ID: 1152870470

View in Genome Browser
Species Human (GRCh38)
Location 17:82751054-82751076
Sequence ACGGGGATGGAGGATGGGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1238
Summary {0: 1, 1: 2, 2: 7, 3: 148, 4: 1080}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152870470 Original CRISPR ACGGGGATGGAGGATGGGGA CGG (reversed) Exonic
900149093 1:1170527-1170549 AGGAGGAGGGAGGAGGGGGAAGG - Intergenic
900206452 1:1433824-1433846 ACGGGGAGAGCTGATGGGGAGGG + Intergenic
900420669 1:2554679-2554701 AGGGGCATGGAGGAAGGGGCAGG + Intergenic
900593831 1:3471531-3471553 ATGGGGCTGGGGGAGGGGGAGGG + Intronic
900758061 1:4451241-4451263 ACTGGGAAGGAGGAAGGGGCTGG - Intergenic
900944545 1:5822442-5822464 ACAGGACTGGAGGCTGGGGATGG + Intergenic
901163771 1:7199731-7199753 AGGAGGATGGTGGCTGGGGAGGG + Intronic
901192631 1:7421736-7421758 TCCGTGATGGAGGATGGGAAGGG + Intronic
901196830 1:7445040-7445062 ACGGGGTAGGAGGTGGGGGATGG + Intronic
901266197 1:7912779-7912801 CCTGGGATGGAGCTTGGGGAGGG - Intergenic
901266443 1:7914239-7914261 ACGGGGAGGGGGAAGGGGGAGGG - Intergenic
901644411 1:10708952-10708974 CAAGGGATGGAGGACGGGGAGGG + Intronic
901686189 1:10944839-10944861 ACAGGGATGGAGAAAGGGCAGGG + Intergenic
901826140 1:11862781-11862803 AGGAAGATGGAAGATGGGGAGGG + Intergenic
901838536 1:11939345-11939367 GTGGGGATGAAGGATGGGGGAGG + Intronic
901839947 1:11947928-11947950 ATGGGAATGGAGGATGAGGGAGG - Intronic
902044881 1:13516798-13516820 CTGGGGGTGGGGGATGGGGAAGG - Intergenic
902054295 1:13587470-13587492 ACGGGGGAGGAGGAGGAGGAGGG + Intronic
902517637 1:16997881-16997903 AGGGGGAAGGAGGAGGGGGAGGG + Intronic
902598492 1:17525176-17525198 ATGGGGAGGGAGGAGAGGGAGGG + Intergenic
902615440 1:17621057-17621079 ACGGTGATGGTGGAAGGGAAAGG + Intronic
902729071 1:18356923-18356945 ATGGAGATTGAGGATGGGGAGGG + Intronic
902933268 1:19746064-19746086 ACGAGGTTGGAGGAGTGGGAGGG + Intronic
903029566 1:20453244-20453266 AAGGGGCTGGAGGAGGGTGAGGG - Intergenic
903225773 1:21893516-21893538 GTGGGGAGAGAGGATGGGGAGGG + Intronic
903270870 1:22187486-22187508 AAGGGGCTGGAGGAAGGGGAGGG - Intergenic
903480869 1:23652407-23652429 AGGGAGAGGGAGGAGGGGGAAGG + Intergenic
903532283 1:24040631-24040653 ACGGAGATGGATGGTGGTGATGG + Intergenic
903646612 1:24899948-24899970 CAGGGGATGGGGGATGGGGTAGG + Exonic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904044868 1:27603148-27603170 ACGGGGAGGGGGGGCGGGGAGGG - Intronic
904087190 1:27917127-27917149 AAGGGGAAGGAGGAAGGAGAAGG - Intergenic
904087193 1:27917140-27917162 AAGAGGAAGGAGGAAGGGGAAGG - Intergenic
904285838 1:29452812-29452834 ACGGGGATGCAGGAGGGGAAGGG + Intergenic
905013107 1:34760221-34760243 TCAGGGATTGGGGATGGGGAAGG + Intronic
905222228 1:36456123-36456145 ACTGGGATGGAGGAAGCAGAAGG - Intronic
905254553 1:36671836-36671858 AGGAGGATGGAGGTGGGGGAGGG - Intergenic
905256471 1:36688566-36688588 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256492 1:36688620-36688642 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256513 1:36688674-36688696 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256612 1:36688944-36688966 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256635 1:36689008-36689030 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905761966 1:40566365-40566387 GCGGGGAGGGAGGATGAGTAGGG + Intergenic
905912925 1:41666042-41666064 ATGGGGATGGAGGATGGAGAGGG - Intronic
906282813 1:44565805-44565827 ACTGGGTTGCAGGACGGGGATGG - Intronic
906469060 1:46111946-46111968 AGGGGGATGGAGGACAGAGATGG - Intronic
906483555 1:46217505-46217527 AGGAGGATGGAAGATGGGAAGGG + Intronic
906505220 1:46373917-46373939 AAGGCGTTGGGGGATGGGGATGG + Intergenic
906562028 1:46765477-46765499 AAGTGGGTGGAGGGTGGGGAAGG - Intronic
906708132 1:47909780-47909802 AAGGGGGGGGGGGATGGGGAGGG - Intronic
906752054 1:48273483-48273505 TGTGGGGTGGAGGATGGGGAGGG - Intergenic
907004481 1:50896850-50896872 ACGGAGATGGATGATGGTGATGG + Intronic
907389985 1:54151839-54151861 AGGTTGATGGAGGATGTGGAAGG + Intronic
907451494 1:54548339-54548361 ACGGGTATGGAGGGTGGGCTGGG + Exonic
907629528 1:56066368-56066390 AGCAGGATGGAGGATGGTGATGG + Intergenic
907753661 1:57288305-57288327 AAGAGGATGGGGGATGGGGGAGG + Intronic
908321071 1:62979478-62979500 TAGGGGATGGAGGATGGGTTGGG - Intergenic
908331481 1:63074977-63074999 ACGGGTATTGAGGATGGGGAGGG - Intergenic
908333475 1:63096041-63096063 ATGGGGATGGACAATGGGAATGG + Intergenic
908556291 1:65259789-65259811 GAGGGGTGGGAGGATGGGGAGGG + Intronic
908681186 1:66663214-66663236 AAGTGGGTGGGGGATGGGGAGGG - Intronic
909428021 1:75550378-75550400 CAGGGGCTGGAGGATGGGCATGG + Intronic
910289837 1:85589100-85589122 AAGGGGATGGAAGAGTGGGAAGG + Intergenic
910570331 1:88694278-88694300 CAGGGGATGGAGGAGAGGGAAGG - Intronic
911098923 1:94078563-94078585 GGGGGGTTGGAGGATGGGGAGGG - Intronic
911693291 1:100859965-100859987 GCAGGGATGGTGGATGAGGAAGG - Intergenic
911995216 1:104758075-104758097 ATGGGGAGGGGGGATGGGGGAGG + Intergenic
912537891 1:110389261-110389283 CCCTGGATGGAGGATGGGGATGG - Exonic
912733204 1:112127962-112127984 ACGGGGATGGAGGTTATGCATGG - Intergenic
912802574 1:112729495-112729517 TGGAGGATGGAGGGTGGGGATGG + Intergenic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
913344324 1:117793004-117793026 ACATGGATGGAGCAGGGGGAAGG + Intergenic
914263649 1:146019860-146019882 AGGGGGTTGGGGGCTGGGGAAGG - Intronic
914927132 1:151898232-151898254 ACGGGGATGTTGGAAGGGCATGG + Intronic
914964062 1:152237477-152237499 GCTGGGATGGAGGGAGGGGAGGG + Intergenic
915074144 1:153295143-153295165 TAAGGGATGGAGGTTGGGGAGGG + Intergenic
915213129 1:154324769-154324791 ACCTGGATGCTGGATGGGGACGG + Exonic
915366779 1:155321282-155321304 AAGGAGGTGGAGGATGGGGGTGG - Intronic
915444297 1:155966200-155966222 ATGGGGATGAGGGCTGGGGATGG - Intronic
915580120 1:156808526-156808548 GCAAGGAGGGAGGATGGGGAAGG + Intronic
915601372 1:156924828-156924850 TCGGGGGTGGGGGATGAGGAAGG + Intronic
915691565 1:157695931-157695953 ACGGGGAGGGAGGGAGGGGAGGG - Intronic
915799439 1:158773661-158773683 TGGGGGAGGGAAGATGGGGAGGG - Intergenic
916213594 1:162377674-162377696 AGGGGGCAGGAGGAAGGGGACGG - Intronic
916397520 1:164407702-164407724 ATGGGGATGGATGGTGGTGATGG - Intergenic
917024997 1:170631801-170631823 ACGGGGATGGGGGACGGGGACGG - Intergenic
918073765 1:181153452-181153474 ACAGGGGTGGGGGCTGGGGAAGG - Intergenic
918404727 1:184200491-184200513 ATGTGAATGGAGGATGGGAAGGG - Intergenic
918767120 1:188500400-188500422 AGGTGGATGGATCATGGGGATGG + Intergenic
919664345 1:200277925-200277947 AGGGGCATGGGGGATGGGTAGGG + Intergenic
919732779 1:200924473-200924495 CCAGGGATGGGGAATGGGGAAGG - Intergenic
919856317 1:201708699-201708721 AGGGGTATTGAGGAAGGGGATGG + Intronic
919878826 1:201889102-201889124 ATGGGGGCGGAGGAAGGGGAGGG + Intronic
919959588 1:202452568-202452590 ACGGGAGAGGAGGAGGGGGAGGG + Intronic
919982040 1:202647820-202647842 AGGGGGAGGGAGGAGGGGGAAGG - Intronic
920054288 1:203181295-203181317 AAGGGGATGGAGGGTGAGGCAGG + Intronic
920230190 1:204465165-204465187 AGGGCTATGGGGGATGGGGAGGG - Intronic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
920448597 1:206039477-206039499 AAGAGGATGGAGAAGGGGGATGG + Intronic
920693048 1:208161280-208161302 AAGGGGATTGAGGAAGGAGAGGG - Intronic
921326124 1:213987724-213987746 CCGGGGATGGAGGCCGGGGAGGG + Intronic
921358199 1:214306216-214306238 ATGGGGCTGGAGGGTGGGGATGG - Intronic
922563670 1:226587292-226587314 AGGGGGATGGAGGAGGGAGCTGG + Intronic
922722592 1:227906373-227906395 AGGAGGAGGGAGGAGGGGGATGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922925021 1:229341497-229341519 CAGGCGAGGGAGGATGGGGAGGG + Intronic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
923482499 1:234397558-234397580 GGGGGGAAGGGGGATGGGGATGG + Intronic
923697752 1:236270856-236270878 TAGGGGATGGATGATGGGGTAGG + Intronic
923926076 1:238628947-238628969 ACAGGGATGGAGGATTTGCATGG - Intergenic
924193823 1:241584121-241584143 ATGGGGTTGGGGGATGGGGGAGG - Intronic
924539901 1:244970768-244970790 AGGGGGAAGGAGGACGGGGCGGG - Exonic
1062798053 10:358826-358848 AGAGGGATGGGGGATGGGCAGGG + Intronic
1062833577 10:622257-622279 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062833584 10:622270-622292 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1063217488 10:3937660-3937682 ATTGGGATGGAGGGTGGGGGTGG - Intergenic
1063237220 10:4129653-4129675 AAGGGGATGGAGGTGGGAGAGGG - Intergenic
1063505440 10:6593824-6593846 ACTGGGAAGAGGGATGGGGAGGG - Intergenic
1064335459 10:14436507-14436529 AGGGGGGTGGAGGATGGGGGAGG + Intronic
1064418263 10:15168783-15168805 GCGGGGATGGAGGGCGGGGCGGG - Intergenic
1064460333 10:15529002-15529024 ACAGGGAGGAAGGAAGGGGAAGG - Intronic
1064478298 10:15715337-15715359 AGGGGAATGGAGGAGAGGGAGGG + Intronic
1065024193 10:21526033-21526055 CCGGGAATGGAGGATTAGGAAGG - Intergenic
1065649264 10:27870496-27870518 ATGGGGTTGGGGGATGGGGGAGG - Intronic
1065726885 10:28676428-28676450 AAGGGGGTGGGGGGTGGGGAAGG - Intergenic
1066437358 10:35406863-35406885 ACGGGGACGGAGGTGGGGGGGGG - Intronic
1066954946 10:42157050-42157072 ATGGAGATGGATGGTGGGGATGG + Intergenic
1067174832 10:43938242-43938264 GAGGGGATGGTGGATTGGGAAGG + Intergenic
1067364004 10:45608124-45608146 AGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1067661048 10:48236438-48236460 GCAGGGATGGAGGGTGGCGAGGG - Intronic
1068269172 10:54697658-54697680 AAGGGGAAGGGGGAAGGGGAAGG + Intronic
1068522052 10:58087655-58087677 GCAGAGATGGAGGATGTGGAAGG - Intergenic
1068947562 10:62744905-62744927 GCAGGGTTGGGGGATGGGGAGGG - Intergenic
1068955733 10:62817695-62817717 AGTGGGTTGGGGGATGGGGATGG - Intronic
1069383338 10:67862359-67862381 GCGGGGATTGGGGGTGGGGAGGG - Intergenic
1069422194 10:68256695-68256717 AATGGGGTGGAGGATGGGGAGGG + Intergenic
1069894332 10:71671311-71671333 ACAGGGATTGGGGAAGGGGATGG - Intronic
1069933792 10:71901190-71901212 ATGGGGAGGGAAGATGGGAATGG - Intergenic
1069933799 10:71901209-71901231 ATGGGGAGGGAAGATGGGAATGG - Intergenic
1069933806 10:71901228-71901250 ATGGGGAGGGAAGATGGGAATGG - Intergenic
1070601587 10:77870000-77870022 TGGGGGATGGGGGATGGGGTAGG - Intronic
1070769864 10:79075937-79075959 ACTGGCAGGGAGGATGGGGACGG + Intronic
1070823279 10:79375639-79375661 TCTGGGATGGGGCATGGGGAGGG + Intergenic
1071329581 10:84546425-84546447 AGGGAGATGGCCGATGGGGAGGG + Intergenic
1071848197 10:89541303-89541325 ACATGGATTGAGGATGGGTATGG + Intronic
1072021508 10:91408071-91408093 AGGGGGCTGGAGAATGGGAATGG - Intergenic
1072213512 10:93268611-93268633 AGAGGGATAAAGGATGGGGAGGG - Intergenic
1072235071 10:93446595-93446617 AGGGGGATGGAAGATGGGAGGGG + Intronic
1072565498 10:96613580-96613602 TCGGGGATGGGGGCTGGAGATGG + Intronic
1072729902 10:97838837-97838859 AGTGGGAAGGAGGATTGGGAAGG + Intergenic
1073288440 10:102401940-102401962 TCGGGAAAGGAGGCTGGGGAGGG - Intronic
1073348510 10:102802089-102802111 AGGTGGAAGGAGGAGGGGGAAGG - Intronic
1073460259 10:103661811-103661833 CCGGGGGTGGAGGCAGGGGAGGG + Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073597715 10:104817394-104817416 AAGGGGGAGGAGGAGGGGGAAGG - Intronic
1074257929 10:111821914-111821936 ATGAGGGTGGAAGATGGGGAGGG - Intergenic
1074484727 10:113864295-113864317 CCGGAGATGGAGGATGGCAATGG + Intronic
1074524653 10:114253214-114253236 ACGGGGAGGGGGGACGGGGAGGG - Intronic
1074722094 10:116272445-116272467 ACGGGGATGGAGGTGAGGGCTGG + Intronic
1074765057 10:116694533-116694555 AAGGGGAGGGAGGAGGTGGAGGG - Intronic
1074856099 10:117474664-117474686 TAGGAGATGGAGGATGGGGATGG + Intergenic
1074876323 10:117616166-117616188 AGTGGGATGGAGGTTTGGGATGG + Intergenic
1075058493 10:119237923-119237945 AGAGGGATGGAGGAAGGGGCTGG + Intronic
1075144121 10:119868895-119868917 GCTGGGATGGAGTATGAGGAGGG + Intronic
1075315253 10:121447972-121447994 GAGGGGATGGAGGATGGGTCGGG - Intergenic
1075606240 10:123812821-123812843 GTGGGGATGGGGGATGGGGAAGG - Intronic
1076040648 10:127245186-127245208 AAGGGCAGGGAGGAAGGGGAGGG + Intronic
1076601859 10:131662337-131662359 ATGGGGCTGGGGGACGGGGAGGG + Intergenic
1076726998 10:132418691-132418713 CCGGGGAGGGAGGAGGGGAAGGG - Intergenic
1076733915 10:132450475-132450497 ACCGGGGTGGGGGATGGGGTCGG - Intergenic
1076760917 10:132605368-132605390 AAGCGGCTGGGGGATGGGGAAGG + Intronic
1076790545 10:132774853-132774875 ACGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790576 10:132774940-132774962 ACGGGCAGGGAGGAGGGGCAGGG + Intronic
1076821406 10:132941836-132941858 GCCAGGATGGAGGATGGGGCTGG - Intronic
1077215316 11:1393010-1393032 AGGGGGATGTAGGCTGGGGTTGG + Intronic
1077392575 11:2306919-2306941 GAGGAGATGGAGGAGGGGGAAGG + Intronic
1077488510 11:2849996-2850018 ACCGGGATGGACGAGGTGGAGGG + Intergenic
1077578757 11:3403685-3403707 TGGGGGATGGCGGAGGGGGAGGG + Intergenic
1077891089 11:6418858-6418880 CCGGGGATGGGGGATGGGGCCGG + Intronic
1078127324 11:8580487-8580509 AGGGGGAAGGGGGAGGGGGATGG + Intronic
1078153461 11:8778408-8778430 AGGGGGAGGGTGGATGTGGACGG - Intronic
1078399285 11:11010077-11010099 ACGTGGATAGAGTATGGTGATGG + Intergenic
1078730647 11:13971052-13971074 AGCTGGATGGAGGAAGGGGAAGG + Intronic
1079129344 11:17738328-17738350 GAGGGGCTGGAGGAGGGGGATGG + Intronic
1079282209 11:19097707-19097729 CCCGGGATCGAGGATGGGGTTGG - Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079486622 11:20941800-20941822 GCGTGGATAGAGGAAGGGGAAGG + Intronic
1079572814 11:21965658-21965680 ACTGGGTTGGAGGAAGGGGCAGG - Intergenic
1080405145 11:31972030-31972052 ACGGGAAAGGGGGAGGGGGAGGG + Intronic
1080420688 11:32108085-32108107 ACCAGAATTGAGGATGGGGATGG - Intergenic
1080456906 11:32427017-32427039 GAGGGGAGGGAGGATGGGGATGG + Intronic
1080456942 11:32427150-32427172 ACGGGGCTGGAAGTTGGGGCGGG - Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080684632 11:34504857-34504879 AAGAGGAGGGAGGGTGGGGAAGG + Intronic
1081675336 11:44965280-44965302 ATGAGGAGGGAGGCTGGGGAGGG + Intergenic
1082244434 11:49905195-49905217 AGGGGGAAGGGGGAAGGGGAAGG + Intergenic
1082892404 11:58154101-58154123 AGGAGGAAGGAGGAGGGGGAAGG + Intronic
1083595854 11:63917942-63917964 ACGGAGATGGGGGAGGGGGTGGG + Intergenic
1083744370 11:64727038-64727060 TCGGGGCAGGAGGCTGGGGATGG - Exonic
1083857700 11:65401311-65401333 CTGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857706 11:65401324-65401346 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857729 11:65401376-65401398 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083913049 11:65721023-65721045 AGGGGGAGGGGGGAGGGGGAAGG - Intergenic
1084086341 11:66857018-66857040 ACGTGGAGGGCGGACGGGGAGGG - Intronic
1084113650 11:67029224-67029246 CTGGGGGTGGAGGATGGGGTGGG + Intronic
1084235785 11:67787201-67787223 TGGGGGATGGCGGAGGGGGAGGG + Intergenic
1084285658 11:68128837-68128859 ACGGGGGTGGTGGATGGAAAGGG + Intergenic
1084411800 11:69010001-69010023 ACGGGGGTCCAGGAAGGGGAGGG - Intronic
1084949621 11:72657474-72657496 AGGGAGATGGAGGAGTGGGAGGG - Intronic
1085572063 11:77568518-77568540 AAGGGGAGGGAAGAGGGGGAAGG - Intronic
1086524676 11:87711375-87711397 AAGGGGAGGGAAGATTGGGAAGG + Intergenic
1087409856 11:97777677-97777699 ACGGGGAGAGAGGATGGGAAGGG + Intergenic
1087990665 11:104743111-104743133 GTGGGGATGGGGGGTGGGGAAGG + Intergenic
1088194808 11:107262565-107262587 TAGGGGATTGAGGATGGGGAAGG + Intergenic
1088735332 11:112723744-112723766 AAGGGGAGGGAGGATGGGCAGGG + Intergenic
1089201054 11:116724964-116724986 AGGGGGAAGGAGGACAGGGAGGG - Intergenic
1089291286 11:117439208-117439230 ACAGGGATGGAGAAAGGGTAGGG - Intronic
1089293013 11:117449887-117449909 GAGGGAAGGGAGGATGGGGATGG - Intronic
1089396662 11:118140635-118140657 AAGGGGAGGGAAGATGGGGGAGG - Intronic
1089631283 11:119785972-119785994 CCTGGGGTGGGGGATGGGGAAGG + Intergenic
1090183112 11:124718205-124718227 ACGGGAACAGAGGATGGGGACGG + Intergenic
1090635365 11:128687566-128687588 GCGGGGCTTCAGGATGGGGAGGG - Intronic
1090687678 11:129141471-129141493 ATGGGGTAGGGGGATGGGGAAGG + Intronic
1090887634 11:130893155-130893177 ACAGGAAAGGAGGATGGGAAGGG + Intronic
1091106486 11:132924236-132924258 TGGGGGATGGAGGATGGAGTGGG + Intronic
1091765846 12:3119559-3119581 ACGGGCTGAGAGGATGGGGAGGG - Intronic
1091903653 12:4165304-4165326 ACGGGTATGGGGGATGCGGTGGG - Intergenic
1092218123 12:6696404-6696426 AAGGTGCTGGTGGATGGGGACGG - Intronic
1092760284 12:11804414-11804436 AAGGTGATGGAGGATGAGGGTGG - Intronic
1093235433 12:16604340-16604362 AGGGGGGTGAAGGATAGGGAAGG - Intronic
1093661960 12:21767568-21767590 ATGGGGGTGGGGGATGGGGATGG - Intronic
1093991175 12:25591428-25591450 AAGGGGATGGAAGAGGGGGAAGG + Intronic
1094555678 12:31497774-31497796 ATGGGGAGGGTGGAGGGGGAGGG + Intronic
1094623157 12:32099461-32099483 AATGGGGTGGAGGATGGGGATGG + Intergenic
1094822378 12:34236401-34236423 ATGGTGATGGATGATGGTGATGG - Intergenic
1095133703 12:38572369-38572391 AATGGGATGGAAGAAGGGGAAGG + Intergenic
1095253945 12:40011634-40011656 ACGGGGAGGGAGGAAGGAAAGGG - Intronic
1096468983 12:51864519-51864541 ATCGGGCTGGGGGATGGGGACGG + Intergenic
1096499344 12:52055673-52055695 AAGGGGCTGGGGGGTGGGGACGG - Intronic
1096504110 12:52082017-52082039 CCGGGGAAGCAGGATGGGAAGGG - Intergenic
1096651413 12:53063719-53063741 AGGGGGATAAAGGGTGGGGAAGG - Intronic
1096671286 12:53199672-53199694 ATGGGGTTGGGGGATGGGGGTGG - Intronic
1096761189 12:53843395-53843417 GCAGTGATGGAGGATGGAGAGGG + Intergenic
1096765122 12:53880682-53880704 ACGGAGATGGATGATGGAGATGG - Intergenic
1096772575 12:53945437-53945459 ATGGGGGTGGAGGCTGGGGATGG - Exonic
1097191307 12:57220855-57220877 ACAGAGATGGGGGATGGGGATGG - Intronic
1097288790 12:57896966-57896988 CCGGGGATGGGGGATGGGGTGGG - Intergenic
1097791953 12:63824540-63824562 AAGGGGGTGGGGGACGGGGAGGG + Intergenic
1098552387 12:71777213-71777235 ACGGGGGTGGGGAATGGTGAGGG - Intronic
1098888249 12:75982156-75982178 ACGGGGGAGGGGGAGGGGGAGGG + Intergenic
1099385309 12:82006249-82006271 GGGGGGAAGGAGGAAGGGGAGGG + Intergenic
1100545449 12:95597808-95597830 ATGGGGTTGGGGGAGGGGGAGGG - Intergenic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101116191 12:101533801-101533823 AGGTGGTTGGAGGGTGGGGATGG + Intergenic
1101546822 12:105721345-105721367 ATGAGGTTGGGGGATGGGGAGGG + Intergenic
1101693016 12:107098360-107098382 AGGGGGAGGGAGGGAGGGGAAGG + Intergenic
1101909292 12:108850180-108850202 TGGGGGAGGGAAGATGGGGAGGG + Intronic
1102205137 12:111085142-111085164 AGTAGGATAGAGGATGGGGATGG + Intronic
1102252215 12:111394963-111394985 TGGGAGATGGAGGATGGGGGTGG + Intergenic
1102394259 12:112574228-112574250 GGGGGCATGGAGGAGGGGGAGGG + Intronic
1102397052 12:112595495-112595517 AAGGGGAAGGAGGAGGGAGAGGG - Intronic
1102573565 12:113842282-113842304 CCGGGGTTGGGGGATGGGGGTGG + Intronic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1102906287 12:116677875-116677897 AAGAGGAGGGAGGATGGGAAGGG - Intergenic
1102913294 12:116735363-116735385 ATGGGGATGGATGGTGGTGATGG + Intronic
1103022962 12:117551191-117551213 AGGAGAATGGAGGAGGGGGAAGG - Intronic
1103197546 12:119058030-119058052 ACTGGGAAAGAAGATGGGGAAGG + Intronic
1103332228 12:120162280-120162302 ACGGAGATTGAGAATTGGGAAGG - Intronic
1103350349 12:120279041-120279063 AGGGGGATGGGGGAGGGGGAGGG + Intergenic
1103508654 12:121458509-121458531 AGGGGGATGGGGGGTGGGGGCGG + Intronic
1103871103 12:124092626-124092648 ATGGTGATGGATGATGGTGATGG + Intronic
1103948790 12:124540854-124540876 AAGGGGATGGAGAGTGGAGATGG + Intronic
1103986261 12:124769550-124769572 ACGGGGAAAGGGCATGGGGAAGG - Intergenic
1104509973 12:129368359-129368381 ACAAGGATGGAGAATGTGGAAGG - Intronic
1104789249 12:131471620-131471642 CCTGGGATGGAGGACGTGGATGG + Intergenic
1104822716 12:131687494-131687516 CCAGGGATGGAGGGTGGGCATGG - Intergenic
1104935339 12:132361344-132361366 ACTAGGAGGGAGGGTGGGGAAGG - Intergenic
1104958870 12:132478762-132478784 GCGGGGATGCAGGGTGGGCAGGG + Intergenic
1105210667 13:18254963-18254985 GTGGGGAGGGAGGGTGGGGAGGG + Intergenic
1106157054 13:27169232-27169254 AAGGGGATGGAGGGTCGGGTTGG + Intronic
1107120177 13:36787495-36787517 AGGGGGACTGAGGCTGGGGAGGG + Intergenic
1107139618 13:36983819-36983841 ATGGGGATGGATGATGGTGGGGG + Intronic
1108099842 13:46943067-46943089 ACGGGGTGGGGGGTTGGGGAGGG + Intergenic
1108185047 13:47880383-47880405 AGAGGGAAGGAGGATGGGGTGGG + Intergenic
1108409348 13:50131147-50131169 AAAGGGATGGGGGATGGGGGCGG - Intronic
1108433221 13:50375660-50375682 AGAGGGATGGAGGAAGGGAAGGG - Intronic
1108962448 13:56251673-56251695 ATGGGTAGGGAGGATGGTGATGG - Intergenic
1108985847 13:56586129-56586151 AAGGGCCTGGAGGATGTGGATGG - Intergenic
1109446441 13:62447120-62447142 GAGGGGATGGATCATGGGGATGG + Intergenic
1109599947 13:64612633-64612655 ACGGGGAGGGTGGCGGGGGATGG - Intergenic
1110218947 13:73052554-73052576 AAGTGGAAGGAGGGTGGGGATGG - Intergenic
1110398879 13:75066291-75066313 AAAGAGATGGAGGATGGGCATGG + Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1111111963 13:83723041-83723063 CCGGGGATAGAGGAAGGGGGAGG + Intergenic
1111396346 13:87672929-87672951 AAGGGGAGGGAGGAGAGGGAAGG - Intronic
1111402092 13:87751668-87751690 TGGGTGATGGATGATGGGGAAGG + Intergenic
1111723535 13:91976120-91976142 ATGGGGTTGGGGGAGGGGGAAGG + Intronic
1112432925 13:99368213-99368235 AGGAGGTGGGAGGATGGGGAGGG + Intronic
1112485434 13:99815286-99815308 GTGGGGATGGTGCATGGGGATGG + Intronic
1113159591 13:107364972-107364994 AGGGGGATGGGGAAGGGGGAGGG - Intronic
1113179792 13:107612097-107612119 AGGGGGAGGGAGGAAGGGGAGGG + Intronic
1113626314 13:111850610-111850632 ACAGGGCAGGAGGGTGGGGAAGG - Intergenic
1113785944 13:113002125-113002147 CCGGGGATGGATGTTGGGGTGGG + Intronic
1113927017 13:113947264-113947286 ACGGGGAAGGGGGTTGGGGGAGG + Intergenic
1113932099 13:113973988-113974010 GCTGGGCTGGAGGATGGAGAAGG - Intergenic
1113966353 13:114155683-114155705 GTGGGGGTGGAGGGTGGGGAGGG + Intergenic
1114993965 14:28323540-28323562 ACTGTCATGGGGGATGGGGAGGG + Intergenic
1115111621 14:29830287-29830309 TCTGGGATAGAGGGTGGGGAAGG - Intronic
1115477737 14:33832165-33832187 ATGGGGTTGGGGGAGGGGGAAGG + Intergenic
1115566538 14:34629843-34629865 CCGGGGACCCAGGATGGGGAAGG + Intronic
1115614256 14:35078310-35078332 ACTGGGCTGGAGGAGGGGAATGG - Intronic
1116475096 14:45331016-45331038 ACGGGAAGGGAGGAAAGGGAAGG - Intergenic
1116609489 14:47049283-47049305 ATGGAGATGGAGGTGGGGGAAGG + Intronic
1116914519 14:50510328-50510350 ACGGGGAGGGAGGCGGGGAAAGG - Intronic
1117372804 14:55094168-55094190 ATGGGGATGGAGTATGGAGGAGG + Intergenic
1117579582 14:57138710-57138732 AGGGGGAAGGAGGATGGGTCAGG + Intergenic
1117602442 14:57390124-57390146 AGGGGCAAGGAGGATGGGGGAGG - Intergenic
1117612487 14:57499144-57499166 ATGGGGTGGGGGGATGGGGAGGG - Intergenic
1117937402 14:60921802-60921824 ACAGGAATGGAAAATGGGGATGG + Intronic
1118338009 14:64870985-64871007 ATGGGGAGGGATGATGGTGATGG + Intronic
1118442173 14:65821916-65821938 ACGGCAATGGAGGATGGTGGGGG + Intergenic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1119062034 14:71484986-71485008 GCTGGGATGGAGTAAGGGGAGGG - Intronic
1119548894 14:75493655-75493677 GCGGGGATGGAGAGTGGGGAGGG + Intergenic
1119598583 14:75958896-75958918 ATGGGGATAGAGGAAAGGGATGG - Exonic
1119921460 14:78450405-78450427 AATGGGATGGAGGCTGGGTAGGG + Intronic
1120521125 14:85529731-85529753 ACAGGGTTGGGGGATGTGGACGG + Intergenic
1120730634 14:87997173-87997195 TGGAGGATGGGGGATGGGGAAGG - Intergenic
1120895407 14:89527028-89527050 ACAGGAAAGGAGGATAGGGAGGG + Intronic
1121212807 14:92221707-92221729 TCTGGGATGGAGCATGAGGAGGG - Intergenic
1121266049 14:92603344-92603366 AGGGGGCTGAAGGGTGGGGAGGG - Intronic
1121330996 14:93049749-93049771 ACGGGGGTGGGGGGTGGGTAAGG + Intronic
1121585079 14:95057834-95057856 GCGGGGATGGTGGAGGGGGAGGG + Intergenic
1121647042 14:95525711-95525733 AGGGGGAAGGAGGATTGGAAAGG - Intergenic
1121861700 14:97324774-97324796 ATGGGGGTTGAGGAAGGGGAAGG - Intergenic
1121956928 14:98222872-98222894 ATGGGGCTGGGGGATGTGGATGG - Intergenic
1122138382 14:99647449-99647471 AGGTGGATGGAGGAAGGGAAGGG + Intronic
1122353805 14:101111958-101111980 TCGGCGAAGGAGGAAGGGGAAGG - Intergenic
1122394925 14:101418429-101418451 ATGGGGGTGGAGGGTGGGCAGGG + Intergenic
1122647933 14:103207386-103207408 GAGGGGAAGGAGGAAGGGGAAGG - Intergenic
1122838166 14:104441457-104441479 AAGGGGCTGGAGGATGGACATGG + Intergenic
1122845971 14:104499264-104499286 ACGATGATGGAGGAGGGCGAAGG + Intronic
1122873077 14:104650443-104650465 ACGGGGGAGGAGGAGGGGCAGGG - Intergenic
1122879588 14:104684216-104684238 ACCGAGAAGGAGGCTGGGGAGGG + Intergenic
1122916065 14:104859530-104859552 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916095 14:104859660-104859682 GTGGAGATGGAGGATGGAGATGG - Intergenic
1122916120 14:104859762-104859784 GTGGAGATGGAGGATGGAGATGG - Intergenic
1122916136 14:104859827-104859849 ATGGAGATGGAGGGTGGAGATGG - Intergenic
1122916140 14:104859840-104859862 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916182 14:104860046-104860068 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916200 14:104860122-104860144 ATGGAGATGGAGGATGGAGATGG - Intergenic
1122916212 14:104860187-104860209 ATGGAGATGGAGGGTGGTGATGG - Intergenic
1122916216 14:104860200-104860222 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916261 14:104860406-104860428 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916320 14:104860651-104860673 GTGGTGATGGAGGATGGAGATGG - Intergenic
1122916368 14:104860827-104860849 GCGGTGATGGAGGGTGGAGATGG - Intergenic
1202865467 14_GL000225v1_random:114414-114436 CCGGGGTTGGGGGATGGGGCTGG - Intergenic
1123696895 15:22884954-22884976 ACGGGGATGGGGGGTGGGGTGGG + Intronic
1124497504 15:30195640-30195662 ACGGGGATGGGGGCGGGGTAGGG + Intergenic
1124746071 15:32343025-32343047 ACGGGGACGGAGGCGGGGTAGGG - Intergenic
1124860767 15:33438308-33438330 CTGGGGGTGGAGGATGGGGAGGG - Intronic
1125201012 15:37100654-37100676 ACGGGGATGGGGGACGGCGGGGG + Intronic
1125590926 15:40854100-40854122 GTGGGGATGGGGGATGGGGAGGG - Intronic
1125921978 15:43530382-43530404 ACAGGAATGGATGATGGGGAGGG - Exonic
1126184473 15:45818614-45818636 ATGGGGCGGGGGGATGGGGAAGG - Intergenic
1126369686 15:47932703-47932725 ATGGGGGTGGGGGATGGGGGTGG + Intergenic
1126572122 15:50163853-50163875 AAGGGGAAGGAAGAAGGGGAAGG - Intronic
1126684204 15:51233181-51233203 ATAGGGAAGGAGGATGGGGGAGG - Intronic
1126800246 15:52291620-52291642 ACAAGGATGAAGGCTGGGGATGG - Intronic
1126860424 15:52877573-52877595 AGAGAGATGGAGGAAGGGGAGGG - Intergenic
1127210936 15:56773845-56773867 ATTGGGGTGGAGGATGGGGTGGG + Intronic
1127732750 15:61815549-61815571 AGGAGCATGGATGATGGGGAGGG + Intergenic
1128155371 15:65388611-65388633 GCAGGGATGGTGGATGGGGTGGG + Intronic
1128363451 15:66979555-66979577 AAGGGGAGGGAGGAAGGGGAAGG - Intergenic
1128702228 15:69813078-69813100 GCGGGGATGTAGGGTGGGGGCGG - Intergenic
1128740978 15:70083532-70083554 GAGGGGAGGGAGGAGGGGGAAGG - Intronic
1128944360 15:71811035-71811057 GCGGGGATGGGGGTTGGGGGCGG + Intronic
1129125871 15:73440879-73440901 ACAGGCAGGGAGGATGGGAATGG - Intergenic
1129301504 15:74628269-74628291 TCGAGGATGGAGGATGGGGTAGG + Intronic
1129925281 15:79358496-79358518 GCTGGGATGGAAGCTGGGGATGG + Intronic
1130023045 15:80247243-80247265 AGGTGGTGGGAGGATGGGGAAGG - Intergenic
1130123085 15:81069150-81069172 ACGGGGATAGAGAATGGGGGAGG + Intronic
1130146183 15:81275349-81275371 ACGGGGGAGGAGGGGGGGGAGGG + Intronic
1130216324 15:81973799-81973821 AGGGGAGTGGAGGGTGGGGAGGG + Intergenic
1130441092 15:83955240-83955262 AAGGGGAGGGAAGAGGGGGAAGG - Intronic
1130663481 15:85850119-85850141 ACAGGGATGGGGGAAGAGGAGGG - Intergenic
1130707107 15:86243687-86243709 AACTGGTTGGAGGATGGGGATGG - Intronic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131132922 15:89911786-89911808 CAGGGGATAGTGGATGGGGATGG - Intronic
1131139830 15:89968122-89968144 AGGAGGAGGGAGGAGGGGGAGGG + Intergenic
1131229175 15:90647493-90647515 AGGGGTGTGGAGGATGAGGAGGG - Intergenic
1131229224 15:90647628-90647650 AGGGGTGTGGAGGATGAGGAGGG - Intergenic
1131284807 15:91048142-91048164 AGGGGGAGGGGGGAGGGGGAGGG - Intergenic
1131641573 15:94299029-94299051 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1132855480 16:2042872-2042894 ATGGGGGAGGAGGGTGGGGAGGG - Intronic
1132874525 16:2130437-2130459 ACAGAGATGGATGATGGGGAGGG - Intronic
1132884535 16:2176814-2176836 GTGGGGATGGAGGGTGGGGATGG - Exonic
1133241142 16:4415401-4415423 ACTGGGATGGAGAATGGAGGGGG - Intronic
1133347364 16:5079840-5079862 TGGGGGATGGCGGAGGGGGAGGG + Intronic
1133392829 16:5423013-5423035 AAGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133392859 16:5423102-5423124 AGGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133886004 16:9828191-9828213 ACAGGGATGGAGCAAGAGGAAGG + Intronic
1134066599 16:11232468-11232490 AGGGGGGAGGAGGAGGGGGAGGG + Intergenic
1134108332 16:11499346-11499368 AGGGGAATGGGGGAAGGGGAAGG + Intronic
1134553470 16:15149270-15149292 ACAGAGATGGATGATGGGGAGGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134891573 16:17845913-17845935 ACGGGGAAGGAGGACAGGGAGGG + Intergenic
1135040430 16:19113857-19113879 TCGGGGAGGGAGGATGGGGGTGG + Intergenic
1135139373 16:19908443-19908465 ACAGGGATGGAGGATGGGGAAGG + Intergenic
1135146589 16:19968143-19968165 ACTGGTATGTAGGATGGGGTAGG - Intergenic
1135164774 16:20129567-20129589 AAGGGAAGGGGGGATGGGGAGGG - Intergenic
1135504878 16:23027682-23027704 AGGGAGATGGGGGTTGGGGAAGG - Intergenic
1135527810 16:23227443-23227465 AGGGGAATGGAGGAGGGCGATGG - Intergenic
1135677162 16:24425671-24425693 ACGGAGATGGATGGTGGTGATGG - Intergenic
1135694710 16:24575799-24575821 AGGGAGAGGGAGGAGGGGGAGGG + Intergenic
1136081345 16:27854325-27854347 AAGGGGGAGGAGGAGGGGGACGG + Intronic
1137221509 16:46456378-46456400 ATGGAGATGGATGATAGGGATGG - Intergenic
1137290916 16:47051350-47051372 ACGATGAAGGAGGATGAGGAAGG + Intergenic
1137344067 16:47638038-47638060 AAGGGGCTGGGGAATGGGGAGGG - Intronic
1137507640 16:49068292-49068314 AAGGGGATGGTGGAGGGTGAAGG + Intergenic
1137521682 16:49200528-49200550 AAGGGGCTGGGGGATAGGGAAGG - Intergenic
1137873448 16:51972566-51972588 GCTGGGATGGTGGCTGGGGATGG + Intergenic
1137887799 16:52125666-52125688 GTGGGGATAGATGATGGGGAGGG - Intergenic
1138066423 16:53946072-53946094 AGGAGGATGGGGGAAGGGGAAGG + Intronic
1138348005 16:56331679-56331701 TCTGGGATGGAGCTTGGGGACGG - Intronic
1138574285 16:57897654-57897676 GCGGGGATGGGGGCGGGGGAAGG - Intronic
1138927712 16:61612187-61612209 GGGGGGATGGGGGAAGGGGAAGG + Intergenic
1139215848 16:65123368-65123390 ACGGGGAAGGAGGCTGCGGAGGG + Intronic
1139228490 16:65256812-65256834 ATGGGGATGGAGGTTGGGGTGGG + Intergenic
1139601685 16:67991247-67991269 GCAGGGATGGAGGGTGGGTAGGG - Intronic
1139707440 16:68751082-68751104 ACTGGCTTGGAGGAAGGGGAAGG - Intronic
1140038650 16:71390506-71390528 ACGTGGATGGAGGAGGGTAATGG + Intergenic
1140257305 16:73348415-73348437 AAGAGGATGGAGGCTGGGGTTGG - Intergenic
1140646570 16:77038079-77038101 AGGGGGAGGGAAGAAGGGGAAGG - Intergenic
1140841073 16:78839643-78839665 ACTGTTATGGAGGGTGGGGAGGG + Intronic
1141253100 16:82376689-82376711 AGGGAGTTGGAGGAAGGGGAGGG - Intergenic
1141631684 16:85291460-85291482 CCGGGGGAGGAGGCTGGGGAGGG - Intergenic
1141698084 16:85629699-85629721 AGGGGGATGGGGGATGCTGATGG + Intronic
1141825885 16:86480136-86480158 AGAGGGAGGGAGGGTGGGGATGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141849035 16:86631437-86631459 ACTGGGAGAGAGGATGAGGACGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142159020 16:88547441-88547463 GCGGGGACAGAGGGTGGGGAAGG + Intergenic
1142159029 16:88547465-88547487 GCGGGGACAGAGGGTGGGGAAGG + Intergenic
1142159045 16:88547513-88547535 GCGGGGACAGAGGGTGGGGAAGG + Intergenic
1142207262 16:88789764-88789786 ACGGGGCTGGGGGACGTGGAGGG + Intergenic
1142341432 16:89525514-89525536 ACAGGGATGAGGGGTGGGGATGG - Intronic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1142498264 17:317913-317935 TGGAGGATGGAGGATGGGGTGGG - Intronic
1142969487 17:3601485-3601507 ACTGGGATGGAGGAGGGTGGGGG - Intergenic
1142985890 17:3695267-3695289 ATGAGGATGGGGGAAGGGGATGG + Intronic
1143216602 17:5229824-5229846 AAGGAGATGGGGGAAGGGGAGGG - Intronic
1143267684 17:5652724-5652746 ATGGGGAGGGAGGAAGGGCAAGG + Intergenic
1143351116 17:6288951-6288973 GGGGAGCTGGAGGATGGGGAGGG + Intergenic
1143384941 17:6523574-6523596 GTGGGGATGGGGGATGGGAAGGG + Intronic
1143471730 17:7179602-7179624 ACGGGGAGGGAGGAGGGATATGG - Intergenic
1143478005 17:7214010-7214032 AGGGAAATGGGGGATGGGGAAGG - Intronic
1143720762 17:8807490-8807512 AGGAGGGTGGAGGATGTGGAAGG + Intronic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144196030 17:12896109-12896131 AGGGGGAGGGGGGAGGGGGAGGG + Intronic
1144779279 17:17799772-17799794 ACGGGGGAGGAGGCTGGGCAGGG - Intronic
1145712775 17:26992275-26992297 GCTGGGATTGAGGATGGGGGAGG - Intergenic
1145772634 17:27504548-27504570 ACGGGGATGGGGCCTGGGCAGGG + Intronic
1145923895 17:28631737-28631759 ACAGAGATGGAGGAGGGGAATGG + Intronic
1145994453 17:29097409-29097431 GAGGGGAAGGAGGATGGGGCAGG + Intronic
1146178130 17:30679646-30679668 AGGAGGATGGAGGAGGGGGGAGG + Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146487824 17:33258409-33258431 ACAGAGAAGGAGGATGGGTAGGG + Intronic
1147049851 17:37785693-37785715 ATGGGGTTGGGGGATGGGGGAGG - Intergenic
1147168462 17:38605310-38605332 AGGGGGATGGATGGTGAGGAGGG - Intronic
1147239306 17:39080074-39080096 TGGGGGATGGAGGATTAGGAAGG + Intronic
1147277724 17:39333140-39333162 ACGGAGAGGGAGGAGGGAGAGGG - Intronic
1147460523 17:40565309-40565331 ATGGGGGTGGAGGATGCGGGTGG - Intronic
1147550794 17:41440107-41440129 ATTGGGATGGAGGGTGGGGAAGG + Intronic
1147605537 17:41771981-41772003 ATGAGGATGCAGGCTGGGGATGG + Intronic
1147969551 17:44212176-44212198 ATGGGGGTGGGGGGTGGGGAAGG + Intronic
1148082418 17:44974869-44974891 ATGGGGATGGAGTAGGGGGCAGG + Intergenic
1148219164 17:45850011-45850033 ACGGGGCTGGAGGCAGGTGATGG + Intergenic
1148233779 17:45953681-45953703 GCAGGGATGGTGGAGGGGGAGGG + Intronic
1148432124 17:47650552-47650574 AGGGGGAGGGGGGAGGGGGACGG - Intronic
1148548102 17:48532082-48532104 AAGGAGATGGAGGGTGGTGAAGG - Intergenic
1148550048 17:48544735-48544757 GCCGGGCTGGAGGCTGGGGAAGG + Exonic
1148597114 17:48865562-48865584 AGGGGGATGGAGGAAGGCCAGGG - Intronic
1148842669 17:50508823-50508845 CGGGGCCTGGAGGATGGGGATGG + Intronic
1148854403 17:50570816-50570838 ATGGGGTAGGAGGAGGGGGAGGG + Intronic
1148854733 17:50572537-50572559 AGGGGGCTGCAGGATGGGAAGGG - Exonic
1149475883 17:56960659-56960681 GAGGGGATGGGGGATGGGGAAGG - Intronic
1149750999 17:59145129-59145151 ATGGAGATGGATGATGGTGATGG + Intronic
1150580588 17:66470291-66470313 GCGGGGGTGGGGGTTGGGGAGGG - Intronic
1150947685 17:69765600-69765622 AGGGGGAGGGAAGAGGGGGAAGG - Intergenic
1151013755 17:70531091-70531113 TGGGGGCTGGAGGGTGGGGATGG + Intergenic
1151013797 17:70531177-70531199 TGGGGGCTGGAGGGTGGGGATGG + Intergenic
1151514033 17:74580664-74580686 AAGTGGGTGGAGGATGGTGAGGG - Intronic
1151727712 17:75894261-75894283 GCGTGGATGGAGGATGGCGCAGG - Intronic
1151765774 17:76132571-76132593 GCGGGGGGGGAGGATGGGGGCGG - Intergenic
1151823835 17:76512639-76512661 ACGGGGAAGGATGATGAGGGTGG - Intergenic
1152238398 17:79149995-79150017 GTGGGGGTGGGGGATGGGGATGG + Intronic
1152238420 17:79150034-79150056 GTGGGGGTGGGGGATGGGGATGG + Intronic
1152369593 17:79878095-79878117 CGGGGGGAGGAGGATGGGGAAGG + Intergenic
1152471334 17:80491516-80491538 AGGGGGAGGGAGGGAGGGGATGG - Intergenic
1152609187 17:81307369-81307391 AAAGGGAAGGAGGAGGGGGAGGG - Intergenic
1152609217 17:81307443-81307465 AAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1152615513 17:81336123-81336145 ACAGGGGTGGAGGAGGGGGAGGG - Intergenic
1152678302 17:81652982-81653004 GCAGGGATGGAGGAGGGGGAAGG - Intronic
1152809683 17:82375584-82375606 AAGGGGACGGAGGAGGGGCAGGG - Exonic
1152863420 17:82709116-82709138 TGGGGGATGGAGCAGGGGGAGGG - Intergenic
1152870443 17:82750995-82751017 ACGGAGATGGGGGACGGGGATGG - Exonic
1152870446 17:82751001-82751023 ACGGGGACGGAGATGGGGGACGG - Exonic
1152870470 17:82751054-82751076 ACGGGGATGGAGGATGGGGACGG - Exonic
1152870475 17:82751067-82751089 ACGGCGATGGGAGACGGGGATGG - Exonic
1152870486 17:82751094-82751116 ACGGGGACGGGGGACGGGGACGG - Exonic
1153326835 18:3829451-3829473 GAGGGGGTGGAGGGTGGGGAAGG + Intronic
1155066538 18:22273768-22273790 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155066546 18:22273791-22273813 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155767941 18:29659166-29659188 ATGGGGGTGGGGGATGGGGATGG + Intergenic
1156326614 18:36079435-36079457 ACAGTGAGGGCGGATGGGGAGGG + Intergenic
1157240149 18:46001597-46001619 ACGGAGATGGATGGTGGTGATGG - Intronic
1157330025 18:46696949-46696971 AGGTGGGTGGAGGATGGGGAGGG + Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157470110 18:47982481-47982503 GGGGGGATAGAGGATGGGGGAGG + Intergenic
1157602454 18:48902331-48902353 AAGGGGATGGAGAAAGGGGAAGG - Intergenic
1158911558 18:62068183-62068205 ATGGGGATGAAGGAAGGAGACGG + Intronic
1158967450 18:62635001-62635023 ACGCTGATGAAGGAGGGGGATGG - Intergenic
1159916600 18:74193764-74193786 GGGGGGATGGTGGAGGGGGATGG - Intergenic
1160001717 18:75030835-75030857 ACGGGGGTAGAGAATGGAGAGGG - Intronic
1160174003 18:76578712-76578734 GCGGGGAAGGAGGAAGAGGAGGG - Intergenic
1160324351 18:77929412-77929434 AGGGGGATGGCTGATGGTGATGG + Intergenic
1160409766 18:78667770-78667792 AGGGGTAGGGTGGATGGGGAGGG - Intergenic
1160448658 18:78947064-78947086 AGGAGGATGGAGGAAGAGGAAGG + Intergenic
1160539814 18:79614372-79614394 ACCGGGAGGGAGGCTGTGGATGG - Intergenic
1160676393 19:393622-393644 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676438 19:393799-393821 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676474 19:393954-393976 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676476 19:393967-393989 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676504 19:394078-394100 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676508 19:394091-394113 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676531 19:394177-394199 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676585 19:394414-394436 ATGGGGAAAGATGATGGGGAAGG + Intergenic
1160676615 19:394562-394584 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676728 19:395069-395091 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676774 19:395256-395278 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676799 19:395356-395378 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676824 19:395456-395478 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160692010 19:464494-464516 ATGTGTATGGAGGATGGGGAAGG - Intronic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695200 19:480512-480534 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695204 19:480525-480547 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695373 19:481434-481456 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695394 19:481509-481531 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160873882 19:1288443-1288465 CCGGGGAGGGATGATGGGGTCGG + Intronic
1160893227 19:1390419-1390441 ACAGGGATGGAGGAGAGGGGAGG + Intronic
1160900250 19:1424350-1424372 AGGGGGAGGGGGGAGGGGGAGGG - Intronic
1161219392 19:3111322-3111344 CCGGGGCTGGAGGAGGGGGTGGG - Intronic
1161310552 19:3591683-3591705 ACTGGGCTGCAGGATGGGGATGG - Exonic
1161433238 19:4246526-4246548 CTGGGGAAGGAGGCTGGGGAAGG + Intergenic
1161448299 19:4329918-4329940 GAGGGGCTGCAGGATGGGGACGG - Intronic
1161606403 19:5217100-5217122 AGGAGGATGCAGGATGGTGAAGG + Intronic
1161741136 19:6021856-6021878 AAGGGGCTGGAGGCTGGGTAGGG + Intronic
1161768256 19:6218346-6218368 ACTGGGAGGGAGGCTGGGGCAGG + Intronic
1161918304 19:7247227-7247249 AAGTGGATTAAGGATGGGGAAGG - Intronic
1162022278 19:7873372-7873394 AGGGGGAGGGAAGATGGGGGCGG + Intronic
1162031467 19:7919209-7919231 ACAGGGGTGGAGCCTGGGGACGG + Intergenic
1162273851 19:9637713-9637735 ATGGTGATGTAGGATGTGGAAGG + Intronic
1162450800 19:10753379-10753401 AGGGGGAGGGGGGAAGGGGAAGG - Intronic
1162531262 19:11237613-11237635 AGGGGGAGGGAGGGAGGGGACGG + Intronic
1162582538 19:11539798-11539820 TCGGGGCTGGAGGAGGGGGCTGG + Intronic
1162973634 19:14195889-14195911 ACTGAGCTGGAGGATGGGGCAGG - Intronic
1163248253 19:16110760-16110782 CCGGGGATGGTGGGGGGGGAGGG - Intergenic
1163475600 19:17524220-17524242 GAGGGGATAGAGGATGGGCATGG - Intronic
1163611535 19:18304402-18304424 AGGGGGATGGGGGATGGGAGTGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164722600 19:30443699-30443721 CCGGGGATGGAGCTCGGGGAAGG - Exonic
1165098208 19:33421899-33421921 ATGGCGATGGTGGCTGGGGATGG + Intronic
1165843480 19:38803484-38803506 ACAGAGATGGATGGTGGGGAGGG - Intronic
1166301595 19:41914548-41914570 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301609 19:41914608-41914630 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301622 19:41914668-41914690 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301629 19:41914695-41914717 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301636 19:41914722-41914744 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301687 19:41914908-41914930 ACGGAGATGGTGGAGGGGGAGGG - Intronic
1166316586 19:41993041-41993063 CCAGGGATGGAGGTGGGGGATGG - Intronic
1166339543 19:42129442-42129464 CCGGGGAGGGAGGAGTGGGAGGG - Intronic
1166361269 19:42253925-42253947 GCGGGGACGGGGGAGGGGGAAGG - Intronic
1166459573 19:42974373-42974395 ATGGGGATGGAGAATTGGAATGG - Intronic
1166750699 19:45162795-45162817 ACGGGGAGGGAGGGAGTGGAGGG + Intronic
1166887591 19:45971565-45971587 ACCTGGATGGAGGTGGGGGAGGG + Intronic
1166944697 19:46389854-46389876 GAGGGGCAGGAGGATGGGGATGG - Intronic
1167220634 19:48196240-48196262 ACAGGCATGGAGAATGGAGATGG + Intronic
1167486449 19:49765895-49765917 TTGGGGATGGAGGCTGGGGCTGG + Intergenic
1167628397 19:50607519-50607541 ACTGAGAAAGAGGATGGGGACGG - Intergenic
1167663191 19:50808458-50808480 ATGGGGCTGGATAATGGGGATGG - Intergenic
1167685704 19:50954759-50954781 ACAGGGAAGGAGGAAGGGGTGGG - Intergenic
1167686528 19:50960082-50960104 GAGGGGGAGGAGGATGGGGAGGG + Intronic
1167686544 19:50960118-50960140 GAGGGGGAGGAGGATGGGGAGGG + Intronic
1167698785 19:51030244-51030266 CGGGGAATGGAGGAGGGGGAGGG - Intronic
1167725754 19:51211758-51211780 ACGGGGATGCAGGATCAGGAAGG - Intergenic
1168148192 19:54430942-54430964 ACGGGGAAGGCGGACGGGGCGGG + Intronic
1168162144 19:54517962-54517984 TCGGGGGTGGGGGAGGGGGAGGG + Intergenic
1168249716 19:55134781-55134803 AAGGGGAGGGAGGGAGGGGAGGG + Intronic
1168433805 19:56302320-56302342 AAAGGGAAGGAGGAAGGGGAGGG - Intronic
1168467878 19:56618749-56618771 ACTGGGAGGGAGGGTGGGCAGGG + Intronic
1168517112 19:57017662-57017684 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1168517152 19:57017763-57017785 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1168615379 19:57833267-57833289 AAGGGGATGGAAGAGTGGGAAGG - Intronic
1168621405 19:57882180-57882202 AAGGGGATGGAAGAGTGGGAAGG + Intronic
925258749 2:2511687-2511709 AGGCAGATGGAGGTTGGGGAAGG - Intergenic
925324688 2:3008748-3008770 ACGGGGCTGGGGGGTGGTGAGGG + Intergenic
925713972 2:6768157-6768179 CCGGGGATGGAGACTGGGGGTGG + Intergenic
925920331 2:8633639-8633661 AGGGGGACGAAGGAGGGGGAAGG - Intergenic
926683567 2:15681118-15681140 AGGGGGAGGGGGGAGGGGGAGGG + Intergenic
926683595 2:15681160-15681182 AGGGGGAGGGGGGAGGGGGAGGG + Intergenic
926754317 2:16223386-16223408 TGGGGGAGGGAGGCTGGGGAGGG - Intergenic
927500876 2:23582424-23582446 GTGGGGGTGGAGGATGGGGATGG + Intronic
927679845 2:25132078-25132100 CCGGGGATGGGGGTTGGAGAGGG + Intronic
927852755 2:26510512-26510534 ACGGGGGTGAGGGATGAGGAGGG - Intronic
928008250 2:27582749-27582771 ACTGGGCGGGTGGATGGGGAAGG + Intergenic
928278955 2:29927246-29927268 TGGGGGATGGGGGATGGGGGAGG + Intergenic
928362142 2:30672763-30672785 TCAGGGATGGAGCCTGGGGAGGG + Intergenic
928480493 2:31678236-31678258 TGGGGGATGGGGGATGGGGGAGG - Intergenic
929037604 2:37709505-37709527 CCAGGGAAGGTGGATGGGGAGGG + Intronic
929237898 2:39625761-39625783 AGGGGAATGGAGGAGAGGGAAGG + Intergenic
929247114 2:39714228-39714250 AGGGGGATGGAGAGAGGGGATGG + Intronic
929431740 2:41893198-41893220 CCGGGGAGGGAGGAAGGGGAAGG - Intergenic
929656788 2:43740981-43741003 ACAGGAAAGGATGATGGGGAAGG - Exonic
929711100 2:44267400-44267422 AGGGGGATGGAGGCTGGAGCTGG + Intergenic
929852418 2:45604384-45604406 AGGGGGGTGGAGGAAGGGGAGGG + Intronic
929857676 2:45650608-45650630 ACGGCGGTGGGGGAGGGGGAAGG - Intergenic
930030780 2:47056907-47056929 ACGGGGCTGGATGGGGGGGAGGG - Intronic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930451153 2:51539949-51539971 ATGGGGTTGGGGGATGGGGGAGG - Intergenic
931169836 2:59790980-59791002 AAGGCGAGGGAGGCTGGGGAGGG + Intergenic
931985388 2:67736657-67736679 AAGGGGATGGAGGAGGAGAATGG - Intergenic
932334400 2:70921720-70921742 AAGGTGATGGAGGGTGGGAAAGG - Intronic
932457181 2:71857281-71857303 GCGGGCATGGAGGGAGGGGAGGG + Intergenic
933785522 2:85838202-85838224 ACAGGGAGGAGGGATGGGGATGG + Intergenic
934777785 2:96950042-96950064 ACGGGGAAAGAGGCAGGGGAAGG + Intronic
934885580 2:98021509-98021531 CTGGGAATGGAGGTTGGGGAAGG - Intergenic
934925925 2:98381731-98381753 TGGGGGAAGGAGGCTGGGGAAGG + Intronic
934954048 2:98601903-98601925 ACGGGGAAGGGGGCAGGGGATGG - Intronic
934979767 2:98830043-98830065 GCGGGAAGGGAAGATGGGGAGGG - Intronic
934980705 2:98837295-98837317 ACAGGCAAGGAGGCTGGGGAGGG + Intronic
935308441 2:101759724-101759746 AGGGGGAGGGGGGAAGGGGATGG - Intronic
935686596 2:105689130-105689152 ATGGGGTTGGAGGAGGTGGAAGG - Intergenic
936627756 2:114166570-114166592 AGGGGGTTGGAGAAAGGGGATGG + Intergenic
936648145 2:114395354-114395376 ATGGGGTGGGAGGATGGGGGAGG + Intergenic
937104297 2:119295511-119295533 GCAGGGATGGAGGGTGGTGAGGG - Intergenic
937379556 2:121364284-121364306 GAGGGGCTGGAGGAAGGGGATGG - Intronic
937474119 2:122199452-122199474 ATGAGGACAGAGGATGGGGATGG + Intergenic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
937895245 2:126972831-126972853 AGGGGCTTGGAGGAAGGGGAAGG - Intergenic
937916390 2:127101146-127101168 TCCAGGATGGAGGATGGGGGAGG - Intronic
937967486 2:127525125-127525147 ACGGGCATGGGGGGTGGGGGTGG + Intronic
939539629 2:143477305-143477327 ACTGGGATGGAGGCTGAGAAGGG + Intronic
939712615 2:145541771-145541793 TTGGGGATGGGGGATGGAGACGG + Intergenic
940293825 2:152102025-152102047 ACGGGGATGGAGGATGGTTTGGG - Intergenic
940891131 2:159036501-159036523 ATGGGGTGGGAGGATGGGGGAGG - Intronic
941056566 2:160796162-160796184 ATGGGGTTGGGGGATGGGGGAGG + Intergenic
941538662 2:166754781-166754803 GCAGGGATGGGGGATGGGGGAGG - Intergenic
942457409 2:176147772-176147794 CCGGGGGTGGAGGGTGGGGGTGG - Intergenic
943640047 2:190347845-190347867 ATGAGGATGGAGGCTGGGCATGG + Intronic
943943249 2:194025694-194025716 ATGGGGTGGGAGGAGGGGGAAGG + Intergenic
944100374 2:196019937-196019959 AAGGGGGAGGAGGAGGGGGAGGG - Intronic
944447376 2:199805190-199805212 GCAGGGGTGGAGGATGGTGAGGG - Intronic
944822050 2:203441032-203441054 TTGGGGGTGGAGGAGGGGGAGGG + Exonic
946060448 2:216936580-216936602 ATGGGTCTGGAGGATAGGGAAGG + Intergenic
946175795 2:217921360-217921382 ACCGGGCTGGTGGGTGGGGAGGG - Intronic
946237387 2:218332535-218332557 ATGGGGAAGGAGGAAGGGAAGGG - Intronic
946419654 2:219557677-219557699 ACGGGGAGGCATGACGGGGAAGG + Intronic
946889886 2:224264375-224264397 AGGCGTATGGAGGAGGGGGAGGG + Intergenic
947224137 2:227823936-227823958 AAAGGGACAGAGGATGGGGATGG + Intergenic
947291516 2:228580808-228580830 ACGGGTAGGTAGAATGGGGAAGG + Intergenic
947382468 2:229558658-229558680 ACTGGGCTGCAGGATGGGGTGGG + Intronic
947561586 2:231158646-231158668 CCTGGGATGGAGACTGGGGAGGG - Intronic
948258945 2:236588954-236588976 CCGGGGATGAGGTATGGGGATGG + Intergenic
948458804 2:238119393-238119415 AGGTGGATGGAGGAGGTGGATGG + Intronic
948458829 2:238119481-238119503 AGGTGGATGGAGGAGGTGGATGG + Intronic
948458858 2:238119575-238119597 AGGTGGATGGAGGAGGTGGATGG + Intronic
949047315 2:241877891-241877913 AGGGGGAAAGAGGAAGGGGAGGG - Intergenic
949062382 2:241968893-241968915 ATGGTGATGGAGTGTGGGGATGG + Intergenic
949062414 2:241969028-241969050 ATGGTGATGGAGTGTGGGGATGG + Intergenic
949064234 2:241980037-241980059 TGGGGGATGGGGGATGGGGTGGG - Intergenic
1168771816 20:420701-420723 ACGGGGGTGGGGGATGGGGGTGG - Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168958336 20:1850077-1850099 GTGGGGAAGGAGGATGGGGTTGG + Intergenic
1168962125 20:1877042-1877064 ACGGGGATGGACACGGGGGATGG - Intergenic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169178637 20:3542593-3542615 AGGGGGAAGGGGGAAGGGGAAGG - Intronic
1169538891 20:6578814-6578836 ACTGTCATGGGGGATGGGGAGGG + Intergenic
1169634862 20:7678160-7678182 ATGGGGTGGGAGGAGGGGGAAGG + Intergenic
1169641604 20:7758425-7758447 AGGGGTAGGGAGAATGGGGAGGG - Intergenic
1169946702 20:10996719-10996741 ACGGGGTTGGGGGAAGGGGGAGG - Intergenic
1170235724 20:14102783-14102805 ATGGGGATATAGGATGGGGATGG + Intronic
1170442863 20:16396283-16396305 ACAGGGACAGAGGAGGGGGATGG - Intronic
1170444821 20:16415646-16415668 AAGGGGATGGAGGGAGGAGAAGG - Intronic
1170614104 20:17935231-17935253 ATGGGGATGAAGGAGAGGGATGG + Intergenic
1171291812 20:23986654-23986676 GTGGGGAGGGAGGGTGGGGAGGG + Intronic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1172051821 20:32123192-32123214 AGGGGGAGGGGGGAGGGGGAGGG + Intronic
1172080801 20:32339080-32339102 ATGGGGATGGAGAACGGGGCTGG + Intergenic
1172113947 20:32562943-32562965 GAGGGGAGGGAGGGTGGGGAGGG + Intronic
1172114794 20:32567268-32567290 ACCGGGATGGAGAGTGGGGCAGG - Intronic
1172292169 20:33784222-33784244 AGGGAGATGGGGGAGGGGGAAGG - Intronic
1172387864 20:34546748-34546770 CAGCTGATGGAGGATGGGGATGG + Intergenic
1172523915 20:35586090-35586112 CTGGGGATGAATGATGGGGATGG - Intergenic
1172548631 20:35781617-35781639 ACGGAGATGGAGAGTGGTGATGG - Intronic
1172696446 20:36826341-36826363 AGGGGGAGGGGGGAGGGGGAGGG - Intronic
1172813741 20:37670343-37670365 AGGGGGTTGGGAGATGGGGAGGG - Intergenic
1172980446 20:38937582-38937604 ACAGGAATGGGGGATGGGGATGG + Intronic
1173151079 20:40566809-40566831 AGGGGGAGGGAGGAGGGAGATGG - Intergenic
1173617672 20:44413638-44413660 ACAGGGATGGAGTAGGGGGTGGG - Intronic
1173671910 20:44804835-44804857 TAGGGGATTGGGGATGGGGAAGG + Intronic
1173811348 20:45957740-45957762 TGGGGGCTGGAAGATGGGGAGGG - Intronic
1174137825 20:48392885-48392907 GAGGGGATGGAGGATGGGAAGGG + Intergenic
1174253387 20:49236031-49236053 ATGGGGATAGAGGCTGGGCACGG - Intronic
1174367969 20:50067858-50067880 AGGGGGATAGGGGATGGGGTGGG - Intergenic
1174385765 20:50187758-50187780 CAGGGGGTGGAGGGTGGGGAAGG + Intergenic
1174909707 20:54593991-54594013 CTGAGGGTGGAGGATGGGGAAGG + Intronic
1174933455 20:54841669-54841691 CGGGGGATGGGGGATGGGGTTGG - Intergenic
1175278558 20:57787959-57787981 AGGGGGATGGAGGGTGGGGAAGG + Intergenic
1175304890 20:57969136-57969158 AGTGGGTTGGAGGAAGGGGAGGG + Intergenic
1175405436 20:58722962-58722984 ACGGGGATGGGGGAGTGAGATGG + Intergenic
1175414453 20:58792638-58792660 ACGGGGAAGGGGAATGGAGATGG + Intergenic
1175992196 20:62795219-62795241 CCGGGGACGGGGGAGGGGGAGGG - Intergenic
1175998643 20:62822237-62822259 AGGGGCATGGAGCCTGGGGAGGG - Intronic
1176027350 20:62992868-62992890 AGAGGGATGGAGGAAGAGGAGGG + Intergenic
1176032043 20:63017374-63017396 ACGGTGAGAGAGGACGGGGAGGG + Intergenic
1176161282 20:63650207-63650229 AAGGGGAAGGATGGTGGGGAGGG - Intronic
1176303736 21:5112853-5112875 ACGGGGGTGGAGGGTGGGGGAGG + Intergenic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1177691762 21:24519184-24519206 ACGGGGATGGAGTAGGGGCGAGG + Intergenic
1177905576 21:26967698-26967720 AAGAGGCTGGAGAATGGGGAGGG - Intergenic
1178615573 21:34130105-34130127 GGGGGGATGGGGGAGGGGGATGG - Intronic
1179125509 21:38587303-38587325 AAGGGGATGGGGGAGGGGGACGG + Intronic
1179473235 21:41626025-41626047 AGAGGGAAGGAGGATGGGCAGGG + Intergenic
1179543764 21:42100909-42100931 ATGGGGTTGGTGGGTGGGGAGGG - Intronic
1179543777 21:42100939-42100961 ACGGGGTTGGTGGGTAGGGAGGG - Intronic
1179549736 21:42136359-42136381 AGGGGGAAGGTGGATGGGGAGGG - Intronic
1179625939 21:42649837-42649859 ACAGGGAAGGAGGCTGGAGATGG - Intergenic
1179812987 21:43884264-43884286 AGGGGGAAGGAGGAGGGGGAAGG - Intronic
1179853296 21:44149097-44149119 ACGGGGGTGGAGGGTGGGGGAGG - Intergenic
1179901392 21:44396311-44396333 AGGGGTGTGGAGGATGTGGAGGG + Intronic
1180044980 21:45301156-45301178 AGGAGGATGGAGGATGAGGGAGG - Intergenic
1180780729 22:18517940-18517962 GTGGGGAGGGAGGGTGGGGAGGG + Intronic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181177361 22:21045301-21045323 ACGTGGTGAGAGGATGGGGAAGG + Intergenic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181199624 22:21209577-21209599 GTGGGGAGGGAGGGTGGGGAGGG + Intronic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181400136 22:22646281-22646303 GTGGGGAGGGAGGGTGGGGAGGG - Intronic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181519381 22:23436554-23436576 ATCTGGATGGAGGATGGGGCTGG - Intergenic
1181649228 22:24249509-24249531 GTGGGGAGGGAGGGTGGGGAGGG + Intergenic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181652875 22:24270692-24270714 CCGGAGATGGGGGAAGGGGAGGG + Intergenic
1181702108 22:24627379-24627401 GTGGGGAGGGAGGGTGGGGAGGG - Intronic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1182082446 22:27538893-27538915 ACAGGGAAGGAGGAAGGGGGAGG - Intergenic
1182330959 22:29551786-29551808 AGGGGGAGGGGGGAGGGGGAGGG - Intronic
1182459958 22:30476503-30476525 AAGGGGAGGGGAGATGGGGAAGG - Intergenic
1182495702 22:30705833-30705855 ACTGGAGTGGAGGAGGGGGAGGG + Intronic
1182935617 22:34219101-34219123 AAGGGGATGGAGCATGGGTGGGG + Intergenic
1183271607 22:36865781-36865803 ATGGGGTTGGAGCTTGGGGAAGG - Intronic
1183597951 22:38823386-38823408 ACTGGGCAGGAGGATGGAGAGGG - Intronic
1184194293 22:42916407-42916429 GTGGGGATGGGGGGTGGGGAAGG + Intronic
1184254715 22:43280474-43280496 ACGGGGATGGGTGAGGGGAAGGG - Intronic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184515944 22:44962784-44962806 TGGGGGATGGAGGCTGGGGCAGG + Intronic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184729196 22:46363843-46363865 GCGGGGATGGGGGAGGGGGGAGG - Intronic
1184742954 22:46439704-46439726 ACGGGGTTGGAGGCTGGGAAGGG - Intronic
1184753400 22:46502283-46502305 AGGGGAAGGGAGGGTGGGGAGGG + Intronic
1184995036 22:48199245-48199267 AAGGGGGTGGGGGAAGGGGAGGG + Intergenic
1185285193 22:49996905-49996927 CCGGGGATGGGGGATGGGAAGGG + Intronic
1185384648 22:50526200-50526222 AAGGGGATGGCGGAGGCGGAAGG + Intronic
1185411172 22:50683788-50683810 AGGGGGGTGGTGGAGGGGGATGG + Intergenic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
949493523 3:4610954-4610976 AGGGGGAAGGGGGAAGGGGAAGG - Intronic
949494521 3:4619518-4619540 AAGGGGATGGAAGTTGGAGAAGG - Intronic
949815206 3:8050882-8050904 ATGGTGAAGGAGGGTGGGGATGG + Intergenic
950168894 3:10822588-10822610 CAGGGGAGGGAGGTTGGGGAAGG + Intronic
950256424 3:11510449-11510471 ACTGGGATGGGGGAGGGGGTGGG - Intronic
950261095 3:11543888-11543910 CTGGGGATGGAGGGTGGGCAGGG + Intronic
950472234 3:13193464-13193486 TGGGGGATGAAGGATGTGGACGG + Intergenic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
951719186 3:25679747-25679769 AGGGGGAGAGAGGAGGGGGAAGG + Intergenic
952161859 3:30701963-30701985 ATGGGGATGAAGGGTGGGGTGGG - Intergenic
953025407 3:39142226-39142248 CCAGGGATGTAGGAGGGGGAAGG - Exonic
953166117 3:40466252-40466274 ATTGGGTTGGGGGATGGGGAAGG + Intergenic
953246866 3:41200456-41200478 AAGGGGGTGGAGGAAGGCGAAGG + Intronic
953484896 3:43286335-43286357 AGGAGGATGGAGGACGGGGGAGG - Intergenic
953885566 3:46712755-46712777 ATGGGGATGGAGGATGTCGGGGG - Intronic
953932422 3:47012348-47012370 ACAGGGAAGGAGTATGGGTAGGG + Intergenic
954090352 3:48279217-48279239 AAGGGGATGAAGGATTTGGAGGG - Intronic
954098371 3:48349624-48349646 ACGTGGCTGGAGGATGACGATGG + Intergenic
954364485 3:50138856-50138878 ACGGGGCTGGGAGATGGAGATGG + Intergenic
954411579 3:50373518-50373540 AGGGGGAGGGAGGAGGGGGATGG + Intronic
955733946 3:62017019-62017041 ACGGGGGTGAGGGAGGGGGAGGG - Intronic
956590477 3:70908933-70908955 AGGGGGATGGAGGGTGAGGGTGG + Intergenic
956764417 3:72472445-72472467 CCGGGGTTGGGGGGTGGGGATGG - Intergenic
957435372 3:80168516-80168538 AGGGGGTTGGAAGCTGGGGAAGG - Intergenic
957467076 3:80608075-80608097 AGTGGGAGGGAGGAGGGGGAAGG + Intergenic
957523038 3:81345570-81345592 AAGGGGAAGGTGGATGGAGATGG + Intergenic
957867982 3:86049702-86049724 AGGGGGAAGGAGGAAGGTGAGGG + Intronic
958164223 3:89858469-89858491 AGGGGGTGGGAGGAAGGGGAGGG + Intergenic
959202190 3:103261397-103261419 ACAGGCATGGTGGATGGTGAGGG + Intergenic
959599773 3:108168637-108168659 TGGGGGATGGGGGATGGGGAGGG - Intronic
960251837 3:115463819-115463841 AGGGGGAGGGGGGAGGGGGAGGG + Intergenic
960571283 3:119187705-119187727 AAGGGGGTGGAGGGTGGGGAAGG - Intronic
960737154 3:120793315-120793337 ACATGGATGGAGAGTGGGGAAGG - Intergenic
961302714 3:125932595-125932617 TGGGGGATGGTGGAGGGGGAGGG - Intronic
961463113 3:127065552-127065574 ACGCTGAAGGAGGAAGGGGAGGG - Intergenic
961735441 3:128999450-128999472 GCAGGGATGGGGGGTGGGGAGGG + Intronic
961824700 3:129592880-129592902 AGGGGGATGCAGGCTGGGGGAGG + Intronic
961885351 3:130093193-130093215 TGGGGGATGGTGGAGGGGGAGGG + Intronic
962355649 3:134692251-134692273 ATGGGGTTGGGGGAGGGGGAAGG - Intronic
962368968 3:134805109-134805131 CTGGGGATGGGGGATTGGGAAGG + Intronic
964235701 3:154524364-154524386 AAGGGGATGGAGCATGGTGAAGG - Intergenic
965147993 3:164931053-164931075 CAGGGGATGGAGAGTGGGGATGG + Intergenic
966883455 3:184362183-184362205 GCGGGGGTGGAGGTTGGGGAGGG + Intronic
966932684 3:184686021-184686043 CCGGGGCTGGAAGGTGGGGAGGG - Intergenic
967456477 3:189692433-189692455 GTGGGGAGGGAGGAAGGGGAAGG - Intronic
967597873 3:191349084-191349106 ATGGGGGTGGAGGAGGGGGTTGG + Intronic
967717717 3:192782337-192782359 CCGGGGAAGGTGGGTGGGGAGGG + Intergenic
967720573 3:192811768-192811790 ATGGGGATTAAGGTTGGGGAGGG + Intronic
968912441 4:3483104-3483126 AGGGGTGTGGAGGGTGGGGACGG + Intronic
968912454 4:3483148-3483170 AGGGGTGTGGAGGGTGGGGACGG + Intronic
968912467 4:3483192-3483214 AGGGGTGTGGAGGGTGGGGACGG + Intronic
968912480 4:3483236-3483258 AGGGGTGTGGAGGGTGGGGACGG + Intronic
968994549 4:3937379-3937401 TGGGGGATGGTGGATGGGGAGGG + Intergenic
969261994 4:6039494-6039516 ACAGGGATGCATGACGGGGATGG + Intronic
969339166 4:6529619-6529641 AGAGGGATGGGGGATGGGGTAGG - Intronic
969408028 4:7007869-7007891 CCGTGGGTGGAGGGTGGGGAAGG - Intronic
969438631 4:7203819-7203841 GCGGGGGTGGAGGAGGGTGATGG - Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969643449 4:8412792-8412814 GCAGCGAGGGAGGATGGGGAGGG - Intronic
970636862 4:18020715-18020737 ATGGGGATGGGAGGTGGGGAGGG + Intronic
970909576 4:21258975-21258997 ACTGGGATGCTGGATGTGGATGG + Intronic
971131818 4:23819511-23819533 GCTGGGATAGAGGATGGGTAAGG + Intronic
972152300 4:36108187-36108209 AAGAGGTTAGAGGATGGGGATGG - Intronic
972406721 4:38753153-38753175 CTGGGGGTGGAGGGTGGGGAAGG + Intergenic
972666764 4:41172314-41172336 AGGGGGCTGGCGGATGGGGGTGG - Intronic
973724842 4:53764679-53764701 GCAGGGATGGAGGATGAGGGGGG - Intronic
973779410 4:54274078-54274100 ATGTGGATGGAGTGTGGGGAAGG + Intronic
973832851 4:54779289-54779311 ACAGGGAGGGAGGAGGGGGAGGG + Intergenic
973961772 4:56117591-56117613 ACAGAGATGGATGATGGTGATGG + Intergenic
975360222 4:73460949-73460971 AGGGGGATGGGGGAGGGGGAGGG - Intergenic
975416067 4:74106050-74106072 ACAGGGAGGGAGGAGTGGGAAGG - Intergenic
975460863 4:74651285-74651307 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460870 4:74651298-74651320 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460877 4:74651311-74651333 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975540027 4:75499764-75499786 AAGGGTAGGGAGGATGGGGCAGG + Intronic
975758480 4:77594751-77594773 TCGGGGTAGGAGGCTGGGGAAGG + Intronic
976455475 4:85241921-85241943 ATGGAGATGGATGATGGTGATGG - Intergenic
976579711 4:86721719-86721741 AGGGGGAAGGGGGAAGGGGAGGG - Intronic
976675229 4:87695392-87695414 AAGGGGAGGGAGGGAGGGGAGGG + Intergenic
977628469 4:99215210-99215232 TAGGGGATGTAGGATGGAGAAGG + Intronic
977820197 4:101462384-101462406 AAAGGGAAGGATGATGGGGAGGG + Intronic
978352672 4:107836845-107836867 ACTGGGAGAGAGGATGGGCAGGG + Intronic
979208741 4:118075043-118075065 ATGGGGTGGGGGGATGGGGAAGG - Intronic
980329876 4:131397794-131397816 CAGGGGTTGGGGGATGGGGAAGG - Intergenic
980714740 4:136614819-136614841 ATGGTGATGTAGGATGTGGAAGG - Intergenic
981101031 4:140829306-140829328 ACGGGGAGAGATGATGTGGAGGG + Intergenic
981155832 4:141433813-141433835 ATGGGGTTGGGGGAGGGGGAAGG - Intergenic
981532435 4:145765353-145765375 ATGGGGTGGAAGGATGGGGAGGG - Intronic
981538174 4:145822333-145822355 ACTGGGGTGGAGGGTGGGGGTGG - Intronic
981840295 4:149103880-149103902 AGGGGAAGTGAGGATGGGGAGGG - Intergenic
981939087 4:150262488-150262510 GCAGGGATGGAGAATGGGGCAGG + Intergenic
982104291 4:151998222-151998244 ACCAGGGTGGGGGATGGGGATGG - Intergenic
983068389 4:163238697-163238719 ATGGGAAGGGAAGATGGGGAGGG + Intergenic
983137944 4:164107937-164107959 AAGAGGATGGAGGAGGTGGAGGG - Intronic
983296440 4:165873892-165873914 CCGGGGGAGGAGGATGGGGTTGG + Exonic
983462463 4:168045527-168045549 AAGGGGATGGTGGGTGGAGAGGG - Intergenic
983923744 4:173373181-173373203 AAAAGGATGGTGGATGGGGAAGG - Intronic
984819341 4:183866516-183866538 AAGAGGATGGTGGAGGGGGAGGG + Intronic
984919221 4:184749265-184749287 AGGGGGCTGGAGGCTGAGGAAGG + Intergenic
985188517 4:187345588-187345610 AGATGGATGTAGGATGGGGAAGG - Intergenic
985727647 5:1524255-1524277 GCGGGGAGGGAGGAAGGGGCGGG + Intergenic
986183629 5:5416977-5416999 GAGGGGAAGGAGGACGGGGAGGG + Intergenic
986773481 5:10994299-10994321 GCGGGGACGGAGGAAGGGGGCGG + Intronic
986773501 5:10994339-10994361 CCGGGGAAGGAGGAGGGGGGCGG + Intronic
986773509 5:10994358-10994380 GCGGGGAAGGAGGAAGGGGCCGG + Intronic
986879088 5:12147840-12147862 AGGGGGAGGGGGTATGGGGAAGG - Intergenic
987042078 5:14072388-14072410 ATGGAGATAGAAGATGGGGAAGG - Intergenic
987332550 5:16869919-16869941 AAGGGGAAGGGGGAGGGGGAGGG + Intronic
987382631 5:17299926-17299948 CTGGGAATGGAGGTTGGGGATGG + Intergenic
987396727 5:17431535-17431557 AAGGGGGTGGGGGATGGGAAGGG - Intergenic
988497675 5:31758698-31758720 ATGAGGATGGAGGAAAGGGAGGG - Intronic
989217468 5:38920159-38920181 ACGGGGATGGAGGGTGTGGTAGG - Intronic
989545307 5:42665595-42665617 GTGGGGGTGGAGGAGGGGGAAGG + Intronic
990045032 5:51418610-51418632 ACGGGGCTGGAGGGTAGGTAGGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990558479 5:56960636-56960658 TCGGAGATGGAGGAGGGAGAAGG - Intronic
991501515 5:67281986-67282008 AGGGGGAAGGAGGAAGGGAAGGG - Intergenic
991512583 5:67396202-67396224 GTGGGGATGGGAGATGGGGAAGG + Intergenic
991535067 5:67661015-67661037 ATGGGGTTGGGGGATGGGGGAGG - Intergenic
991897771 5:71423245-71423267 ACGGGGCTGGGGGTAGGGGAGGG - Intergenic
992357194 5:75998190-75998212 ACGGGGTGGGAGGAAGGGGGAGG + Intergenic
992368137 5:76114237-76114259 ATGGTGATGGGGGATGGGGAGGG - Intronic
992598916 5:78376726-78376748 ATGGGGTCGGAGGATAGGGAGGG + Intronic
993741450 5:91545820-91545842 CAGGGGGTGGAGGATGGGGGAGG - Intergenic
993871597 5:93260844-93260866 ATGGGGTTGGGGGATGGGGGAGG + Intergenic
994188111 5:96838046-96838068 ACAGGGATGGGGGGTGGGGTGGG + Intronic
994550322 5:101226404-101226426 TCAGGGATGGAGGCTGGGAAGGG - Intergenic
995154820 5:108898541-108898563 AAGGGAAGGGAGGAAGGGGAGGG - Intronic
995402343 5:111757281-111757303 AAGAGGAGGGAGGAGGGGGAAGG + Intronic
996588651 5:125120379-125120401 GCTGAGATGGAAGATGGGGAAGG + Intergenic
997262392 5:132475073-132475095 GTGGAGATGGAGGAGGGGGAAGG + Intronic
997292348 5:132747219-132747241 GCGGGGATGGAGGGAAGGGAGGG + Intergenic
997511582 5:134458380-134458402 ACGGGAATGAGGGATGGGCAGGG + Intergenic
997688804 5:135811213-135811235 CCTGGGAAGGAGGATGGGCAGGG + Intergenic
997961982 5:138329475-138329497 ACAGGGAAGGAGGATAGAGACGG - Intronic
998002346 5:138635155-138635177 ACGGGGGTGGGGGTTGGGGTTGG + Intronic
998028014 5:138837501-138837523 GAGGGGAGGGAGGAGGGGGAGGG - Intronic
998227193 5:140336150-140336172 AGAAGGATGGAGGATGGGCAGGG - Intronic
998604040 5:143615506-143615528 AGGGGGAGGGAGGAGGAGGAAGG - Intergenic
998699384 5:144680355-144680377 AAGGAAATGAAGGATGGGGACGG + Intergenic
999073538 5:148773132-148773154 AAGGGTATGGACGATGGGGAAGG - Intergenic
999201286 5:149818290-149818312 ACTGTGATGGTGGGTGGGGAAGG - Intronic
999255971 5:150210207-150210229 AGGGCCCTGGAGGATGGGGAAGG + Exonic
1000161141 5:158598752-158598774 ACAAGGATGGAGGCTGGAGATGG - Intergenic
1001092399 5:168751048-168751070 AGGGGGAGGGAGGCTGGGGGAGG + Intronic
1001302734 5:170548605-170548627 ACTAGGAAGGTGGATGGGGAAGG - Intronic
1001318857 5:170663867-170663889 ACAGGGCTGGAGGAGGGGGCAGG - Intronic
1001382491 5:171313619-171313641 GCAGGGCTGGAGGAAGGGGAGGG + Intergenic
1001397021 5:171424845-171424867 AGGGGGAAGGGGGAGGGGGAGGG + Intronic
1001430741 5:171660034-171660056 CTGGGGATGGGGGGTGGGGAAGG - Intergenic
1001655300 5:173344633-173344655 AGGTGCATGGAGGATGGGGAAGG - Intergenic
1001799616 5:174531607-174531629 CAGGGGCTGGAGGGTGGGGAAGG + Intergenic
1001853056 5:174986114-174986136 GCAGGGAAGGAGGATAGGGAGGG - Intergenic
1001996953 5:176169727-176169749 AGGGGGAGGGAGGGAGGGGAAGG + Intergenic
1002163493 5:177331196-177331218 AAGGGGCTGGAGGATGGTGGGGG - Intergenic
1002795669 6:469425-469447 AGGGGGAGAGAGGAGGGGGACGG - Intergenic
1003381916 6:5632564-5632586 AGGGGGAAGGAGGAAGGGAAAGG - Intronic
1003609169 6:7592831-7592853 GTGGGGATGGAGGATGTTGAGGG + Intronic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1004002057 6:11604834-11604856 AGGGGGAAGGAGGAGGGGGGAGG + Intergenic
1004157550 6:13183624-13183646 AGGAGGAAGGAGGGTGGGGAGGG + Intronic
1004537397 6:16515807-16515829 AAGCGGATGCAGGAGGGGGATGG + Intronic
1005358421 6:25007678-25007700 ACCGAGAAGGAAGATGGGGAGGG - Intronic
1005755929 6:28924661-28924683 AAGAGGCTGGAGGATGAGGAGGG + Intergenic
1006278699 6:33029002-33029024 AGGGGGAGGGAGGGAGGGGAGGG - Intergenic
1006562972 6:34929771-34929793 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1006576224 6:35048461-35048483 AAGGGGATGGGGGAGGGGAAAGG - Intronic
1006578810 6:35064786-35064808 ACGGGGGTGGAGGTGGGGGCTGG - Intronic
1006641599 6:35492257-35492279 GGGGGGGTCGAGGATGGGGAGGG + Intronic
1006889948 6:37418178-37418200 AGGGGGACGGAGGAATGGGAAGG + Intergenic
1007110494 6:39310851-39310873 AGGGGGATGGGGGTGGGGGAAGG - Intronic
1007234416 6:40379977-40379999 AGGGAGATGGACCATGGGGAGGG + Intergenic
1007300644 6:40865427-40865449 ATGGTGATGGAGGATATGGAAGG + Intergenic
1007357562 6:41332516-41332538 AGGGGGTTGGAGGATGGGGTTGG + Intergenic
1007367695 6:41406434-41406456 ACGCGGCTGGAGGAGGGGGCCGG + Intergenic
1007759890 6:44127608-44127630 GCGGGGCTGGGGGAGGGGGAGGG - Intronic
1008552264 6:52644472-52644494 ACAGGGATGGAAAGTGGGGAAGG - Intergenic
1008846130 6:55966450-55966472 ACTGGGATGGAGGGTGGAGGTGG - Intergenic
1009844949 6:69122475-69122497 AGGGGGAGGGGGGAGGGGGAGGG + Intronic
1010985111 6:82414670-82414692 ACTGGGCTGGGGGATGGGGTGGG - Intergenic
1011368888 6:86610938-86610960 ATGGGGCTGGGGGATGGGGTAGG + Intergenic
1011474409 6:87736872-87736894 AGGGGGAGGGGGGAGGGGGAGGG + Intergenic
1011659451 6:89581716-89581738 TTCGGAATGGAGGATGGGGAAGG - Intronic
1011908302 6:92402165-92402187 ATGGGGTGGGAGGCTGGGGAAGG - Intergenic
1011932255 6:92729065-92729087 ATGGGGTTGGGGGCTGGGGAAGG - Intergenic
1012032780 6:94093800-94093822 TAGGAGATGGAGGATGTGGAAGG - Intergenic
1013047874 6:106505563-106505585 ACGAAGATGGGGAATGGGGAAGG - Intergenic
1013360852 6:109392665-109392687 ACAGGAAAGGAAGATGGGGAGGG + Intronic
1013547147 6:111169485-111169507 TGGGAGATGGAGGCTGGGGAAGG - Intronic
1013552604 6:111223134-111223156 TGGAGGCTGGAGGATGGGGAGGG + Intronic
1014967165 6:127769771-127769793 ATGGGGTTGGAGGATGGGGGAGG - Intronic
1015113505 6:129619630-129619652 AAGGGGATGGGGGAGGGGGAGGG + Intronic
1016356804 6:143227380-143227402 ATGGGGATGAAGGAGGGGCACGG - Intronic
1017467803 6:154710960-154710982 ACAGGGAAGGAGGATGGGGCTGG - Intergenic
1017519646 6:155190480-155190502 ACAGGGATGGCTGGTGGGGAGGG + Intronic
1017637408 6:156456287-156456309 GAGGGGATGGGGGATGGGGAGGG - Intergenic
1018208902 6:161461304-161461326 AGGGGGATGGTGGAGAGGGAGGG + Intronic
1018461681 6:164004717-164004739 AGGGGGAGGGGGGATGGGGGAGG + Intergenic
1018473246 6:164114778-164114800 ATGAGGTGGGAGGATGGGGATGG + Intergenic
1018871844 6:167789987-167790009 GTGGGGATGGATGATGGGGGTGG - Intronic
1018961034 6:168448570-168448592 ACTGGGGAGGAGGATGGTGATGG + Intronic
1019008892 6:168825858-168825880 GCGGGGATGGAGCCTGGGGCGGG + Intergenic
1019008938 6:168826002-168826024 GCGGGGATGGAGCCTGGGGCGGG + Intergenic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019287273 7:229983-230005 ATGGGGTAGGGGGATGGGGAAGG + Intronic
1019332287 7:466426-466448 AGGAGGATGGAGGAGGGTGAGGG - Intergenic
1019345728 7:529881-529903 GCGGGGGTGGAGGCTGGGGGGGG - Intergenic
1019508355 7:1404804-1404826 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508370 7:1404838-1404860 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508385 7:1404872-1404894 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508400 7:1404906-1404928 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019554992 7:1624891-1624913 ACAGGGATGGAGGAATGTGAGGG + Intergenic
1019591892 7:1839777-1839799 ATCTGGATGGAGGATGGGGCTGG + Intronic
1019595481 7:1856424-1856446 CCGGGGTTGGGGGATGGGAAGGG + Intronic
1019785882 7:2977127-2977149 GCAGGGATGGAGGAGGGGGTGGG + Intronic
1019884355 7:3891150-3891172 ACTGGGAAAGAGGATGGGGGAGG + Intronic
1020318822 7:6925743-6925765 TGGGGGATGGTGGAGGGGGAGGG + Intergenic
1020403652 7:7805671-7805693 AGGTGGCTGGTGGATGGGGATGG - Intronic
1020452378 7:8334957-8334979 AGGGGTATGTGGGATGGGGAAGG + Intergenic
1021340929 7:19461815-19461837 ACTGGGGTGGGGTATGGGGATGG - Intergenic
1021580036 7:22142767-22142789 ACAGAGGTGGGGGATGGGGATGG + Intronic
1022015413 7:26345006-26345028 ACGAAGACGGAGGAGGGGGAGGG - Intronic
1022502486 7:30891525-30891547 ATGGGGACAGAGGGTGGGGAGGG - Intronic
1022590210 7:31654341-31654363 ATGGAGATGGAGGGAGGGGAAGG + Intronic
1023003735 7:35840173-35840195 AAGGGGGAGGAGGAGGGGGAGGG - Intronic
1023216518 7:37868733-37868755 ACCGGGAAGGTGGAAGGGGAAGG - Intronic
1023302195 7:38784655-38784677 AGGGGGAAGGAGGAGGGGAAGGG + Intronic
1023829359 7:44029815-44029837 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1023874116 7:44277734-44277756 AGGGAGGTGGGGGATGGGGAGGG - Intronic
1023901991 7:44488736-44488758 GCAGGGATGGAGGAAGGGGAGGG - Intronic
1024030294 7:45455034-45455056 AGGGGGATGGGGGAGGGGGGTGG - Intergenic
1024051183 7:45624348-45624370 AGGGGGAAGGAGGGTGGGCATGG + Intronic
1024721007 7:52137379-52137401 AGGGGGGAGGAGGATGGAGAAGG + Intergenic
1024895889 7:54261505-54261527 AGGTGGATGGATCATGGGGATGG - Intergenic
1025607100 7:63047348-63047370 ATGGTGAGGGAGGTTGGGGAAGG - Intergenic
1026308833 7:69166264-69166286 ATGGGGAGGGGGGAAGGGGAGGG + Intergenic
1026308845 7:69166283-69166305 AGGGGGAGGGGGGAAGGGGAGGG + Intergenic
1026350517 7:69511397-69511419 GCTGGGCAGGAGGATGGGGATGG - Intergenic
1026507432 7:70997243-70997265 ACAGGCATGTAGGATTGGGAGGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026772391 7:73210838-73210860 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026806125 7:73430450-73430472 AAGGGGATGGAGGGGGAGGAGGG - Intergenic
1027013259 7:74764237-74764259 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1027074781 7:75181797-75181819 ATGGGGAAAGAGGAAGGGGACGG - Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027159772 7:75793791-75793813 AAGGGGAGGAAGGAAGGGGAAGG + Intergenic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027774167 7:82443860-82443882 ACGGCGCTGGAGGGTGGGGGTGG + Intergenic
1028281122 7:88929220-88929242 ACGGGGAGAGAGACTGGGGATGG + Intronic
1028668526 7:93373749-93373771 AGTGGGAAGGAGGATAGGGATGG + Intergenic
1028720173 7:94020889-94020911 ATGGGGTTGGGGGAGGGGGAGGG + Intergenic
1028773731 7:94656252-94656274 GCGGGGATGGGGGATGGGGGTGG - Intergenic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029576893 7:101409335-101409357 AAGTGGATGGAGCATGGGGTTGG + Intronic
1029739665 7:102484073-102484095 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029757666 7:102583252-102583274 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029775602 7:102682313-102682335 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1030111129 7:106027832-106027854 AAGGGGATGGGGGCTGGGCATGG + Intronic
1030259750 7:107550645-107550667 ATGGGGATGGATGAAGGAGAGGG - Intronic
1030295486 7:107921845-107921867 AAGGGGATGGGGGTGGGGGAGGG - Intronic
1030509919 7:110471396-110471418 AGAGAGATGGAGGATGGAGAAGG + Intergenic
1030660209 7:112209996-112210018 GTGGGGTTGGGGGATGGGGAAGG + Intronic
1030956601 7:115860633-115860655 ATGGTGATAGAGGGTGGGGAAGG - Intergenic
1031167039 7:118241413-118241435 GTGGGGATGGGGGATGGAGAGGG - Intronic
1031317670 7:120275766-120275788 AATGGGATGGAGGTTGGGTATGG + Intronic
1032179698 7:129664124-129664146 ACGGGAAAGGGGGAGGGGGAGGG + Intronic
1032345306 7:131110714-131110736 TTGGGGAAGGAGGATGGTGAGGG - Intronic
1033045967 7:137962444-137962466 AAGGGGAAGGAGGATGGTGCGGG - Intronic
1033096722 7:138438707-138438729 TCAGGGATGGGGAATGGGGATGG + Intergenic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033354374 7:140587583-140587605 AAGGGGAGGGAGAATGGGGCTGG - Intronic
1033392396 7:140940309-140940331 ACAGGGATGGAGGTTGTGCATGG + Intergenic
1033804362 7:144937525-144937547 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804369 7:144937538-144937560 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1034308632 7:150067799-150067821 GGGGGGATGGGGGATGGGGTCGG + Intergenic
1034798219 7:154032844-154032866 GGGGGGATGGGGGATGGGGTCGG - Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1034914075 7:155022576-155022598 AGGGGGATGGAAGATGAGAAAGG - Intergenic
1035060539 7:156066256-156066278 ACGTGGAATGAGGATGAGGATGG - Intergenic
1035174016 7:157037712-157037734 AAGGGGAGGGAGCCTGGGGAGGG + Intergenic
1035329089 7:158084884-158084906 ATGGGCATCGAGGATGTGGATGG - Intronic
1035407223 7:158607057-158607079 AAGGTGATGGAGGATGGAGCAGG + Intergenic
1036191810 8:6677892-6677914 ACATGGATGGGGGATGGGGAGGG - Intergenic
1036217100 8:6889877-6889899 AGGGGGAGGGGGGATGGGGAGGG - Intergenic
1036217115 8:6889901-6889923 ACGGGGAGGGGGGATGGGGAGGG - Intergenic
1036748655 8:11429121-11429143 CAGGGGCTGGAGGAGGGGGATGG - Intronic
1036777833 8:11625677-11625699 ACGGTGAGGGAGGCTGGGGAAGG + Intergenic
1037611545 8:20480396-20480418 AAAGGGAAGGAGGATGGGGGTGG + Intergenic
1037725346 8:21478662-21478684 AAGGTGATGGAAGACGGGGAAGG + Intergenic
1037760410 8:21738159-21738181 ACGGGGGAGGGGGATGAGGAGGG - Intronic
1037808582 8:22072462-22072484 ACAGGGGTGGAGGGTGGGGGTGG - Intronic
1037993376 8:23336358-23336380 ACTGGGATGGAGGAGGGGAGGGG - Intronic
1038022858 8:23564488-23564510 TCGGGGAGGGAGGAAGGGAAGGG + Intronic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038136359 8:24790558-24790580 TCGGAGCTGGAGAATGGGGAGGG - Intergenic
1038304924 8:26391323-26391345 TTGTGGATGGAGGATGAGGATGG - Exonic
1038326261 8:26575074-26575096 ACGGGCATGGTGGCTGGGGCCGG - Intronic
1039198229 8:35056454-35056476 ACAGGGCTGGAGGGTGGTGATGG + Intergenic
1039793115 8:40891252-40891274 AGGGGGAGGGGGGAGGGGGAAGG + Intronic
1039913702 8:41844421-41844443 CAGGCGATGGAGGTTGGGGAGGG - Intronic
1040289243 8:46115957-46115979 ACGGGGATGCAGGATGGCATGGG - Intergenic
1040324207 8:46333450-46333472 ACGGGGCTGCAGGATGGCGTGGG + Intergenic
1040470652 8:47733598-47733620 ACGGGGAGGGAGGGTGGAGGCGG - Intronic
1040517143 8:48144469-48144491 GGGTGGATGGAGGGTGGGGAAGG + Intergenic
1040534540 8:48297349-48297371 CTGGGGATGGGGGTTGGGGAGGG + Intergenic
1040863278 8:52022816-52022838 AAGGGGATGGGGGTAGGGGAGGG - Intergenic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1041895855 8:62924117-62924139 ATGTGGCTGGAGGTTGGGGAGGG - Intronic
1042176523 8:66042697-66042719 AGGGGGAGGGGGGAGGGGGAGGG - Intronic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042412309 8:68479562-68479584 CCAGAGATGGAGGTTGGGGATGG + Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042845990 8:73169962-73169984 GATGGGATGGAAGATGGGGAGGG - Intergenic
1043690668 8:83146924-83146946 AAGGGGGTGGAGGATGGCGGAGG - Intergenic
1044253643 8:90034112-90034134 ACGGGGGTGGAAGAGGGGGCAGG - Intronic
1044656506 8:94553782-94553804 CGGTGGATGGAGGAGGGGGAGGG + Intergenic
1044812639 8:96079661-96079683 ACGGGGATGGTGCAGGGGGATGG + Intergenic
1044935790 8:97292422-97292444 ACGGGGAGGCAGGGTGGTGAAGG + Intergenic
1044956059 8:97482251-97482273 ATGGGGTTGGGGGATGGGGGAGG - Intergenic
1045540066 8:103075830-103075852 CCGGGAGTGGAGGATGGGGCGGG - Intergenic
1045881516 8:107045942-107045964 TGGGGGAGGGAGGATGGAGAGGG + Intergenic
1046936471 8:119889638-119889660 AGGGGAGGGGAGGATGGGGAGGG + Intronic
1046953147 8:120037148-120037170 ACAGGGATTGTGCATGGGGAAGG + Intronic
1047371401 8:124258972-124258994 ATGGTGTTGGGGGATGGGGAAGG - Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1047901163 8:129423480-129423502 AAGGGGAGGGAAGATTGGGAAGG + Intergenic
1048331042 8:133471004-133471026 AGGAGGAAGGAGGATGGGAAGGG - Intronic
1049029792 8:140025923-140025945 ACGGAAATGGATGATGGAGATGG - Intronic
1049047663 8:140165585-140165607 AGGGGGAAGGAGGGAGGGGAAGG + Intronic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049290487 8:141798970-141798992 GCAGGGATGGAGGAAGGGAAGGG - Intergenic
1049315824 8:141966818-141966840 GTGGGGATGGAGGAAGGGGATGG + Intergenic
1049440492 8:142607302-142607324 AGGGGAGTGGAGGGTGGGGAGGG + Intergenic
1049454849 8:142681631-142681653 TGGAAGATGGAGGATGGGGAGGG - Intronic
1049575283 8:143386979-143387001 TCGGGGGTGGTGGAAGGGGACGG - Intergenic
1049613611 8:143567103-143567125 ACGGGGGTGGGGGGTGGGGGAGG + Exonic
1050309631 9:4339816-4339838 AGGGGGAGGGGGGAGGGGGAGGG + Intronic
1050321175 9:4453847-4453869 ATGGGGTGGGAGGAAGGGGAGGG + Intergenic
1050672570 9:8014377-8014399 AAGGGGATGAAAGATGGAGATGG + Intergenic
1050916455 9:11141097-11141119 ACGGAGGTGGATGATGGTGATGG + Intergenic
1051148710 9:14058051-14058073 ACGGGGGTGGAGGCAGGGGGAGG + Intergenic
1051431659 9:16985801-16985823 ACTGGGAGGAAGGATGGGGTGGG + Intergenic
1051606712 9:18923906-18923928 CAGTGGTTGGAGGATGGGGAAGG - Intergenic
1052370865 9:27663173-27663195 AAGGGAAAGGAGGATGGGGGAGG - Intergenic
1052789261 9:32859295-32859317 ACTGGGATGGAGCTTGAGGAGGG - Intergenic
1053161971 9:35819451-35819473 GTGGGGATGGAGGATGGGGTTGG - Intronic
1053233819 9:36434323-36434345 TGGGGGAAGGAGGAGGGGGAGGG + Intronic
1053233829 9:36434345-36434367 GCAGGGGAGGAGGATGGGGAGGG + Intronic
1053350719 9:37411762-37411784 AAGGGGATGGAGGCAGGGGATGG - Intergenic
1054959049 9:70946701-70946723 ACTGGAAAGGAGGATGAGGAGGG - Intronic
1055581437 9:77711048-77711070 GAGGGGAAGGAGGAGGGGGAGGG - Intergenic
1055581446 9:77711066-77711088 AGGAGGAGGGGGGATGGGGAGGG - Intergenic
1055931033 9:81560055-81560077 ACAGGGAGTGAGGAGGGGGAGGG + Intergenic
1056351345 9:85751936-85751958 ATGTGGATGGAGGCTGGGCATGG + Intergenic
1056688368 9:88785138-88785160 GCAGGGCTGGTGGATGGGGAGGG - Intergenic
1056719316 9:89059205-89059227 ACGGTGGTGGAGGATGGTGGTGG + Intronic
1056835095 9:89948282-89948304 GGGGGGAGGGAGGAGGGGGAAGG + Intergenic
1057163657 9:92909163-92909185 AGGGGGCTGGCAGATGGGGATGG - Intergenic
1057717306 9:97504669-97504691 TCTGCGATGGAGGATGGTGATGG + Intronic
1057964345 9:99488618-99488640 TGGGGGGTGGAGGATGAGGAGGG + Intergenic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058483453 9:105420147-105420169 TCGGGGATCCTGGATGGGGAGGG - Intronic
1058843912 9:108936670-108936692 CCCAGGATGGAGGAGGGGGAAGG + Intronic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059328162 9:113517304-113517326 ACGGTGAGGGTTGATGGGGAAGG + Intronic
1059406194 9:114099385-114099407 CCTGGGATGGGGGATGGGGTGGG - Intergenic
1059657528 9:116369780-116369802 ACTGGGTTGGGGGATGGGGCAGG - Intronic
1059903474 9:118954772-118954794 GAAGTGATGGAGGATGGGGATGG + Intergenic
1059910787 9:119041550-119041572 AGGGAGATGGAGGCTGGGCAGGG + Intergenic
1060171920 9:121468924-121468946 AAGGGCATGGAGGTTGGGGATGG - Intergenic
1060374266 9:123104644-123104666 AAGGGGATGGTTGGTGGGGAGGG - Exonic
1060504447 9:124187563-124187585 TGGGGGATGGAGGGTGTGGATGG - Intergenic
1060546722 9:124466269-124466291 ATGGGCTTGGGGGATGGGGAGGG - Exonic
1060654410 9:125359203-125359225 AAGGGGATGCAGGGAGGGGAGGG - Intronic
1060722210 9:125986734-125986756 ACAGGGAGGGAGGAATGGGATGG + Intergenic
1060952460 9:127612683-127612705 GCGAGGAAGGAGGATGGCGAGGG - Intronic
1060967674 9:127720878-127720900 AGGAGGAGGGAGGAAGGGGAAGG - Intronic
1060994993 9:127870824-127870846 ATGGGAATGGGGCATGGGGATGG + Intronic
1061224930 9:129275914-129275936 AGGTGGATGGAGGAGGGGGAGGG - Intergenic
1061305673 9:129731709-129731731 ACGGGGAGGGAGGGAGGGAAGGG + Intergenic
1061626238 9:131842319-131842341 AGGGGGCAGGAGGGTGGGGACGG + Intergenic
1061637473 9:131922022-131922044 ATGGGGAGGGGGGAGGGGGAGGG + Intronic
1061912974 9:133734703-133734725 CCGGGCAGGGAGGATGGGGAGGG + Intronic
1062119100 9:134824552-134824574 TGGGTGATGGAGGATGGGAAGGG - Intronic
1062463220 9:136670451-136670473 CCAGGGAGGGAGGATGGGGAGGG + Intronic
1062469617 9:136696842-136696864 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469627 9:136696860-136696882 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469659 9:136696922-136696944 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469682 9:136696967-136696989 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469692 9:136696985-136697007 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469712 9:136697026-136697048 AGGGGGGAGGAGGAGGGGGAAGG - Intergenic
1062469722 9:136697045-136697067 AGGGGGGAGGAGGAGGGGGAGGG - Intergenic
1062469743 9:136697082-136697104 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062469753 9:136697101-136697123 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062470524 9:136701639-136701661 ACGGGTCTGGAGGCTGGGGGTGG + Intergenic
1062533523 9:137011790-137011812 GCGGGGATGGGGGATGAGAAGGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1203738872 Un_GL000216v2:161742-161764 CCGGGGGTGGGGGATGGGGCTGG + Intergenic
1185449525 X:275102-275124 AGGAGGAGGGAGGAGGGGGAGGG + Intergenic
1185459518 X:328292-328314 ACGGGGAGAGGGGAGGGGGACGG - Intergenic
1185459839 X:328886-328908 AGGGGGAGAGAGGAGGGGGAGGG - Intergenic
1185499477 X:585716-585738 ACAGGGATGGAGGAGGGAGGTGG - Intergenic
1186186946 X:7030011-7030033 ATGGGGATGGAGAATTGGAATGG - Intergenic
1186293224 X:8121847-8121869 GAGGGGATGGGGGAGGGGGAGGG - Intergenic
1186293236 X:8121866-8121888 AGGGGGATGGGGGAGGGGGGAGG - Intergenic
1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG + Intergenic
1187841170 X:23490065-23490087 AAGGGGAGGGGGGAGGGGGAGGG + Intergenic
1188517827 X:31006163-31006185 ACGAGGATGGTGGCTGGTGATGG - Intergenic
1188737048 X:33729901-33729923 AATGGGATGGAGAGTGGGGATGG - Intergenic
1189267168 X:39725769-39725791 ACAGGGATAGAGGATGGAGGTGG - Intergenic
1189753071 X:44242747-44242769 GAGGAGATGGTGGATGGGGAAGG - Intronic
1190367403 X:49709342-49709364 ATGGGGGTGGGGGAGGGGGAGGG + Intergenic
1190469505 X:50764218-50764240 CAGGAGCTGGAGGATGGGGATGG + Intronic
1190720006 X:53139862-53139884 AAGGGGGAGGAGGAAGGGGAAGG + Intergenic
1190758850 X:53423236-53423258 ACAGGGATACAGGCTGGGGAAGG + Intronic
1191582598 X:62781390-62781412 ATGGGGTGGGAGGATGGGGGAGG - Intergenic
1192024008 X:67428738-67428760 AAGTGGATGGAAAATGGGGATGG - Intergenic
1192216728 X:69164559-69164581 AGGCGGATAGAGGAGGGGGAAGG + Intronic
1192236331 X:69298493-69298515 TTGGTGCTGGAGGATGGGGAAGG - Intergenic
1192448960 X:71230903-71230925 AAGGGGAAGGAAGAGGGGGAAGG + Intergenic
1192486817 X:71534219-71534241 ACTGGGCTGAAGAATGGGGATGG - Intronic
1192764180 X:74125642-74125664 ATGGTGATGTAGGATGTGGAAGG + Intergenic
1192925415 X:75750211-75750233 ATGGGGATGGAGGATGGGGAGGG - Intergenic
1193415407 X:81216569-81216591 TAGGGTAGGGAGGATGGGGATGG - Intronic
1194329266 X:92560707-92560729 AAGGGGATGGAAGATGTAGAAGG + Intronic
1195098568 X:101530333-101530355 GTGGGGTTGGAGGATGGGGAAGG + Intronic
1195105454 X:101598854-101598876 GCGGGGGTGGGGGAAGGGGAGGG + Intergenic
1195107428 X:101614913-101614935 GCGGGGGTGGGGGAAGGGGAGGG - Intergenic
1195446743 X:104960707-104960729 ACTTGGAGGGAGGAGGGGGAAGG - Intronic
1195570216 X:106392281-106392303 ACTGTGATGGATGCTGGGGAGGG - Intergenic
1195675193 X:107502534-107502556 GCAGGGGTGGAGGATCGGGAGGG - Intergenic
1195676892 X:107513421-107513443 AAGGGGCAGGAGGATGGGCAGGG - Intergenic
1195696221 X:107669589-107669611 AGGGGGATGGGGGAGGAGGAAGG - Intergenic
1195696223 X:107669596-107669618 AGGGGGAAGGGGGATGGGGGAGG - Intergenic
1196508600 X:116478578-116478600 AGGGGGATGGAGGATGAGTGGGG - Intergenic
1196845364 X:119892935-119892957 AGGGGAATGGAGGGTGGGAAGGG - Intergenic
1196893529 X:120311571-120311593 AGGGGGAGGGAGGAGGGGGGGGG - Intergenic
1197575422 X:128204919-128204941 ACGGGGTGGGGGGAGGGGGAAGG + Intergenic
1198517830 X:137427066-137427088 AAGGGGATGGGGGAGGGGGTGGG + Intergenic
1198603442 X:138310461-138310483 ATGGAGATGGAAGTTGGGGATGG - Intergenic
1199466378 X:148142123-148142145 ACAGGGTTGGGGGATGGGGGTGG + Intergenic
1200637965 Y:5679896-5679918 AAGGGGATGGAAGATGTAGAAGG + Intronic
1200985874 Y:9303351-9303373 AAGGGGATGGGGGATAGTGAGGG + Intergenic
1201310394 Y:12593956-12593978 ATGGGGATGAAGGTTGGGTATGG + Intergenic