ID: 1152867612

View in Genome Browser
Species Human (GRCh38)
Location 17:82733830-82733852
Sequence CAGGGCTGCCGCAGAACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152867612_1152867621 10 Left 1152867612 17:82733830-82733852 CCTGCTGTTCTGCGGCAGCCCTG No data
Right 1152867621 17:82733863-82733885 CAAGAGGTGGCTGCTTGGCCGGG No data
1152867612_1152867620 9 Left 1152867612 17:82733830-82733852 CCTGCTGTTCTGCGGCAGCCCTG No data
Right 1152867620 17:82733862-82733884 TCAAGAGGTGGCTGCTTGGCCGG No data
1152867612_1152867613 -6 Left 1152867612 17:82733830-82733852 CCTGCTGTTCTGCGGCAGCCCTG No data
Right 1152867613 17:82733847-82733869 GCCCTGCCACTCCTGTCAAGAGG No data
1152867612_1152867619 5 Left 1152867612 17:82733830-82733852 CCTGCTGTTCTGCGGCAGCCCTG No data
Right 1152867619 17:82733858-82733880 CCTGTCAAGAGGTGGCTGCTTGG No data
1152867612_1152867616 -3 Left 1152867612 17:82733830-82733852 CCTGCTGTTCTGCGGCAGCCCTG No data
Right 1152867616 17:82733850-82733872 CTGCCACTCCTGTCAAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152867612 Original CRISPR CAGGGCTGCCGCAGAACAGC AGG (reversed) Intergenic
No off target data available for this crispr