ID: 1152862267

View in Genome Browser
Species Human (GRCh38)
Location 17:82703275-82703297
Sequence GGCACAGCGGCCACACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152862255_1152862267 8 Left 1152862255 17:82703244-82703266 CCCCCCGCCAGTGGTTCCCACGC No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862258_1152862267 5 Left 1152862258 17:82703247-82703269 CCCGCCAGTGGTTCCCACGCTGG No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862251_1152862267 30 Left 1152862251 17:82703222-82703244 CCTCTTCCCTTCAGAAGCAGAGC No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862264_1152862267 -8 Left 1152862264 17:82703260-82703282 CCCACGCTGGAGCAGGGCACAGC No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862256_1152862267 7 Left 1152862256 17:82703245-82703267 CCCCCGCCAGTGGTTCCCACGCT No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862252_1152862267 24 Left 1152862252 17:82703228-82703250 CCCTTCAGAAGCAGAGCCCCCCG No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862257_1152862267 6 Left 1152862257 17:82703246-82703268 CCCCGCCAGTGGTTCCCACGCTG No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862265_1152862267 -9 Left 1152862265 17:82703261-82703283 CCACGCTGGAGCAGGGCACAGCG No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862261_1152862267 1 Left 1152862261 17:82703251-82703273 CCAGTGGTTCCCACGCTGGAGCA No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862253_1152862267 23 Left 1152862253 17:82703229-82703251 CCTTCAGAAGCAGAGCCCCCCGC No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data
1152862260_1152862267 4 Left 1152862260 17:82703248-82703270 CCGCCAGTGGTTCCCACGCTGGA No data
Right 1152862267 17:82703275-82703297 GGCACAGCGGCCACACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152862267 Original CRISPR GGCACAGCGGCCACACCCAG AGG Intergenic
No off target data available for this crispr