ID: 1152872502

View in Genome Browser
Species Human (GRCh38)
Location 17:82764352-82764374
Sequence AGGAGAAAGCAGGCCGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2072
Summary {0: 1, 1: 2, 2: 28, 3: 276, 4: 1765}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152872502 Original CRISPR AGGAGAAAGCAGGCCGGGTG CGG Intronic
Too many off-targets to display for this crispr