ID: 1152872195

View in Genome Browser
Species Human (GRCh38)
Location 17:82761652-82761674
Sequence ACTGATACACACACCAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152872195 Original CRISPR ACTGATACACACACCAACAA TGG (reversed) Intronic
901095595 1:6676689-6676711 ACACACACACACACCAAAAAAGG + Intronic
902794850 1:18794457-18794479 ACAGAAACACATACCAAGAAAGG - Intergenic
902800157 1:18824521-18824543 ACTCATACACACACACACACGGG + Intergenic
903429503 1:23282759-23282781 ACTGAGAAACACACCAAACAGGG + Intergenic
903924564 1:26822629-26822651 ACTGATTCAGACACCAACAGTGG + Intergenic
906575698 1:46887237-46887259 ACTAATACACATACCAACCCAGG + Intergenic
906596278 1:47080659-47080681 ACTAATACACATACCAACCCAGG - Exonic
908048630 1:60202038-60202060 ACTTCTACTCACACAAACAAAGG - Intergenic
909808444 1:79900958-79900980 ACAGATACACACAGAAATAATGG + Intergenic
912024593 1:105152514-105152536 ACTAATATACACAACAACATAGG - Intergenic
912186283 1:107280026-107280048 ACACACACACACACCAACAAAGG - Intronic
916810740 1:168303508-168303530 CCTGATCCAGACCCCAACAAAGG + Intronic
919017696 1:192061535-192061557 ACTGATACACACAGCAATAAGGG - Intergenic
920606215 1:207389689-207389711 ACTGATACACAGCCCAACTTAGG - Intergenic
920653981 1:207861115-207861137 ATAAATACACACACAAACAAGGG + Intergenic
921109834 1:212024699-212024721 ACTGATGCATACAACAACAAAGG + Intronic
922660673 1:227427824-227427846 ACAGATAAACACATCCACAAAGG - Intergenic
923297465 1:232608725-232608747 ACTGATAAGCACTCCAACTAAGG + Intergenic
923971061 1:239203769-239203791 GCTGATACCCAAATCAACAATGG + Intergenic
924102290 1:240617296-240617318 ATGGATACACACAGAAACAAAGG - Intergenic
924351737 1:243120960-243120982 ACTGACACACACAGTAACATGGG - Intergenic
924649441 1:245911517-245911539 ACATATACACACACACACAACGG + Intronic
1062782261 10:224630-224652 AATGACACACACACCAACACAGG - Intronic
1062972320 10:1658653-1658675 CCTGATGCAGACACCAGCAAGGG - Intronic
1063013976 10:2056166-2056188 ACACACACACACACAAACAATGG - Intergenic
1067012247 10:42725218-42725240 ACACATACACACACACACAAAGG - Intergenic
1069238103 10:66103559-66103581 ACTGATACACACCACAACACAGG + Intronic
1070199236 10:74186777-74186799 ACTGATACACACACCAAAATGGG - Intronic
1070663544 10:78327830-78327852 AATACTACACACACCAACCAGGG - Intergenic
1070788793 10:79177546-79177568 GCCGAAACACACACCACCAAGGG + Intronic
1074761235 10:116668957-116668979 ACACACACACACACAAACAAGGG + Intronic
1075423021 10:122318296-122318318 ACTGATACATGCAACAACATGGG - Intronic
1075821715 10:125318966-125318988 ATTGCTACACACAACAACATGGG - Intergenic
1077526449 11:3068581-3068603 ACACACACACACACCAAAAATGG - Intergenic
1077832268 11:5886172-5886194 ACACATACACACACACACAAAGG - Intronic
1079335466 11:19566840-19566862 TCTGAAAGACACACCCACAAAGG + Intronic
1079479005 11:20861416-20861438 ACTGCTCCACACACTACCAAGGG - Intronic
1082213313 11:49533924-49533946 ACACACACACACACAAACAATGG + Intergenic
1083740729 11:64710247-64710269 ACAGACACACACACACACAATGG + Intronic
1084401157 11:68943935-68943957 ACTGATACACACCACCACATGGG - Intergenic
1084434897 11:69133087-69133109 ACAGATACACACAACAACATGGG - Intergenic
1084782554 11:71420021-71420043 ACAGCTACACACATCAACATGGG - Intergenic
1085700132 11:78738501-78738523 ACTGATGTTCACACCAACCAGGG + Exonic
1085942142 11:81217611-81217633 ACAGATACAAAAACAAACAATGG + Intergenic
1087004307 11:93454022-93454044 ACTAACACCCACACCAGCAAAGG + Intergenic
1087559743 11:99772827-99772849 ACACATACACACACCCACAGAGG + Intronic
1088041574 11:105390665-105390687 AGTGATACACACAACAACATAGG + Intergenic
1088304460 11:108393305-108393327 ACTAATTCACACTGCAACAAAGG - Exonic
1088756414 11:112888978-112889000 ACAGAGGCACACACAAACAATGG + Intergenic
1090604673 11:128408857-128408879 ACTGATCCACACAGAAAAAAAGG - Intergenic
1090843072 11:130509309-130509331 ACTCACACCCACACCAGCAAAGG - Intergenic
1091004104 11:131936681-131936703 ACACAAACACACACAAACAAAGG + Intronic
1093119763 12:15254677-15254699 ACAGACACACACACACACAAAGG - Intronic
1093728586 12:22543605-22543627 ACTGAAACACACACACACACAGG - Intronic
1095042576 12:37458994-37459016 CCTGATACACAGAGCAACAATGG + Intergenic
1097500887 12:60400725-60400747 ACAGACACACACACACACAATGG - Intergenic
1097824572 12:64161905-64161927 ACTGATACACGCTACAACATGGG + Exonic
1098821873 12:75242319-75242341 ACTGATATACTCAACAACATGGG + Intergenic
1099653317 12:85456956-85456978 ACTGTAACACACACCCACTAGGG + Intergenic
1099761380 12:86924111-86924133 ACAGAGACACACACACACAATGG + Intergenic
1099893054 12:88612588-88612610 ACTAATATACCCACCAACATTGG + Intergenic
1100953889 12:99884577-99884599 ATTGATACACACAACAACATGGG + Intronic
1102722830 12:115032948-115032970 ACTTACTCACACACCAAAAAAGG + Intergenic
1104062022 12:125276706-125276728 ACTGACAGCCACACCAACAAGGG - Intronic
1104265111 12:127224744-127224766 ACAGACACACACACACACAATGG - Intergenic
1104424624 12:128665453-128665475 ACTCACACACACACAAACATAGG + Intronic
1105664354 13:22535711-22535733 ACTGATACACTCAGCATCATGGG + Intergenic
1105671141 13:22617630-22617652 AATGATAGACACAGCTACAAAGG + Intergenic
1107570024 13:41647593-41647615 GCTGATACACAAAACAGCAATGG + Intronic
1107668173 13:42714712-42714734 ACTGATACATGCAACAACACGGG - Intergenic
1107788433 13:43977387-43977409 ACAGATACACACCTCACCAAAGG + Intergenic
1108537456 13:51399699-51399721 ACACACACACACACCCACAATGG - Intronic
1108866521 13:54930525-54930547 ACTGAGACACACACACAAAAAGG + Intergenic
1110007069 13:70286273-70286295 TGTGATACACACACACACAATGG + Intergenic
1110141043 13:72129689-72129711 ACTCATACCCACACCAGCAAAGG - Intergenic
1110516572 13:76419733-76419755 ACAGAAACACACACAAACCAGGG + Intergenic
1110786371 13:79532411-79532433 ACTGACACACACACAAAAAAGGG - Intronic
1112303741 13:98254221-98254243 AATGACACAAACACCAATAATGG - Intronic
1112813285 13:103243950-103243972 ACTGATAATCTCACCAACTATGG + Intergenic
1113405304 13:110033325-110033347 ACTGATAGGCACACCATAAAAGG + Intergenic
1114904950 14:27115653-27115675 ACACATACACACACACACAAAGG - Intergenic
1115108945 14:29797692-29797714 ACAGACACACACACCACCACAGG + Intronic
1116639184 14:47439322-47439344 ACACATACACACACAAACAGAGG - Intronic
1117096964 14:52308919-52308941 ACTCATACTGTCACCAACAACGG + Intergenic
1117226202 14:53662661-53662683 ACTGATACATGCAACAACACAGG + Intergenic
1118420842 14:65601117-65601139 ACTCACACACAAACCAAGAAGGG - Intronic
1120475278 14:84978928-84978950 ACACACACACACACCAACATAGG + Intergenic
1120660449 14:87242636-87242658 ATTGATACATACAACAACATGGG + Intergenic
1122095232 14:99365807-99365829 ACTAATACACAGAGTAACAATGG - Intergenic
1122103621 14:99434238-99434260 ACAGCTACACACAGCAACATGGG + Intronic
1122276232 14:100592166-100592188 ACAGAGAAACACACCAACTAGGG - Intergenic
1122276907 14:100595476-100595498 ATTGATACACACAGCAACGTGGG - Intergenic
1124127216 15:26946950-26946972 ACTGATATACACAGCAATATGGG + Intronic
1125897445 15:43314580-43314602 ACTAATACACACTACAACATGGG + Intergenic
1126868179 15:52958650-52958672 ATTTATACACTCACCAAAAAAGG - Intergenic
1128381579 15:67117049-67117071 ACTGAAACACACACTGAAAAGGG + Intronic
1129309898 15:74699880-74699902 ACTCACACACACACAAAAAAAGG - Intergenic
1130095910 15:80855949-80855971 ACTGATACACACAGCAACGTAGG + Intronic
1130363521 15:83211807-83211829 TCTGATGCTCACACCAACATGGG - Intergenic
1131405967 15:92164865-92164887 ACTCATACACACACAACAAAGGG + Exonic
1133625625 16:7568081-7568103 CCTGATCCAGACACCAAGAAAGG + Intronic
1134796680 16:17045160-17045182 ACACACACACACACAAACAATGG - Intergenic
1135589347 16:23694135-23694157 ACAGATGCACACACCCACACCGG + Intronic
1137019005 16:35404456-35404478 ACAGATATACACACACACAAAGG - Intergenic
1137979600 16:53058435-53058457 ACAGAAACACACATAAACAAAGG + Intronic
1138090354 16:54168742-54168764 ACTCATTCCCACACCACCAAGGG + Intergenic
1141124309 16:81389419-81389441 GCTGGTACACACCCCAACAGTGG - Exonic
1141217271 16:82036313-82036335 ACACACACACACACAAACAAGGG - Intronic
1142490484 17:275349-275371 ACAGCTACACACATCAACATGGG + Intronic
1143738287 17:8930706-8930728 ATTGATACACACAACAACCTGGG + Intronic
1144002579 17:11069451-11069473 ACATATACACACACACACAAAGG - Intergenic
1144848212 17:18230950-18230972 ACTGCCACACTCACCAACAGAGG - Intronic
1147370357 17:39988386-39988408 ACTGACACACACTACAACATGGG - Intronic
1148400050 17:47350578-47350600 ACACACACACACACAAACAAAGG - Intronic
1149813095 17:59697001-59697023 ACTGATACAGCCACCCTCAATGG - Intronic
1150094948 17:62365623-62365645 ACACACACACACACCAAAAAAGG + Intergenic
1151442510 17:74140321-74140343 ACTGATACATACAATAACATGGG + Intergenic
1152872195 17:82761652-82761674 ACTGATACACACACCAACAATGG - Intronic
1154727287 18:18107317-18107339 ACTTATACACACTACAAAAAGGG - Intergenic
1155700501 18:28737288-28737310 ACTGATTAAAACACCAACAAAGG + Intergenic
1157238008 18:45982135-45982157 ACAGACACACACACATACAAAGG - Intergenic
1157766790 18:50303609-50303631 ACTGATACAAGCAACAACATGGG - Intergenic
1157874154 18:51256094-51256116 CCTAATACATATACCAACAAAGG + Intergenic
1158595701 18:58814033-58814055 ACTGATACCCACGAAAACAAAGG - Intergenic
1160390214 18:78524589-78524611 ACAGACACACACACAAACACAGG + Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1164098805 19:22035911-22035933 ACACACACACACACAAACAAAGG + Intergenic
1168268449 19:55236511-55236533 ACTAATACACACACCAATGCAGG + Intronic
925229293 2:2218400-2218422 ATTGATACACACAGCAAGATGGG + Intronic
926663666 2:15496164-15496186 ACTGATACATGCAACAACATGGG + Intronic
927740226 2:25562238-25562260 ACTGATACACACTAAAACATAGG - Intronic
928194705 2:29206768-29206790 ACACACACACACACCAATAAAGG - Intronic
928261454 2:29771191-29771213 ACAAATACACACACACACAAAGG + Intronic
928641866 2:33307471-33307493 ACTGATACACACAGCAACTTGGG + Intronic
928741487 2:34359002-34359024 ACTGATATACACAACAACATGGG - Intergenic
929066814 2:37984892-37984914 TCAGATACACACACAAACATAGG + Intronic
929713541 2:44288528-44288550 ACAGATACAGACACCTACCAGGG - Intronic
930287316 2:49447040-49447062 ACACATACACACACACACAATGG + Intergenic
931726468 2:65116299-65116321 GCTGAAAAACACACCAAGAACGG + Intronic
934077723 2:88442074-88442096 ACTCCAACACACTCCAACAAAGG + Intergenic
934974970 2:98795391-98795413 ACTGATACATGCAACAACAAAGG + Intronic
935598661 2:104899934-104899956 ACTTGGACACACACCCACAAGGG - Intergenic
935924642 2:108053745-108053767 GTTGATCCAAACACCAACAAGGG - Intergenic
936264607 2:110993446-110993468 ACTAATACACACAACAACATGGG - Intronic
937536351 2:122893402-122893424 ACTGATACATACAATAACATGGG + Intergenic
939461932 2:142508074-142508096 ACAGACACACACACACACAAGGG + Intergenic
940057741 2:149530800-149530822 ATTGATATACACAACAACACAGG + Intergenic
940209454 2:151241597-151241619 ACAGAAACACACACCAAACAAGG - Intergenic
941372062 2:164677873-164677895 ATTGATACTCCCACCAACAGTGG + Intronic
941920617 2:170847109-170847131 GCTGATACACTCACTAACAGTGG - Intronic
942255735 2:174096122-174096144 ACTGATACACACTACAACATGGG + Intronic
942485430 2:176434686-176434708 ACTAATACACACAACAACATGGG - Intergenic
942836824 2:180309731-180309753 ACTGATACACACAACATAGATGG - Intergenic
942913254 2:181271792-181271814 ACACACACACACACTAACAAGGG + Intergenic
943312269 2:186340957-186340979 ACTGATACACACAACATAGATGG + Intergenic
943972207 2:194425217-194425239 ACTGTTAAACACACCAATGAAGG + Intergenic
944149066 2:196538031-196538053 CCTGATCCAGACACCAACAGAGG - Intronic
944837162 2:203591183-203591205 ACTGATACACGCTACAACATAGG - Intergenic
945996054 2:216437018-216437040 ACTGAAGAACAAACCAACAATGG - Intronic
946829566 2:223714324-223714346 ACTGTTACTAACAACAACAATGG + Intergenic
947067504 2:226245306-226245328 ACAGACACACACACACACAAAGG - Intergenic
947613418 2:231538294-231538316 ACAGATAAACACATGAACAAAGG + Intergenic
1168738548 20:167461-167483 ACTGTGACACACACACACAATGG - Intergenic
1168832979 20:857320-857342 ACAGATACACTCAGCAACACGGG - Intronic
1169236327 20:3932930-3932952 ACTGAGGCACACACCAACGGTGG + Exonic
1170856249 20:20058328-20058350 ACTGATACACACAAAAGCTAAGG + Intronic
1170948786 20:20915250-20915272 TCTGCTACACAAACCAACAGTGG + Intergenic
1171847520 20:30286119-30286141 ACACACACACACACAAACAAAGG + Intergenic
1173780091 20:45748705-45748727 ACAGACACACACCCCAACAAAGG - Intronic
1178019208 21:28390168-28390190 CCTGATCCACTCACCAGCAAAGG - Intergenic
1178565377 21:33679215-33679237 ATAGATACACACACACACAAAGG - Intronic
1178660303 21:34502113-34502135 TCTGATACATAGACCAAAAAAGG - Intergenic
1182267780 22:29132193-29132215 ACTGATACAGGCAACAACATAGG - Intronic
1182638381 22:31747642-31747664 ACACCTACAGACACCAACAATGG + Intronic
952447786 3:33399495-33399517 ACTGATAAACACAACAACTTAGG + Intronic
954922434 3:54203395-54203417 CCTGTAACACACACCCACAAGGG - Intronic
955442351 3:58970419-58970441 AGTGATACACCTACAAACAAAGG + Intronic
955465481 3:59232620-59232642 ACTGATAGACACAACAACATGGG - Intergenic
955676656 3:61456083-61456105 ATGGATACACACACCACAAACGG - Intergenic
955892792 3:63667858-63667880 ACATATACACACACACACAAAGG + Intronic
956070647 3:65446863-65446885 ATTGATGCACATGCCAACAATGG - Intronic
957057791 3:75457547-75457569 ACACACACACACACAAACAAAGG - Intergenic
957129333 3:76203210-76203232 ACTGATACGGACTCCATCAATGG + Intronic
958686978 3:97411165-97411187 ACTGATACAAACACTCATAAAGG + Intronic
958985370 3:100774544-100774566 GCTGATACACCTACCAAAAATGG + Intronic
959170200 3:102835220-102835242 ATTTATACTCCCACCAACAATGG - Intergenic
963052020 3:141150624-141150646 ACAGACACACACACGACCAAGGG + Intergenic
964008192 3:151856555-151856577 ACGGACACACACAGAAACAATGG - Intergenic
964146037 3:153464664-153464686 ACAGATACACACACAAACTGAGG + Intergenic
965884846 3:173432761-173432783 ACTTTTATACACAACAACAAAGG - Intronic
967538611 3:190637933-190637955 CCTGATACACACAACAGCATGGG - Intronic
968260662 3:197321193-197321215 ACTGATACACATGACAACATGGG + Intergenic
968488387 4:876306-876328 ACAGACACACACACCAACGGGGG + Intronic
969093523 4:4715127-4715149 ACACACACACACACAAACAATGG - Intergenic
969318904 4:6398925-6398947 ATTGACACACACAGCAACCAGGG + Intronic
970055635 4:11968565-11968587 ACTGATGCACACATTAACACTGG - Intergenic
970199766 4:13591927-13591949 AGTGATTCATTCACCAACAAAGG + Exonic
970209564 4:13695061-13695083 ACTGATAAACAAAACAACATAGG + Intergenic
971814591 4:31470832-31470854 ACACACACACACACCCACAATGG + Intergenic
972766610 4:42157368-42157390 ACCGATGCACACAACAACACAGG - Intergenic
972955126 4:44379543-44379565 ACACATACACACACCTGCAATGG - Intronic
974066134 4:57079221-57079243 ACACACACACACACCAAAAAAGG - Intronic
974982546 4:68977589-68977611 ACTGATACACAAAAATACAAAGG + Intergenic
974990768 4:69085844-69085866 ACTGATACACAGAAATACAATGG - Intronic
974994897 4:69143138-69143160 ACTGATACACAAAAGTACAAAGG - Intronic
975018009 4:69448416-69448438 ACTGATACACAAAAATACAAAGG - Intergenic
976455501 4:85242203-85242225 ACAGACACACACACACACAATGG - Intergenic
976590119 4:86841345-86841367 ACTGTTACAAATACCAGCAAAGG + Intronic
977111232 4:92958280-92958302 ACTGATAAAGACATCTACAAAGG - Intronic
977239156 4:94545469-94545491 CCTGACACACATACCAAAAATGG + Intronic
978236258 4:106464609-106464631 ACTGATAAATACAACAACATGGG + Intergenic
978287499 4:107095724-107095746 ACACACACACACACCCACAAAGG + Intronic
978989254 4:115057746-115057768 ACACACACACACACCAAAAAGGG + Intronic
979250202 4:118559562-118559584 ACTGACACACACAGTAACATGGG + Intergenic
980394878 4:132198865-132198887 ATTGATATACACACAAAGAAGGG + Intergenic
982526076 4:156480598-156480620 ACACACACACACACCCACAAAGG + Intergenic
982681081 4:158431732-158431754 ACTAATAAATACACCAGCAACGG + Intronic
983252451 4:165360176-165360198 ACTCATACACACACCCACACTGG + Intergenic
983405814 4:167328170-167328192 ACTGAAACACACACACACACAGG + Intergenic
984273338 4:177575067-177575089 TCTGAGAGAAACACCAACAAGGG + Intergenic
984879776 4:184400371-184400393 ACTGATACACACAACAACTTGGG - Intronic
986356097 5:6927823-6927845 ACTGATACATACAACCACAGAGG - Intergenic
986890753 5:12301991-12302013 ACTGGAACACACAACAAAAAAGG + Intergenic
987297947 5:16570692-16570714 ACTGATCCACAGACCAACTCTGG + Intronic
987505126 5:18759225-18759247 ACACATACACACACACACAATGG - Intergenic
988443217 5:31256021-31256043 ACACATACACACAGCAAAAAGGG - Intronic
989434005 5:41390160-41390182 ACTGATACATACAACAATATAGG - Intronic
989998608 5:50865295-50865317 TCTGATAGAGACACCAACAGTGG - Intergenic
990160923 5:52939201-52939223 ACTGATAAAAACAAAAACAACGG - Intronic
990351618 5:54922831-54922853 TCTGATGCACACACAAGCAATGG + Intergenic
992842219 5:80707187-80707209 ACTGATACACTCAACAACATGGG - Intronic
994866096 5:105272787-105272809 ACTGATTTACACACAAATAATGG - Intergenic
995041149 5:107589478-107589500 ACACACACACACACCAACAAAGG + Intronic
995665104 5:114533109-114533131 ACAGAGACACACACAAAAAAGGG - Intergenic
997404512 5:133634243-133634265 ATCCCTACACACACCAACAAAGG - Intergenic
998595278 5:143522975-143522997 ACACACACACACACAAACAATGG - Intergenic
998734988 5:145127263-145127285 ACACACACACACACCAAGAAAGG - Intergenic
999285173 5:150390345-150390367 ACTATTACAAACACCAAAAAAGG - Intronic
1000916980 5:167094460-167094482 ATTGATTCACACAACAACATGGG - Intergenic
1004077975 6:12362725-12362747 ACTCATAAACACACTAACAATGG - Intergenic
1005055611 6:21726163-21726185 ACACACACACACACAAACAAAGG + Intergenic
1005902890 6:30234125-30234147 ACTCACACACACACGAACAATGG + Intergenic
1008538393 6:52525465-52525487 ACAGATACACACACACACAGAGG + Intronic
1008541161 6:52547432-52547454 CTTGATACACACACCAGCTATGG + Intronic
1010738934 6:79476419-79476441 ACACACACACACACCAAAAATGG + Intergenic
1013886003 6:114968096-114968118 TTTGATACACACACAAAAAAAGG - Intergenic
1017655516 6:156624808-156624830 ACTGAAACATACAGCAACAATGG - Intergenic
1018181974 6:161231982-161232004 TCTGATACACACATCCACAATGG + Intronic
1018886985 6:167947618-167947640 CCTGATACACAGAGCTACAAAGG + Intronic
1019456606 7:1130824-1130846 GCTCAGACACACACCCACAAAGG + Intronic
1019762257 7:2822047-2822069 TGTGATATACACATCAACAAGGG + Intronic
1020489156 7:8757825-8757847 ACACACACACACACCAAAAATGG + Intergenic
1021051371 7:15989518-15989540 ACTTAAACACGCATCAACAAAGG - Intergenic
1021572387 7:22079461-22079483 ATTAATAAACACACCAAGAAAGG + Intergenic
1021690460 7:23225815-23225837 ACAGACACACACACAAAGAAAGG + Intergenic
1021807349 7:24370639-24370661 ACTGATACACACACACATACAGG + Intergenic
1022177360 7:27884665-27884687 ACTGATACACACACAACAAATGG - Intronic
1022742517 7:33137048-33137070 ACTGATACACCCAAGAACAGAGG - Intronic
1022757261 7:33305387-33305409 TCTGATACCCAAACCAACAAAGG - Intronic
1024476970 7:49822821-49822843 ACTGATACAGGCAACAACATAGG - Intronic
1024720780 7:52135657-52135679 ACAGATACACACACATAAAATGG + Intergenic
1024873887 7:53998828-53998850 ACTGATGCACACTACAACATAGG + Intergenic
1026894881 7:74004216-74004238 ACAGAGACACACAGCAACACCGG - Intergenic
1027530098 7:79319783-79319805 ACTGGTACACACACCATAAATGG + Intronic
1028961749 7:96756442-96756464 ACACACACACACACAAACAATGG - Intergenic
1029311576 7:99671915-99671937 ACATAAACACACACAAACAAGGG + Intronic
1029562500 7:101312287-101312309 AGAGATACACACACCAGTAATGG - Intergenic
1031428199 7:121633548-121633570 ACTGTAACAGACACGAACAAGGG - Intergenic
1034012734 7:147547639-147547661 ACACACACACACAACAACAACGG + Intronic
1034128212 7:148693034-148693056 ACAGAAATACACAACAACAAAGG + Intergenic
1035093788 7:156335388-156335410 ACAGAAACACACACCAAACATGG - Intergenic
1035440308 7:158891678-158891700 ACTTACACACAGAGCAACAATGG - Intronic
1035487975 7:159243534-159243556 ACTGATATAAACAACAACATGGG + Intergenic
1035902803 8:3476267-3476289 ACTGATACACACAACAACATGGG - Intronic
1036731695 8:11271213-11271235 ACGGATACACACACAAACACAGG + Intergenic
1037127697 8:15370740-15370762 TCTGATACACACACCAAGGCAGG - Intergenic
1038652316 8:29416631-29416653 ACTGATACACATAGCAATACGGG + Intergenic
1038747650 8:30268447-30268469 ATTGCTTCCCACACCAACAATGG + Intergenic
1041076333 8:54173479-54173501 TCTTATACACACACACACAAAGG - Intergenic
1041259314 8:56006391-56006413 CCTGATACACATACACACAAAGG + Intronic
1041888677 8:62843886-62843908 ATTGGTACATACACCAGCAAAGG - Intronic
1042130358 8:65581962-65581984 ACTGATACACATACAAATACAGG - Intergenic
1042421988 8:68602278-68602300 ACTAATACACTCCCCAACAATGG - Intronic
1043884839 8:85587290-85587312 ACTGAAGAACAAACCAACAATGG + Intergenic
1044425284 8:92042792-92042814 AATGATACACGCACACACAAAGG + Intronic
1044566712 8:93669959-93669981 ACACACACACACACAAACAATGG + Intergenic
1044607404 8:94059178-94059200 CCACATACACACACAAACAAAGG - Intergenic
1045638799 8:104223811-104223833 ACAGATAGAGACACCAACTACGG - Intronic
1045969978 8:108069176-108069198 ACACATACATGCACCAACAATGG - Intronic
1046238218 8:111455245-111455267 ACACATACACACACATACAATGG + Intergenic
1048314494 8:133352079-133352101 ACTGGGACACACACAAACAGAGG - Intergenic
1050398681 9:5228042-5228064 ACACACACACACACCAAAAAAGG - Intergenic
1051070869 9:13165355-13165377 ACTGATACTCACACATAAAAGGG + Intronic
1051105370 9:13573163-13573185 ACACATACACACACACACAATGG - Intergenic
1051781741 9:20696334-20696356 ACAGACACACACACACACAATGG + Intronic
1052158266 9:25222964-25222986 ACTGCTACACAAAACAACAAGGG + Intergenic
1054846127 9:69800284-69800306 GCTGATAAACACATGAACAAAGG - Intergenic
1055869303 9:80855142-80855164 ACTGTAACACACACCAACTTGGG - Intergenic
1057115129 9:92513623-92513645 ACTGATACACAAAACAAAATGGG + Intronic
1059074205 9:111174074-111174096 ATTGATACACACAGCTACATGGG + Intergenic
1059825756 9:118027122-118027144 ACTAATCCACACTCCCACAATGG - Intergenic
1060306906 9:122421837-122421859 ACTGAGACAGACACCCTCAATGG + Intergenic
1061617319 9:131788752-131788774 ACAGATACACACATGTACAATGG + Intergenic
1062545382 9:137060873-137060895 ACACACACACACACCAATAAAGG - Intergenic
1186401170 X:9261323-9261345 ACTGATACACAGACTAAGACAGG + Intergenic
1186653834 X:11591553-11591575 ACTGATACATACTACAACACGGG + Intronic
1186862776 X:13689509-13689531 ACAGAAACACACACAAACACTGG + Intronic
1187001917 X:15190131-15190153 ACCCATACCCACACCAACAATGG + Intergenic
1187516135 X:19972781-19972803 ACTGATACATACTACAACACAGG - Intergenic
1188699314 X:33238491-33238513 ACACATACACACACAAACAGGGG - Intronic
1189543471 X:42017088-42017110 ATTGATACACAAAACAACATGGG - Intergenic
1189547473 X:42056695-42056717 ACAGATACACACACAGACACAGG + Intergenic
1189550104 X:42084174-42084196 ATTTATACTCCCACCAACAATGG + Intergenic
1189583774 X:42435638-42435660 ACTAATACACATACCCTCAAGGG + Intergenic
1189682363 X:43529793-43529815 TGTGATACAGCCACCAACAAAGG + Intergenic
1190582329 X:51901432-51901454 TGTGATACACACACACACAATGG - Intronic
1191900722 X:66038521-66038543 ACATACACACACACAAACAAAGG + Intronic
1194421372 X:93677728-93677750 CCTGATACACACAACAACATGGG - Intronic
1195541142 X:106064463-106064485 ACAAATACACACTCCCACAATGG - Intergenic
1195616314 X:106915167-106915189 ATTGATACACACAGCTACATGGG - Intronic
1195740169 X:108057074-108057096 ACTGATACACACAGCAACTTGGG + Intronic
1195793262 X:108614102-108614124 ACTGATACACATAACAACATGGG + Intronic
1196607297 X:117671515-117671537 AGTGAAACACACTCCACCAAGGG - Intergenic
1196980011 X:121202419-121202441 ACTGATACCAAAACCAAGAAAGG - Intergenic
1197841498 X:130752359-130752381 ACTGATAGACTAACCAATAAAGG - Intronic
1198038855 X:132828734-132828756 ACACATACACACACAAACATAGG + Intronic
1198116381 X:133549012-133549034 ACTAATACACTCATCATCAATGG + Intronic
1198269952 X:135047370-135047392 ACTAATACTGAAACCAACAATGG - Intergenic
1198308320 X:135404434-135404456 ACTGTGACACACATCCACAATGG - Intergenic
1198495541 X:137188605-137188627 ACACATACACACACACACAAGGG - Intergenic
1198511838 X:137360011-137360033 ACACATACACATACCTACAATGG - Intergenic
1199580035 X:149351636-149351658 ACTGAAACACACACCCACTGGGG - Intergenic