ID: 1152864171

View in Genome Browser
Species Human (GRCh38)
Location 17:82712423-82712445
Sequence TCTGAGAGCTGAACGCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152864171_1152864173 -7 Left 1152864171 17:82712423-82712445 CCAGCTAGCGTTCAGCTCTCAGA No data
Right 1152864173 17:82712439-82712461 TCTCAGAAGAGAGGAGACCCTGG No data
1152864171_1152864174 -2 Left 1152864171 17:82712423-82712445 CCAGCTAGCGTTCAGCTCTCAGA No data
Right 1152864174 17:82712444-82712466 GAAGAGAGGAGACCCTGGAATGG No data
1152864171_1152864175 -1 Left 1152864171 17:82712423-82712445 CCAGCTAGCGTTCAGCTCTCAGA No data
Right 1152864175 17:82712445-82712467 AAGAGAGGAGACCCTGGAATGGG No data
1152864171_1152864178 19 Left 1152864171 17:82712423-82712445 CCAGCTAGCGTTCAGCTCTCAGA No data
Right 1152864178 17:82712465-82712487 GGGTAGTTCCTCTCTGCAGCTGG 0: 14
1: 161
2: 268
3: 346
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152864171 Original CRISPR TCTGAGAGCTGAACGCTAGC TGG (reversed) Intergenic
No off target data available for this crispr