ID: 1152867943

View in Genome Browser
Species Human (GRCh38)
Location 17:82735462-82735484
Sequence GCTTCGCGCTTCCTGCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152867943_1152867951 16 Left 1152867943 17:82735462-82735484 CCCGGGCGCAGGAAGCGCGAAGC 0: 1
1: 0
2: 2
3: 5
4: 83
Right 1152867951 17:82735501-82735523 GCGCGCGGCGAGCCCGCCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 100
1152867943_1152867950 1 Left 1152867943 17:82735462-82735484 CCCGGGCGCAGGAAGCGCGAAGC 0: 1
1: 0
2: 2
3: 5
4: 83
Right 1152867950 17:82735486-82735508 GGACGAACGCGGGGAGCGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 115
1152867943_1152867947 -9 Left 1152867943 17:82735462-82735484 CCCGGGCGCAGGAAGCGCGAAGC 0: 1
1: 0
2: 2
3: 5
4: 83
Right 1152867947 17:82735476-82735498 GCGCGAAGCCGGACGAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 14
1152867943_1152867946 -10 Left 1152867943 17:82735462-82735484 CCCGGGCGCAGGAAGCGCGAAGC 0: 1
1: 0
2: 2
3: 5
4: 83
Right 1152867946 17:82735475-82735497 AGCGCGAAGCCGGACGAACGCGG 0: 1
1: 0
2: 0
3: 1
4: 14
1152867943_1152867948 -8 Left 1152867943 17:82735462-82735484 CCCGGGCGCAGGAAGCGCGAAGC 0: 1
1: 0
2: 2
3: 5
4: 83
Right 1152867948 17:82735477-82735499 CGCGAAGCCGGACGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152867943 Original CRISPR GCTTCGCGCTTCCTGCGCCC GGG (reversed) Intergenic
900100209 1:959291-959313 GCTGCGCACTTCCGCCGCCCAGG + Intronic
905800248 1:40838353-40838375 TATTCGCGCTGCCTGCGCTCTGG + Exonic
906116286 1:43359288-43359310 GCTTTGCGCTGCCAGCGCGCAGG - Exonic
911664785 1:100539889-100539911 GCTTCTCGCTGCCGGTGCCCTGG + Exonic
913449009 1:118979811-118979833 GCATCGCGCCGCGTGCGCCCGGG - Intronic
917484632 1:175444482-175444504 GCTCAGAGCTTCCTGAGCCCTGG + Intronic
1066267179 10:33787686-33787708 GCTCCACTCTTCCAGCGCCCTGG - Intergenic
1070727616 10:78803064-78803086 CCCACGCGCTTCCTGCGGCCTGG - Intergenic
1074137918 10:110644128-110644150 CCTCCCCGCTTCCTGCGCCCAGG + Intergenic
1076141460 10:128081846-128081868 GCTTAGCCCTTCCTGAGTCCCGG - Intronic
1077048360 11:555826-555848 GCTTCCCGCTCCCTGAGGCCGGG - Exonic
1077373744 11:2195604-2195626 GCTCCCCGCTTCCCGCCCCCGGG + Intergenic
1091973833 12:4809794-4809816 GCTTCCCGTTACCCGCGCCCGGG - Exonic
1092246740 12:6868043-6868065 GCTTCCCGCTCCCTGCGCCCTGG + Intronic
1092564231 12:9648065-9648087 GCCTCGCGCCTCCCGCCCCCCGG + Intergenic
1096465783 12:51847319-51847341 GCTTCCCGGTTCCTGGGCCGTGG - Intergenic
1107467532 13:40664775-40664797 GGCGCGGGCTTCCTGCGCCCGGG + Intronic
1112652620 13:101416052-101416074 GCATCGCGGCTCCCGCGCCCCGG + Intronic
1113771225 13:112910731-112910753 GGCTCGGGCTTCCTGCCCCCCGG + Intronic
1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG + Intronic
1119738514 14:76999204-76999226 GCTTCGCTCTCCCTGCAACCTGG - Intergenic
1124077733 15:26461867-26461889 GCATCATGCCTCCTGCGCCCTGG + Intergenic
1131174425 15:90201235-90201257 CCCTCGCGCTGCCAGCGCCCGGG + Intronic
1132556451 16:574852-574874 GATGCGCTCTTCCTGGGCCCGGG + Intronic
1137683072 16:50368379-50368401 GCCTCGGGCTTGCTGCGCCTTGG - Intronic
1140224058 16:73064818-73064840 GCTCCGCGCCTCCTGCCCCAAGG - Intergenic
1141170554 16:81688012-81688034 GCTCTGCGCTGCCTGCGCACCGG - Intronic
1143376654 17:6471241-6471263 GCCTCGAGGTTCCAGCGCCCAGG - Exonic
1147382288 17:40062978-40063000 GCCGCCCGCCTCCTGCGCCCGGG - Exonic
1147583470 17:41639325-41639347 GCTCCTCCCTCCCTGCGCCCTGG + Intergenic
1152569272 17:81114446-81114468 GCTTTGCCCTTCCTGGGGCCTGG - Intronic
1152867943 17:82735462-82735484 GCTTCGCGCTTCCTGCGCCCGGG - Intergenic
1158259051 18:55587935-55587957 GCTCCGCGCCTCCCGCGCCGCGG - Intronic
1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG + Intergenic
1160630906 18:80246448-80246470 CCCTCCCGCTGCCTGCGCCCGGG - Intronic
1161002481 19:1917832-1917854 GCTTCCCGCCTCCTGCCCCCAGG - Intronic
1161066466 19:2240921-2240943 GCTCCGCTCCTCCTGGGCCCTGG + Intronic
1165242746 19:34481312-34481334 GCTTCGCCCGTCCCGCGCCCAGG - Intergenic
927904379 2:26846877-26846899 GCTCTGCGGGTCCTGCGCCCGGG + Intergenic
930358318 2:50347204-50347226 GCTCCGCGCTTGCTGTTCCCGGG - Intronic
932585871 2:73028416-73028438 GCATGGCCCTCCCTGCGCCCAGG - Intronic
937917465 2:127106169-127106191 GCTTAGCGTTTCCGGCGGCCGGG - Intronic
938302995 2:130229306-130229328 GCTACGCACTTCCGTCGCCCAGG - Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
948262076 2:236612051-236612073 GCTTCAGGCTTCCTGAGCGCTGG - Intergenic
1169383325 20:5127267-5127289 CCTTCGCGCTACCCGGGCCCGGG - Intronic
1172443059 20:34979216-34979238 GCTCCGCCCTTCCTGAGCCTGGG + Intronic
1174009907 20:47441327-47441349 CCTTCCCGCTTCCTGCTGCCAGG + Intergenic
1175227371 20:57452461-57452483 GTTTGGCACATCCTGCGCCCAGG - Intergenic
1175788274 20:61725419-61725441 GCTTCGCGCTGCCTGGGAGCAGG + Intronic
1178672374 21:34603306-34603328 GCTTCTCCCTACCTGCGGCCTGG + Intronic
1180960607 22:19760750-19760772 GCGCCGCGCTGCGTGCGCCCCGG - Intronic
1181057865 22:20268357-20268379 GCTGAGCGCCTCCTGCGGCCCGG - Exonic
1182439788 22:30356589-30356611 GCTGCGCGCTTCCCGCGCTATGG - Intronic
1182704284 22:32266113-32266135 GTTTCCCCCTTCCTGCTCCCTGG - Intergenic
1183325192 22:37187731-37187753 GCTTCCTGATTCCTGCTCCCAGG - Intronic
957048802 3:75396239-75396261 GGTGCGCGCCTCCTGCACCCCGG + Intergenic
959388913 3:105748537-105748559 GCTTCTCCCTTCCTTCTCCCTGG - Intronic
961386132 3:126524408-126524430 GCGCCCCGCTCCCTGCGCCCGGG + Exonic
961551508 3:127672739-127672761 GGGCGGCGCTTCCTGCGCCCCGG + Exonic
961674397 3:128555828-128555850 GCTGCGGGCTTCCTGAGGCCTGG - Intergenic
963882695 3:150546283-150546305 ACCTCGCGCTTGCGGCGCCCAGG - Exonic
968268094 3:197378113-197378135 GCTCCGCACTTCCTGCTTCCTGG + Intergenic
968704216 4:2070469-2070491 TCTTGGTGCTTCCTGCCCCCTGG - Intergenic
968734091 4:2286232-2286254 GCTTCTCCCTCCCGGCGCCCAGG + Intronic
969327922 4:6454375-6454397 GCTTGGCCCTTCCTGACCCCTGG - Intronic
969525050 4:7700067-7700089 GCCACGTGCTTCCTGCTCCCTGG + Intronic
969574129 4:8026523-8026545 CCTTCTCGCTGCCTGCGGCCTGG + Intronic
970955479 4:21805760-21805782 GCTACACCCTTCCTGAGCCCTGG + Intronic
982441512 4:155441652-155441674 GCTTTGCCCTTCCTCTGCCCTGG + Intergenic
985731982 5:1554347-1554369 GCATGGCTCTTCCTGTGCCCTGG - Intergenic
992439874 5:76788678-76788700 GCTTCCTGCTTCCTGCTTCCTGG - Intergenic
1001381365 5:171308666-171308688 GCTTCGCGCTGCCTGCGCGCGGG - Exonic
1007321027 6:41028740-41028762 GCTTCCCACCTCCTGTGCCCTGG - Intronic
1017021298 6:150142709-150142731 GCGGCGCGTTTCCTGCGCTCCGG + Intergenic
1017131440 6:151111541-151111563 GCTTCGACCTTCCTGGGCTCAGG + Intergenic
1019356486 7:582607-582629 GCTTCTTGCTTCCTGCGTCCCGG - Intronic
1022109630 7:27220477-27220499 GGTTCGTGCATCCTGCGCCTGGG - Intergenic
1025246729 7:57323193-57323215 GATTCGCCCTTCCTCTGCCCAGG - Intergenic
1028762533 7:94510596-94510618 GCCTTGGGCTTCATGCGCCCCGG - Intronic
1033651230 7:143345589-143345611 GCTGCGCGCAGCCTGCGCTCAGG - Exonic
1039834366 8:41245040-41245062 GGTTCACTCTTCCTGCACCCTGG + Intergenic
1044821814 8:96160432-96160454 GCCTGGCGGCTCCTGCGCCCGGG + Exonic
1045375710 8:101571789-101571811 GCCTCCCGCTTCCTGCCCCCAGG - Intronic
1047024506 8:120811594-120811616 GCTGCGCGCCGCCCGCGCCCGGG + Exonic
1049184638 8:141243310-141243332 GCTTCGTGCTTGCTGCGGCGGGG - Intronic
1049676441 8:143891335-143891357 GCTCTGCGCTTGCTGCTCCCCGG + Intergenic
1053466455 9:38312049-38312071 GCTGTGTGCTTCCTGCTCCCTGG - Intergenic
1057432318 9:95005231-95005253 GCGGCGCGGTCCCTGCGCCCCGG + Intronic
1062274595 9:135724821-135724843 GATTGGAGCTTCCTCCGCCCAGG + Intronic
1187547675 X:20268168-20268190 GCTGCGCGCTAAGTGCGCCCGGG + Intergenic