ID: 1152862862

View in Genome Browser
Species Human (GRCh38)
Location 17:82705852-82705874
Sequence GCCGGCGGGAGCCACCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152862862_1152862872 17 Left 1152862862 17:82705852-82705874 CCGTCCTGGTGGCTCCCGCCGGC No data
Right 1152862872 17:82705892-82705914 GACTGCTGTGTCCACCGGGCCGG No data
1152862862_1152862873 18 Left 1152862862 17:82705852-82705874 CCGTCCTGGTGGCTCCCGCCGGC No data
Right 1152862873 17:82705893-82705915 ACTGCTGTGTCCACCGGGCCGGG No data
1152862862_1152862874 19 Left 1152862862 17:82705852-82705874 CCGTCCTGGTGGCTCCCGCCGGC No data
Right 1152862874 17:82705894-82705916 CTGCTGTGTCCACCGGGCCGGGG No data
1152862862_1152862870 12 Left 1152862862 17:82705852-82705874 CCGTCCTGGTGGCTCCCGCCGGC No data
Right 1152862870 17:82705887-82705909 GCTGTGACTGCTGTGTCCACCGG No data
1152862862_1152862871 13 Left 1152862862 17:82705852-82705874 CCGTCCTGGTGGCTCCCGCCGGC No data
Right 1152862871 17:82705888-82705910 CTGTGACTGCTGTGTCCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152862862 Original CRISPR GCCGGCGGGAGCCACCAGGA CGG (reversed) Intergenic
No off target data available for this crispr