ID: 1152862264

View in Genome Browser
Species Human (GRCh38)
Location 17:82703260-82703282
Sequence GCTGTGCCCTGCTCCAGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152862264_1152862277 18 Left 1152862264 17:82703260-82703282 CCCACGCTGGAGCAGGGCACAGC No data
Right 1152862277 17:82703301-82703323 CCATTCAGCACTGGGGGCCCAGG No data
1152862264_1152862267 -8 Left 1152862264 17:82703260-82703282 CCCACGCTGGAGCAGGGCACAGC No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862264_1152862273 11 Left 1152862264 17:82703260-82703282 CCCACGCTGGAGCAGGGCACAGC No data
Right 1152862273 17:82703294-82703316 GAGGCTCCCATTCAGCACTGGGG No data
1152862264_1152862271 9 Left 1152862264 17:82703260-82703282 CCCACGCTGGAGCAGGGCACAGC No data
Right 1152862271 17:82703292-82703314 CAGAGGCTCCCATTCAGCACTGG No data
1152862264_1152862274 12 Left 1152862264 17:82703260-82703282 CCCACGCTGGAGCAGGGCACAGC No data
Right 1152862274 17:82703295-82703317 AGGCTCCCATTCAGCACTGGGGG No data
1152862264_1152862272 10 Left 1152862264 17:82703260-82703282 CCCACGCTGGAGCAGGGCACAGC No data
Right 1152862272 17:82703293-82703315 AGAGGCTCCCATTCAGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152862264 Original CRISPR GCTGTGCCCTGCTCCAGCGT GGG (reversed) Intergenic
No off target data available for this crispr