755-41374777 CGGTGTATACGTGTGTGCAGCGG - Intergenic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007418326 6:41705057-41705079 GAGTGTGTATGTGTGGACAGTGG - Intronic
1007707316 6:43798806-43798828 GCGTGTGTGTGTGTGTGCAGGGG + Intergenic
1007784415 6:44271507-44271529 GCGTGTGCACAAGTGTGCATGGG - Intronic
1007964557 6:45991754-45991776 GAGTGGGTATGTGTGAGCAGAGG + Intronic
1010373742 6:75141745-75141767 GTGTGTGCATGTATGTGTAGTGG - Intronic
1010982677 6:82386988-82387010 GTGTGTGCGCGTGTGAGCATGGG + Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1011226589 6:85114936-85114958 GACTGTGTGCCTGTGTGCAGGGG - Intergenic
1011534972 6:88366914-88366936 GAGTGTGTATGTGTGTGGGGAGG + Intergenic
1012931478 6:105321905-105321927 GAGTGTGCTCTTGAGAGCAGAGG + Intronic
1013072855 6:106744573-106744595 GTATGTGCATGTGTGTGTAGGGG + Intergenic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1015221560 6:130809778-130809800 GAGTGGGGACGAGTGTGAAGAGG + Intergenic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1016273992 6:142326791-142326813 GTGTGTGTATGTGTGTGGAGGGG + Intronic
1017851897 6:158311398-158311420 GAGTGTTCTCGTGTTTGTAGAGG + Intronic
1018090837 6:160346484-160346506 GAATGTGCTAGTGTATGCAGAGG + Intergenic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018378837 6:163239675-163239697 GAGTGTGCGTGTGTGTGTAGGGG - Intronic
1019023629 6:168940163-168940185 CACTGTGCACGTGGGTGCATTGG - Intergenic
1019023634 6:168940201-168940223 CACTGTGCACGTGGGTGCATTGG - Intergenic
1019067664 6:169315977-169315999 GTGTGTGAACTAGTGTGCAGAGG - Intergenic
1019139566 6:169934987-169935009 GAGTGTGCGAGTGTGTGCCCGGG - Intergenic
1019183281 6:170206160-170206182 GTGTGAGCACGTGTGTGCATGGG + Intergenic
1019264736 7:108163-108185 GTGTGTGCACATGTGTACATGGG - Intergenic
1019356637 7:583368-583390 GAGTGTGCACATGTGTGAGTGGG - Intronic
1019407792 7:892906-892928 GGGTGTGCAGGTGTGTGTACTGG + Intronic
1019408617 7:897136-897158 ACGTGTCCACGTGTGTGCTGAGG - Intergenic
1019553816 7:1618675-1618697 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553836 7:1618785-1618807 GTGTGTGTAGGTGTGTGGAGGGG + Intergenic
1019553871 7:1619022-1619044 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553904 7:1619227-1619249 GGGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553913 7:1619283-1619305 GGGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019560046 7:1651389-1651411 GTGTGTGCCCGTGTGTGCCTGGG - Intergenic
1019630721 7:2047774-2047796 GAGTGTGCATGTGTCTGCAGAGG - Intronic
1020672862 7:11140143-11140165 GTATGTACAGGTGTGTGCAGGGG - Intronic
1021281681 7:18727592-18727614 GAGAGCGCACGTGTGTGCGTGGG - Exonic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1021991231 7:26143239-26143261 GTGTGTGTGTGTGTGTGCAGAGG - Intergenic
1022701221 7:32762117-32762139 GAGAGTGCACGTGTGGGCTTGGG - Intergenic
1022840612 7:34160732-34160754 GGGTGTGCACGTGCCTGAAGAGG + Intergenic
1023758297 7:43440317-43440339 GAGAGTGCATGTGTGCCCAGGGG - Intronic
1023986022 7:45096541-45096563 GTGTGTGTATGTGTGTGCACTGG - Intergenic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1024182212 7:46907986-46908008 CAGTGTGTGCCTGTGTGCAGAGG + Intergenic
1026148964 7:67772007-67772029 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1026651504 7:72219662-72219684 GTGTATGCATGTGTGTGCAAGGG - Intronic
1029913017 7:104174895-104174917 GGCTGTCCATGTGTGTGCAGTGG - Intronic
1030115214 7:106057660-106057682 GGGTGTGTGCGTGTGTGCACGGG - Intergenic
1030395472 7:108981030-108981052 GTGTGTGTATGTGTGTGTAGTGG - Intergenic
1030820818 7:114088126-114088148 AAGTGTGTATGTGTGTGGAGGGG - Intronic
1032023379 7:128422280-128422302 GTGTGTGTAAGTGTGTGTAGGGG + Intergenic
1032459559 7:132100480-132100502 GAGTTTATATGTGTGTGCAGGGG + Intergenic
1032709605 7:134450414-134450436 GTGTGTGCACGTGCCTGGAGGGG + Intronic
1032743127 7:134759574-134759596 ATGTGCGCATGTGTGTGCAGGGG + Intronic
1032807903 7:135375952-135375974 GTGTGTGTATGTGTGTACAGGGG + Intronic
1033927271 7:146478673-146478695 GTGTGTGTACATGTGTGTAGAGG - Intronic
1033983674 7:147196809-147196831 GAGTGTGCAGGCGAGTGCAATGG + Intronic
1034526847 7:151669765-151669787 GTGCGTGCAAGTGTGTGCACAGG - Intronic
1034526848 7:151669791-151669813 GTGTGTGCAAGTGTGTGCACAGG - Intronic
1034783096 7:153899776-153899798 GAGTGTGAATGTGTGTGCACAGG + Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035721720 8:1797780-1797802 GTGTGTGTCAGTGTGTGCAGAGG - Intergenic
1035921714 8:3683616-3683638 GAGTATGCACATGTTTTCAGCGG - Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036580961 8:10075421-10075443 GACTGTGTATGTGTGTCCAGTGG + Intronic
1036711323 8:11080895-11080917 CAGTTTTCACGTGTGTACAGTGG - Intronic
1037172829 8:15913886-15913908 GTGTGTGCACGTGTGTCTAAAGG + Intergenic
1037768557 8:21786193-21786215 GGGTGTGTATGTGTGTGCATGGG - Intronic
1038097887 8:24336044-24336066 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1038729009 8:30110379-30110401 GCGTGCGCGCGTGTGTGTAGTGG + Intronic
1038908416 8:31934382-31934404 GTGTGTGTATGTGTGTGTAGGGG - Intronic
1039224288 8:35371171-35371193 GTGTGTGTGTGTGTGTGCAGTGG - Intronic
1039550926 8:38442379-38442401 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1039778153 8:40757349-40757371 GTGTGTGTATGTGTGTACAGTGG - Intronic
1040978281 8:53217888-53217910 GAGTGTGCGCGTGTGTGGGGGGG + Intergenic
1041035945 8:53790654-53790676 GAGTGTGCTGGCATGTGCAGTGG - Intronic
1041392249 8:57357627-57357649 GTGTGTGTGTGTGTGTGCAGAGG + Intergenic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1042605915 8:70546502-70546524 GAGTGTGGGGGTGTGCGCAGGGG - Intergenic
1042741543 8:72052940-72052962 GTGTGTGCATGTGTGGGAAGTGG + Intronic
1042757120 8:72227300-72227322 GAGTGTGCATGTGTGGGAAGTGG + Intergenic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1043104495 8:76090484-76090506 CAGTGGGCATGTGTGTTCAGAGG + Intergenic
1044146723 8:88725125-88725147 GAATGTGCATGTTTTTGCAGGGG + Intergenic
1045768901 8:105710715-105710737 GGGGGTGTATGTGTGTGCAGTGG + Intronic
1047523588 8:125614502-125614524 GAGTGTGCAAGTGTGTGTGAGGG + Intergenic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048985144 8:139731075-139731097 CAGTGTGCACGTGTGTGCCCTGG - Exonic
1048994215 8:139781720-139781742 GTGTGTGCCTGTGTGTGCGGTGG + Intronic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049239672 8:141530792-141530814 CAGTGTGCACAAGTGGGCAGAGG - Intergenic
1049251905 8:141593726-141593748 GTGTGTGTGCATGTGTGCAGGGG + Intergenic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049637869 8:143698903-143698925 AAGTGTGCACGTGTGGGGAGGGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1050551950 9:6756723-6756745 GAGTGTGTCTGTGTGTGTAGCGG + Intronic
1051167268 9:14277316-14277338 GTGCGTGCACGTGTGTGCGCGGG - Intronic
1052611326 9:30778131-30778153 GTGTGTGTATGTGTGTACAGAGG + Intergenic
1052663951 9:31470661-31470683 GTGCGTGCTTGTGTGTGCAGTGG - Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053348461 9:37395452-37395474 GTGTGAGCACGTGGGGGCAGAGG + Intergenic
1053576832 9:39362744-39362766 GGGTATGCCTGTGTGTGCAGAGG + Intergenic
1053841345 9:42190669-42190691 GGGTATGCCTGTGTGTGCAGAGG + Intergenic
1054098402 9:60921435-60921457 GGGTATGCCTGTGTGTGCAGAGG + Intergenic
1054119803 9:61197065-61197087 GGGTATGCCTGTGTGTGCAGAGG + Intergenic
1054828056 9:69592665-69592687 GAGTGAGCACGTGAGAGCATAGG - Intronic
1056537967 9:87547597-87547619 GTGTGTGTGCGTGTGTGTAGAGG + Intronic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059319856 9:113461221-113461243 GTGTGTGCACATGTGTGAGGTGG + Intronic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059502638 9:114768091-114768113 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1059652712 9:116330605-116330627 GTGTGTGCGTGTGTGTGTAGGGG + Intronic
1059719523 9:116946012-116946034 GAGAGAGCACGTGTGTGCAAAGG + Intronic
1060652633 9:125342395-125342417 GAGTGTGTCTGTGTGTACAGTGG + Intronic
1060749088 9:126157084-126157106 GGGTGCACACGTGTGTGCATGGG - Intergenic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061006095 9:127929196-127929218 GTGTGTGCATGTGTGCGCAGTGG - Intronic
1061417604 9:130455669-130455691 GAGTGAGCACATGTGAGCAGGGG - Intronic
1061951263 9:133937463-133937485 GAGTGTGAACATGTGTGGGGTGG + Intronic
1062153527 9:135033649-135033671 GGGTGTGCATATGTGGGCAGGGG - Intergenic
1062187520 9:135226496-135226518 GAGTGTGCATGTGTGAGCATGGG - Intergenic
1062187522 9:135226540-135226562 GTGTGTGAATGTGTGTGCAATGG - Intergenic
1062195303 9:135269795-135269817 GAGTGGGCATGTGTGCGGAGTGG - Intergenic
1062197974 9:135285094-135285116 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062198003 9:135285279-135285301 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198016 9:135285342-135285364 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198027 9:135285405-135285427 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198039 9:135285465-135285487 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198064 9:135285591-135285613 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198075 9:135285654-135285676 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198104 9:135285839-135285861 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198117 9:135285902-135285924 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198126 9:135285965-135285987 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198154 9:135286091-135286113 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198167 9:135286154-135286176 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198194 9:135286340-135286362 GCGTGTGTACGTGTGTGCCTGGG - Intergenic
1062198202 9:135286400-135286422 GTGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198234 9:135286587-135286609 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062205970 9:135337559-135337581 GTGTATGCACATGTGTGCAGGGG + Intergenic
1062221705 9:135419541-135419563 GCGTGTGCACGTGTGCTCACTGG - Intergenic
1062253893 9:135611993-135612015 GAGTGTGCACGTGTGTGTGCAGG - Intergenic
1062267023 9:135691305-135691327 TCGTGTGTACGTGTGTGCACTGG - Intergenic
1062325560 9:136010925-136010947 GTGTGTGCGTGTGTGTGCAGGGG - Exonic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062399482 9:136366170-136366192 GAGTGTCCAGGAGTGGGCAGTGG - Intronic
1062444160 9:136586469-136586491 GTGTGTGCCCGTGTGTGTAGAGG + Intergenic
1185480190 X:440363-440385 GTGTGTGCACCTGTGTGTGGGGG - Intergenic
1185557820 X:1035282-1035304 GAGTGTGCTGCTGAGTGCAGTGG + Intergenic
1185764344 X:2712864-2712886 TTGTGTGCACGTGTGTGTATGGG - Intronic
1185776543 X:2807858-2807880 GTGTGTGCATGTGTGTCCATGGG + Intronic
1186398684 X:9236453-9236475 GTGTGAGAACATGTGTGCAGAGG + Intergenic
1186677365 X:11832756-11832778 GAGTCTGTGCCTGTGTGCAGTGG - Intergenic
1186678698 X:11848544-11848566 GAGTCTGCATGTATGTGCAAAGG - Intergenic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1188394594 X:29665222-29665244 GAGTGTGCATATGTGTGTATAGG + Intronic
1188923243 X:36005671-36005693 GTGTGTGCACATGTGTGCAATGG + Intergenic
1189273385 X:39767504-39767526 GGGTGTGTGTGTGTGTGCAGGGG - Intergenic
1189641115 X:43071719-43071741 AAGTGTGTGTGTGTGTGCAGTGG + Intergenic
1192193794 X:69015451-69015473 GTGTGAGCACATGTGTGTAGTGG + Intergenic
1192599840 X:72450377-72450399 GTGTGTGCCTGTGTGTGCATAGG - Intronic
1193082822 X:77422613-77422635 GAGTTTGCAGGTGTGGGCAGAGG - Intergenic
1194657514 X:96590720-96590742 GTGTGTGCAAGTGTGTGTATGGG + Intergenic
1194923728 X:99797681-99797703 GAGTGTGTATGTGTGTGCATAGG - Intergenic
1195000854 X:100641940-100641962 GAGTGAACACGTCTGTGCAGAGG + Intergenic
1195172880 X:102286164-102286186 GAGGGTGCACTTGTCTGCAGGGG + Intergenic
1195185986 X:102400931-102400953 GAGGGTGCACTTGTCTGCAGGGG - Intronic
1196029946 X:111086091-111086113 GCATGTGCACATGTGTGCACTGG + Intronic
1196117882 X:112016711-112016733 ATGTGTGCATGTGTGTGTAGAGG + Intronic
1198428751 X:136545314-136545336 GAGTGTGTACATGTTTGCAACGG + Intronic
1198482024 X:137050261-137050283 GAGTATGGAGCTGTGTGCAGTGG - Intergenic
1199282656 X:146020861-146020883 CAGTGGGGACGTGTGTTCAGAGG - Intergenic
1200167339 X:154045930-154045952 GTGTGTGTGTGTGTGTGCAGGGG + Intronic
1200252978 X:154563714-154563736 GAGCGTGCCCGTGTGAGCAGTGG + Intronic
1200264789 X:154640701-154640723 GAGCGTGCCCGTGTGAGCAGTGG - Intergenic