ID: 1152866375

View in Genome Browser
Species Human (GRCh38)
Location 17:82726216-82726238
Sequence CTGTAGCCTTCCAAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152866375_1152866384 24 Left 1152866375 17:82726216-82726238 CCTTCATTCTTGGAAGGCTACAG 0: 1
1: 0
2: 0
3: 22
4: 154
Right 1152866384 17:82726263-82726285 CTTCCCACTGCTCTTGGGATAGG 0: 1
1: 0
2: 4
3: 28
4: 208
1152866375_1152866383 19 Left 1152866375 17:82726216-82726238 CCTTCATTCTTGGAAGGCTACAG 0: 1
1: 0
2: 0
3: 22
4: 154
Right 1152866383 17:82726258-82726280 CCATGCTTCCCACTGCTCTTGGG 0: 1
1: 0
2: 3
3: 43
4: 278
1152866375_1152866381 18 Left 1152866375 17:82726216-82726238 CCTTCATTCTTGGAAGGCTACAG 0: 1
1: 0
2: 0
3: 22
4: 154
Right 1152866381 17:82726257-82726279 CCCATGCTTCCCACTGCTCTTGG 0: 1
1: 0
2: 2
3: 39
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152866375 Original CRISPR CTGTAGCCTTCCAAGAATGA AGG (reversed) Intronic
902884750 1:19396548-19396570 CCGCAGCCTTCCCAGCATGAAGG + Intronic
904811583 1:33166457-33166479 CTGTAGCCCTCGGAGAATGTTGG - Intronic
915419733 1:155770412-155770434 CTTTAGCCTTCCAAGTATCCTGG - Intronic
915798638 1:158764628-158764650 ATGTATCCTTCCATGAATGGAGG - Intergenic
917616889 1:176755053-176755075 CTGGAGCCTTGCAACACTGATGG - Intronic
919810511 1:201406087-201406109 CTGTGTCCTTCCAAGAAAGTTGG + Exonic
921097035 1:211895530-211895552 CTGTGGCCTTTCAGGGATGAAGG - Intergenic
1064430864 10:15268717-15268739 CTGGAGCCTCCCAAGAAGAAGGG + Intronic
1066031860 10:31435738-31435760 GTGGAGCCTTGCAGGAATGATGG + Intronic
1066115022 10:32232142-32232164 CTGTTGCCTTCCAGGTATGAAGG + Intergenic
1070223139 10:74472087-74472109 CCTTAGCCTTCCAAGTATGTAGG - Intronic
1071144605 10:82553417-82553439 CTGTAGACTCCAAAGAAAGATGG - Intronic
1073497619 10:103908195-103908217 CTGTAGCCTTCCAATATTCTAGG + Intronic
1074052037 10:109888748-109888770 CTGTAGCCTTCCAGGATTAAGGG - Intronic
1074617540 10:115084588-115084610 CTGAAGTCTTCCAAGACTGATGG + Intergenic
1074773909 10:116752298-116752320 CTTTAGACTTCAAAGAAAGAGGG - Intergenic
1074818392 10:117162087-117162109 CTGTAGCCTTCCAATGACTAGGG + Intergenic
1079529070 11:21427182-21427204 CAACAGCCTTCCAAGAATAAGGG + Intronic
1079594067 11:22219616-22219638 CAGTTGCCTTCCAAGAATTTTGG + Intronic
1080537571 11:33237088-33237110 CTGTTGCCTTCCCAGGGTGAAGG - Intergenic
1080646451 11:34191653-34191675 CTGAACCCTTCTAAGAATAAGGG - Intronic
1080696024 11:34603681-34603703 CTGTTGGCTTCCGAGAATGAGGG + Intergenic
1080937401 11:36878857-36878879 TTGCAGACTTCCAAGTATGATGG - Intergenic
1083615606 11:64024656-64024678 CTCCATCCTTGCAAGAATGAGGG + Intronic
1084790103 11:71469700-71469722 TTGTTGGCTTCCCAGAATGAGGG - Intronic
1085956407 11:81401645-81401667 CTTTATTCTTACAAGAATGATGG + Intergenic
1091875089 12:3927042-3927064 CTGTCTTCTTCCAAGGATGAAGG - Intergenic
1092687427 12:11066541-11066563 CTGTAACTTTCCCACAATGATGG + Intronic
1095301286 12:40586966-40586988 ATGTAACCATCCAAGAATGTAGG - Intergenic
1095307630 12:40656846-40656868 CAGAAGCCTTCCAAGAAGGAAGG - Intergenic
1097691516 12:62738797-62738819 ATGCAGCCTCCCTAGAATGAAGG - Intronic
1099330035 12:81273177-81273199 TTGTGGACTTCCAAGAAGGATGG - Intronic
1102848579 12:116215789-116215811 CTGCATCTTTCCAAGAATGATGG + Intronic
1105357866 13:19676088-19676110 CTGTGGCCTTCAAAGAGAGAAGG - Intronic
1106609195 13:31262428-31262450 CTTGACCCTTCTAAGAATGAAGG - Intronic
1108254595 13:48598286-48598308 CTGAAGGTTTCCAAGATTGAGGG - Intergenic
1109895773 13:68687259-68687281 CTATAGCCTTCTGAGAAAGAAGG + Intergenic
1111219551 13:85186094-85186116 CTGTAGCCTGTCAAGCATTATGG + Intergenic
1115732350 14:36285094-36285116 CTTTTGTCTTCCAAGTATGACGG - Intergenic
1116210303 14:41931084-41931106 ATGTAGCCTTTCAAGCATTATGG - Intergenic
1116350418 14:43855368-43855390 CTTTACCCTTCCTAGAATAAAGG - Intergenic
1119376499 14:74198266-74198288 CTATAGCATTCAAAGATTGATGG + Intronic
1119561765 14:75596104-75596126 CTGTTGCCTTCCCAGGGTGAAGG + Intronic
1120019801 14:79515712-79515734 CTGTAGTGTGCCAAGTATGAGGG + Intronic
1126222726 15:46232956-46232978 CTGTAGGCTTGAATGAATGATGG - Intergenic
1126943068 15:53786794-53786816 CTGTAGCCTTCCTGGAAAGCAGG - Intergenic
1131817777 15:96239891-96239913 CTGGTGCCTTCCTAGAAGGAAGG - Intergenic
1131872416 15:96776170-96776192 GTGGAGCCTTCCAGGAAGGAAGG - Intergenic
1132860516 16:2069189-2069211 ATGTGGCCTTCCCAGAATGGGGG + Intronic
1137004625 16:35262867-35262889 CTGTTGGCTTACCAGAATGAAGG + Intergenic
1138422235 16:56906614-56906636 CTGTTGCCTTCCCAGGGTGAAGG - Intronic
1139877863 16:70160789-70160811 CAGTAGCGATGCAAGAATGATGG + Exonic
1140650777 16:77085662-77085684 CTTTATCCTTCCAAGAGAGAAGG + Intergenic
1141010784 16:80396414-80396436 CTAAAGCCTTCCCAGAATCAAGG + Intergenic
1141252271 16:82369455-82369477 CAGTAGCCTGCCAAGAATGGGGG + Intergenic
1146937080 17:36818651-36818673 TTGTAGCCTTGCAAGGATGTAGG - Intergenic
1149133469 17:53336641-53336663 CTGAAGTCTTCCAGAAATGAAGG + Intergenic
1149263909 17:54907240-54907262 CTGTAGAAATCCCAGAATGATGG + Intronic
1149596803 17:57869048-57869070 CTGTGGCCTCCCAGGAGTGAGGG - Intronic
1150453445 17:65288328-65288350 CTGAAGCCTTCAAAGAGAGACGG + Intergenic
1151912486 17:77093050-77093072 CTGTAGACTTGGAAGAATGAGGG + Intronic
1152866375 17:82726216-82726238 CTGTAGCCTTCCAAGAATGAAGG - Intronic
1154312338 18:13277052-13277074 CTGTAGGCTCCCAACACTGATGG + Intronic
1154427530 18:14283655-14283677 CTGTAGCTTTTCAACACTGAGGG - Intergenic
1154430258 18:14303195-14303217 CTGTAGCTTTTCAACACTGAGGG - Intergenic
1155422780 18:25673062-25673084 CAGTAGCCTTTCAAGATTCAAGG - Intergenic
1155462522 18:26098916-26098938 CTGTTGCCTTCCCAGGGTGAAGG - Intergenic
1158828486 18:61251630-61251652 CTGTACCCTTCTAGGAAGGATGG - Intergenic
1161421059 19:4176075-4176097 GAGTAGCCTTCCATGAATAACGG + Intronic
1162891603 19:13737273-13737295 CTGCAGCCTCCCAAAAATGCTGG + Intronic
1164674005 19:30089900-30089922 CTTTAAGCTTCCAAGAAAGAGGG - Intergenic
1167030181 19:46953699-46953721 CTCTACCCTTTCAAGTATGAAGG - Intronic
1167321006 19:48797120-48797142 CTGTAACCTGCCAGGAATGATGG + Intronic
1168091788 19:54090341-54090363 CTGTGCCCTTCTAAAAATGAGGG - Intergenic
925316341 2:2928933-2928955 CTGTAGGCTTCCTAGATTGGTGG + Intergenic
926358849 2:12066420-12066442 CTTTTGCCTTTCAAGAATAAGGG + Intergenic
926927098 2:17997879-17997901 GTGGAGCCTTCCAAGAAACAGGG - Intronic
930595992 2:53388546-53388568 CTGTAAGCTTCCAAGAAAAACGG + Intergenic
931386559 2:61803157-61803179 CTGTTGCCTTCCCGGGATGAAGG - Intergenic
931752933 2:65346829-65346851 CTGAAGTCTTCAAGGAATGAAGG - Intronic
932202113 2:69838997-69839019 CTGTACCTTTCCAAGAATTCAGG + Intronic
935611741 2:105032782-105032804 ATGTAGCATTTCAAGAATAATGG + Intergenic
940616666 2:156057252-156057274 CTGAAGTCTTCCCAGAATGGTGG + Intergenic
942438187 2:176003467-176003489 CTGTACACTTGCAAGGATGAGGG + Intergenic
942518416 2:176777518-176777540 TTGTTGCCTTGCAGGAATGAAGG + Intergenic
943052849 2:182937552-182937574 CTGTATCCTTCAAGCAATGAGGG + Intronic
943288095 2:186031116-186031138 TTGTAGCCTTCAAAAAACGATGG - Intergenic
943328336 2:186528270-186528292 CTTCAGCCTTCCAAGAATTTAGG + Intergenic
946470066 2:219951223-219951245 ATGTAGCCTTCAAAGACTGTGGG + Intergenic
948181861 2:235988638-235988660 CTGTAACTTTCCAGTAATGAGGG + Intronic
948822009 2:240554789-240554811 CTTTATCCTTCCAAGAGTGATGG - Intronic
1168778240 20:466130-466152 CTTCAGCCTCCCAAAAATGATGG + Intergenic
1169876713 20:10305974-10305996 CTTTTGTCTTCCCAGAATGACGG - Intronic
1170815051 20:19706776-19706798 CTGGAGCCTGACAAGACTGATGG + Intronic
1172021375 20:31916741-31916763 CTGTAGCATTCAAAGAAAGAAGG + Intronic
1174096988 20:48097440-48097462 CTGTAGCTTCCAAGGAATGACGG + Intergenic
1180890617 22:19285622-19285644 CTTCAGCCTGCCAAGAGTGATGG + Intronic
1182006973 22:26969052-26969074 CTGGTGCCTTCCCACAATGATGG - Intergenic
1182368383 22:29793711-29793733 CTGCGGCCTTCCAAGCCTGATGG - Intronic
951099106 3:18666327-18666349 CAGTACCCTTGTAAGAATGAAGG + Intergenic
951349362 3:21586624-21586646 ATGTAGGCTTGCAAGAAGGATGG + Intronic
951812567 3:26716761-26716783 ATGTATGCTTCCAAGAGTGAGGG - Intergenic
952026359 3:29087486-29087508 CTGAAGACTTCCAAGAGTGAAGG - Intergenic
952143311 3:30503384-30503406 CTGTAGCTTTGCAAGTATGCAGG - Intergenic
952650695 3:35723391-35723413 CTGAATCTTTCCAAGAATCAGGG - Intronic
952958199 3:38573724-38573746 CTGTAGGCTTCAGAGAAAGATGG - Intronic
952978331 3:38715096-38715118 CTGGAGCCTTGCATGAATGAAGG - Intronic
953449537 3:42994742-42994764 CTGCTGCCTTCCAAGAATTAGGG - Intronic
955227108 3:57069758-57069780 CCTTAGCCTTCCAAGTATGTGGG + Intronic
955710967 3:61778704-61778726 CTGTAGCCTTGAAGGAGTGAAGG + Intronic
957808137 3:85178905-85178927 TTGTAGCATTCCAAGTATAATGG - Intronic
959881442 3:111448519-111448541 CTGGAGCTCTCCAAGAATCAGGG - Intronic
962256966 3:133878086-133878108 CTGGAGTCTTCAAAGGATGAAGG + Intronic
968603141 4:1519853-1519875 CTGCAACCTTCCAATAATGCAGG + Intergenic
970706974 4:18816116-18816138 CTGTAGCTTTTCCAGATTGAGGG - Intergenic
971862480 4:32125700-32125722 TTTCAGCCTTCCTAGAATGACGG + Intergenic
977380694 4:96270094-96270116 CTGTAGCTTTGCCAGAATGTTGG - Intergenic
979218034 4:118189457-118189479 CTGTAGCATCCCAAAATTGAAGG + Intronic
980022384 4:127724969-127724991 CTGTAGCATTTCAAGAACCAAGG - Exonic
981006763 4:139883080-139883102 GTGAAACGTTCCAAGAATGATGG + Intronic
981531649 4:145760174-145760196 CTGTAGCCATCAAAGAGAGAGGG + Intronic
981936929 4:150248950-150248972 CTGGAGCCTCCCAGAAATGACGG - Intronic
983672509 4:170254519-170254541 CTGTAGGCTTACAAGAAGCATGG - Intergenic
984034488 4:174648681-174648703 CTCCTGCCTTCCCAGAATGAGGG - Intronic
984469653 4:180152135-180152157 TTGAAGACTTCCAAGAATGAGGG - Intergenic
985311514 4:188604954-188604976 CTGTAACATTCCAGGCATGAAGG + Intergenic
986832621 5:11597687-11597709 CTGTAGCCTTCCAAGTAGATGGG + Intronic
987970449 5:24937509-24937531 CTGCAGCCTTCCAAGTATCTAGG + Intergenic
988332177 5:29856206-29856228 TGTTAGCTTTCCAAGAATGATGG + Intergenic
991428814 5:66521718-66521740 TTGTTGCCTTCCAAGAATAAAGG - Intergenic
993215520 5:85018157-85018179 CTGTAGACTTACAAGAAGTATGG + Intergenic
993580037 5:89649740-89649762 ATGTAGCCTTTCCAGAATCAGGG + Intergenic
994244579 5:97465761-97465783 CTGGAGCCCTTCAAGAATCAAGG + Intergenic
999763731 5:154722626-154722648 CTCTAACATTCTAAGAATGAGGG - Intronic
1005150006 6:22737846-22737868 CTGTAGCCTTCCAATGAAGGGGG - Intergenic
1007967041 6:46013177-46013199 ATGAAGACTTCCAAGAAGGATGG - Intronic
1012123354 6:95394922-95394944 CTGTAGTCTGCTCAGAATGATGG + Intergenic
1013130691 6:107229845-107229867 CTGTTGCCCTCCAAGGATAAAGG - Intronic
1014051865 6:116964203-116964225 ATGTAGCTTTCCAGGAATGGGGG + Intergenic
1018286407 6:162243849-162243871 CTGTTTCCTTCCAATCATGAAGG + Intronic
1019015115 6:168874370-168874392 CTGCAGCCTCCCCAGCATGACGG - Intergenic
1020413380 7:7917577-7917599 CTGTAGCCTTCTCTGAATGTGGG - Intronic
1021206105 7:17782966-17782988 TTATAGTCTCCCAAGAATGAAGG + Intergenic
1021273321 7:18619341-18619363 CTGTATACATCCAAGCATGAAGG - Intronic
1023529486 7:41137499-41137521 CTGTTTCCTTCCAAGTATCAGGG - Intergenic
1027466507 7:78522082-78522104 CTGTAGCTTTCAAAGGATTATGG + Intronic
1032280429 7:130495458-130495480 CTGAAGACTTCCATGAGTGAAGG - Exonic
1035380521 7:158437586-158437608 ACTGAGCCTTCCAAGAATGATGG - Intronic
1038032252 8:23652743-23652765 CAGTAGCCATTCAAGAATGGTGG + Intergenic
1038382527 8:27110025-27110047 CTGTAGCCTGCCAAGTATCCAGG + Intergenic
1038732596 8:30140698-30140720 CTGTTGCCTTCCCAGAGTGAAGG + Intronic
1039625778 8:39050920-39050942 CTGAAGGCTACAAAGAATGAAGG - Intronic
1039876219 8:41588820-41588842 CTGTTGCCTTCCTGGAATGGAGG + Intronic
1040102308 8:43516543-43516565 CTGTAGCTTTTCCAGACTGAGGG + Intergenic
1040660578 8:49570442-49570464 CTGTAACAATCCAAGAAGGATGG - Intergenic
1041208256 8:55520734-55520756 CTGTAGCCGTAGAAAAATGAAGG - Intronic
1043042957 8:75284768-75284790 CTATTACCTTCAAAGAATGATGG - Intergenic
1044030928 8:87236225-87236247 CTGAAGCCTTTGAAGAATAAGGG - Intronic
1045383109 8:101646463-101646485 CTGTAACCTTCCAGCAATAACGG + Intronic
1046292351 8:112179741-112179763 CTGGAGCCTTACAATCATGATGG + Intergenic
1048266507 8:132991982-132992004 GTGAAGCCTTCCAGGAAGGAAGG - Intronic
1052877815 9:33580538-33580560 CTGTAGCTTTCCCACATTGAGGG - Intergenic
1053498168 9:38563667-38563689 CTGTAGCTTTCCCACATTGAGGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056585854 9:87926679-87926701 CTGTAGCCTTTCCATACTGAGGG - Intergenic
1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG + Intergenic
1056714374 9:89015852-89015874 CTGTAGCCTGACTAGAATGAAGG - Intronic
1058601199 9:106672298-106672320 CTGTAGTCTTCCAAATATGTGGG - Intergenic
1058938278 9:109789548-109789570 CAGAATCCTTCCAAAAATGAAGG - Intronic
1060844421 9:126824511-126824533 AAGTATCCTTTCAAGAATGAAGG - Intronic
1188100708 X:26080324-26080346 ATGTAGCCTTCATAGAATGCAGG - Intergenic
1188190274 X:27164262-27164284 TTGTACCCTTCCAAGGATGAAGG + Intergenic
1191212073 X:57895890-57895912 ATACAACCTTCCAAGAATGAAGG + Intergenic
1195756772 X:108206378-108206400 CTTTAACCCTCCAAGAATGGAGG + Intronic
1197125054 X:122934576-122934598 CTGCAGCCTTACAAGAAGCATGG - Intergenic
1199606937 X:149585519-149585541 CTGGGGCCTTCCAAGACTGACGG + Intronic
1199632186 X:149783849-149783871 CTGGGGCCTTCCAAGACTGACGG - Intronic