ID: 1152862273

View in Genome Browser
Species Human (GRCh38)
Location 17:82703294-82703316
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152862258_1152862273 24 Left 1152862258 17:82703247-82703269 CCCGCCAGTGGTTCCCACGCTGG No data
Right 1152862273 17:82703294-82703316 GAGGCTCCCATTCAGCACTGGGG No data
1152862256_1152862273 26 Left 1152862256 17:82703245-82703267 CCCCCGCCAGTGGTTCCCACGCT No data
Right 1152862273 17:82703294-82703316 GAGGCTCCCATTCAGCACTGGGG No data
1152862264_1152862273 11 Left 1152862264 17:82703260-82703282 CCCACGCTGGAGCAGGGCACAGC No data
Right 1152862273 17:82703294-82703316 GAGGCTCCCATTCAGCACTGGGG No data
1152862260_1152862273 23 Left 1152862260 17:82703248-82703270 CCGCCAGTGGTTCCCACGCTGGA No data
Right 1152862273 17:82703294-82703316 GAGGCTCCCATTCAGCACTGGGG No data
1152862261_1152862273 20 Left 1152862261 17:82703251-82703273 CCAGTGGTTCCCACGCTGGAGCA No data
Right 1152862273 17:82703294-82703316 GAGGCTCCCATTCAGCACTGGGG No data
1152862257_1152862273 25 Left 1152862257 17:82703246-82703268 CCCCGCCAGTGGTTCCCACGCTG No data
Right 1152862273 17:82703294-82703316 GAGGCTCCCATTCAGCACTGGGG No data
1152862265_1152862273 10 Left 1152862265 17:82703261-82703283 CCACGCTGGAGCAGGGCACAGCG No data
Right 1152862273 17:82703294-82703316 GAGGCTCCCATTCAGCACTGGGG No data
1152862255_1152862273 27 Left 1152862255 17:82703244-82703266 CCCCCCGCCAGTGGTTCCCACGC No data
Right 1152862273 17:82703294-82703316 GAGGCTCCCATTCAGCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152862273 Original CRISPR GAGGCTCCCATTCAGCACTG GGG Intergenic
No off target data available for this crispr