ID: 1152862277

View in Genome Browser
Species Human (GRCh38)
Location 17:82703301-82703323
Sequence CCATTCAGCACTGGGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152862268_1152862277 -7 Left 1152862268 17:82703285-82703307 CCACACCCAGAGGCTCCCATTCA No data
Right 1152862277 17:82703301-82703323 CCATTCAGCACTGGGGGCCCAGG No data
1152862261_1152862277 27 Left 1152862261 17:82703251-82703273 CCAGTGGTTCCCACGCTGGAGCA No data
Right 1152862277 17:82703301-82703323 CCATTCAGCACTGGGGGCCCAGG No data
1152862264_1152862277 18 Left 1152862264 17:82703260-82703282 CCCACGCTGGAGCAGGGCACAGC No data
Right 1152862277 17:82703301-82703323 CCATTCAGCACTGGGGGCCCAGG No data
1152862265_1152862277 17 Left 1152862265 17:82703261-82703283 CCACGCTGGAGCAGGGCACAGCG No data
Right 1152862277 17:82703301-82703323 CCATTCAGCACTGGGGGCCCAGG No data
1152862260_1152862277 30 Left 1152862260 17:82703248-82703270 CCGCCAGTGGTTCCCACGCTGGA No data
Right 1152862277 17:82703301-82703323 CCATTCAGCACTGGGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152862277 Original CRISPR CCATTCAGCACTGGGGGCCC AGG Intergenic
No off target data available for this crispr