ID: 1152872731

View in Genome Browser
Species Human (GRCh38)
Location 17:82766645-82766667
Sequence CTGTGTAAGTATAACTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152872729_1152872731 27 Left 1152872729 17:82766595-82766617 CCTAGGTGTAGTTTAACAATAAA 0: 1
1: 0
2: 2
3: 10
4: 199
Right 1152872731 17:82766645-82766667 CTGTGTAAGTATAACTGTGTTGG 0: 1
1: 0
2: 2
3: 18
4: 160
1152872730_1152872731 3 Left 1152872730 17:82766619-82766641 CCGTCATTGTTTCTATGTTTTTT 0: 1
1: 1
2: 15
3: 188
4: 2755
Right 1152872731 17:82766645-82766667 CTGTGTAAGTATAACTGTGTTGG 0: 1
1: 0
2: 2
3: 18
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152872731 Original CRISPR CTGTGTAAGTATAACTGTGT TGG Intronic
900234012 1:1577996-1578018 CTCTGTGAGTATAGCTGAGTGGG - Intergenic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
903847957 1:26289695-26289717 ATGTGTAAGTATCACTGTGGGGG + Intronic
905080843 1:35318862-35318884 CTGTGTCAGTTTAAATGTGTAGG - Intronic
905893208 1:41529779-41529801 ATGTGTATGTATGAGTGTGTGGG - Intronic
909069930 1:70981913-70981935 CTGAGTGAGGATAACTGTGGGGG - Intronic
909740289 1:79020315-79020337 ATATGTATGTATAACAGTGTGGG + Intergenic
910316823 1:85895134-85895156 ATGTGTAAGTATGCATGTGTGGG + Intronic
910342614 1:86204922-86204944 GTGTGTAAGCATATGTGTGTGGG - Intergenic
913115706 1:115694707-115694729 CTGTGTAAGTATCCCTAAGTGGG + Exonic
913131746 1:115844257-115844279 CTGTGTGAGTATATCTGTGTAGG - Intergenic
913259804 1:116987871-116987893 CTGCGTAAGAATAACTTCGTGGG - Exonic
914924452 1:151872287-151872309 CTGTGGAAGGATGACTGGGTAGG + Intergenic
916772977 1:167931650-167931672 CTGTGTAATTCAAACTATGTAGG + Intronic
918246841 1:182668040-182668062 CTGTGTAAATAAAACTTTATTGG + Intronic
920902706 1:210127360-210127382 CAGTGTAAGTATGGCTGTGTTGG + Intronic
922365594 1:224860530-224860552 CTTTGTTAGTATAAGTGTGATGG - Intergenic
924278319 1:242410333-242410355 CTGTCCAGGTATAACTGTGTAGG - Intronic
924420897 1:243908726-243908748 TTGTGTAGGAATAACTGTGGTGG + Intergenic
924649522 1:245912607-245912629 TTTTGTTAGTATAACTTTGTGGG - Intronic
1063205677 10:3828540-3828562 CTGTGTGTGTGTGACTGTGTGGG + Intergenic
1066206094 10:33190714-33190736 CTCTGTAAGTATTTCTGAGTGGG + Intronic
1067819994 10:49520042-49520064 CTGTGTACATACAACTGTGCAGG + Intronic
1067956561 10:50797494-50797516 CATTGAAAGTGTAACTGTGTAGG - Intronic
1068387275 10:56347846-56347868 TTAAGTAAGGATAACTGTGTTGG - Intergenic
1070002386 10:72389569-72389591 CAGTGTAAGTAGAATTGTGCAGG + Intronic
1073945489 10:108745287-108745309 ATGTATAGGTATAACTGTATAGG - Intergenic
1074334668 10:112559392-112559414 CTGTCAAAGTATAATTCTGTAGG + Intronic
1074662853 10:115682081-115682103 CTGTGAAAATAAAACTCTGTTGG + Intronic
1076482104 10:130791698-130791720 GTGTGTGAGTGTGACTGTGTGGG - Intergenic
1081628783 11:44673142-44673164 CTGTGTAAATATACATGTGTGGG - Intergenic
1081689280 11:45065790-45065812 CTGTATCTGTATCACTGTGTTGG - Intergenic
1081863374 11:46346841-46346863 CTGTGGAAGGATGACTTTGTAGG + Intronic
1083256231 11:61497229-61497251 GTGTGTAAGTGTATATGTGTGGG + Intergenic
1083686567 11:64379693-64379715 GTGTGTAAGCACAAGTGTGTGGG + Intergenic
1086576013 11:88339817-88339839 ATGTTCAAGTATGACTGTGTTGG + Intergenic
1087119950 11:94563205-94563227 CTGTGTCAGTATGGCTGAGTGGG + Intronic
1091150732 11:133326303-133326325 GTGGGTATGTATAAGTGTGTGGG + Intronic
1091708674 12:2720755-2720777 CTGTGTATGTGTGTCTGTGTGGG - Intergenic
1094366816 12:29691793-29691815 CTGTACAAATAGAACTGTGTTGG + Intronic
1096197974 12:49661088-49661110 AGGTGTAAGTCTAAATGTGTTGG + Intronic
1099612933 12:84898043-84898065 CTGTGTAAATATGACTTGGTTGG + Intronic
1099652580 12:85447136-85447158 CTGTATATGTGTAACTGTGGTGG - Intergenic
1100620545 12:96268077-96268099 CTGTGTCAGTATAAGTAAGTTGG + Exonic
1100917352 12:99440018-99440040 CTGTGTGCGTATCACTGTTTGGG - Intronic
1104395696 12:128430510-128430532 CTGTATAATTATAAGTTTGTTGG - Intronic
1104716153 12:131017655-131017677 CTGTGTTGGTGTATCTGTGTTGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106710936 13:32331807-32331829 GTATGTCTGTATAACTGTGTAGG + Intronic
1108344814 13:49535157-49535179 CTGTGTAAATATACTTCTGTGGG - Intronic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1110289945 13:73793910-73793932 CTGTGTAAATATAACTTCTTGGG - Intronic
1111700028 13:91675587-91675609 CTGTGTGAATATCACTTTGTAGG - Intronic
1112672736 13:101659797-101659819 ATATGTAAGTATATGTGTGTAGG + Intronic
1113272369 13:108687340-108687362 CTGTGTGATTATAATTATGTAGG - Intronic
1114262268 14:21045836-21045858 TTGGGGAAGTATAACTGTGAAGG + Intronic
1114291059 14:21288830-21288852 CAGTAAAAGTATTACTGTGTGGG + Intronic
1117779648 14:59219276-59219298 CTTTGTAGGTAAAATTGTGTGGG + Intronic
1119272572 14:73321811-73321833 CTATGTATGTATATATGTGTAGG + Intronic
1120636455 14:86957616-86957638 CTGTTTAAGAATATATGTGTGGG + Intergenic
1121569704 14:94937820-94937842 CTGTGTGTGTATATCTGTGTGGG + Intergenic
1121648698 14:95539264-95539286 CTGTGTTAGGATACCTGTGTTGG + Intronic
1121883212 14:97518687-97518709 CTGAGTATGTATATATGTGTGGG - Intergenic
1123055876 14:105569847-105569869 GTGTGTGTGTATAACTGTATGGG - Intergenic
1131335632 15:91546075-91546097 CAGTGTGAGTATAAGCGTGTAGG + Intergenic
1131559481 15:93427023-93427045 CTGTGTGAGTGTTACTGTATTGG + Intergenic
1133501746 16:6373115-6373137 GGGTGGAAGTATAACTGTATGGG + Intronic
1135058726 16:19252961-19252983 CTGATTCAGTATAGCTGTGTGGG + Intronic
1135537267 16:23303575-23303597 CTCTGTATATATGACTGTGTAGG - Intronic
1135940216 16:26815840-26815862 TTCTTTAAATATAACTGTGTTGG + Intergenic
1135983419 16:27166356-27166378 CTGAGAAAGCATATCTGTGTGGG + Intergenic
1136664837 16:31801433-31801455 CTGCATATGTCTAACTGTGTGGG - Intergenic
1138380099 16:56594363-56594385 CTGTGAAAATATAAATCTGTTGG + Intergenic
1138706604 16:58921470-58921492 CTGAGTAAGCATAATTGTGATGG - Intergenic
1140164373 16:72534175-72534197 CTATGTAAGTACAAATGAGTTGG - Intergenic
1140357291 16:74317318-74317340 CTGTGTAAGTATGATTGTGATGG + Intergenic
1141741680 16:85897701-85897723 ATTTGTAAGTAAATCTGTGTAGG + Intergenic
1146553541 17:33803329-33803351 CTGTGTATGTGTATATGTGTGGG + Intronic
1149009446 17:51840030-51840052 GTGTTTAAGTATACCTGTTTTGG + Intronic
1151611231 17:75176784-75176806 CTGTGTAACTAAAACAGTCTAGG - Intergenic
1152872731 17:82766645-82766667 CTGTGTAAGTATAACTGTGTTGG + Intronic
1156593231 18:38515990-38516012 CTGTGGTAGCATAACTGTCTGGG - Intergenic
1158089691 18:53696133-53696155 CTGGTGAAGTATCACTGTGTTGG - Intergenic
1158283844 18:55856641-55856663 ATGTGTATATGTAACTGTGTAGG - Intergenic
1160152137 18:76403351-76403373 CTTTGTATGTGTACCTGTGTTGG - Intronic
1161677522 19:5660547-5660569 CTGTATATCTATAACTGTGTAGG + Intronic
1162402057 19:10452566-10452588 CTGTGGACCTATAAGTGTGTTGG + Intronic
1162690713 19:12427944-12427966 CTCTGTAAGCATCACTGTGAGGG + Intronic
1166023530 19:40055880-40055902 CTGTGTGAGTGTCACTGTGCCGG - Intronic
1166963603 19:46514677-46514699 CTGTGTAAGTCTGTGTGTGTAGG - Intronic
925950723 2:8907916-8907938 CAGTGTAAGGATAAGTGTGTTGG - Intronic
930266122 2:49201120-49201142 CTGTGTATTCATAACTGTGCGGG - Intergenic
933090874 2:78114576-78114598 CTTTGAAAGTAGAAATGTGTGGG + Intergenic
935426760 2:102927634-102927656 CTTTGTGAGTATATATGTGTGGG + Intergenic
935660327 2:105461172-105461194 GTGTGTAAGTGTAGCTGTGGTGG - Intergenic
935895845 2:107736629-107736651 CTGTGCAAGTTTGACAGTGTAGG - Intergenic
936482009 2:112892846-112892868 CTGTGTAAGTATGTCTGTTGTGG - Intergenic
941453129 2:165683671-165683693 CTGTGTTAGAACAACTGTCTTGG + Exonic
942723230 2:178977164-178977186 AAGTGTAAGTATAAGAGTGTTGG + Intronic
943354180 2:186831341-186831363 ATGTGTATGTATACGTGTGTGGG + Intronic
945317693 2:208388372-208388394 CTGTGTAATTATAGCTTTGTTGG - Intronic
1171335076 20:24377539-24377561 TTGTGTATGTATATATGTGTGGG + Intergenic
1173345489 20:42195743-42195765 TTGTGTATATATGACTGTGTAGG + Intronic
1173850938 20:46217213-46217235 ATGTGTGAGTATATCTGTGTGGG - Intronic
1174636019 20:52000387-52000409 CTGTTTAAATATAAGTGTCTGGG + Intergenic
1177103204 21:16919933-16919955 ATGTGTAAGTATGACTGTTGAGG + Intergenic
1177216294 21:18133746-18133768 ATGTGTAAGCATCACTCTGTAGG + Intronic
1178388998 21:32183137-32183159 GTGTGTGAGTACAAGTGTGTGGG - Intergenic
1178851027 21:36212494-36212516 TTGTGTAAGTGTAAATGTTTTGG + Intronic
1183366156 22:37408143-37408165 CTGTGTATGTATAAATGTGTGGG - Intronic
1184491729 22:44813834-44813856 GTATGTAAGTCTAAGTGTGTAGG - Intronic
949328073 3:2889531-2889553 CTGTGTATTTTTAACTGTGTAGG + Intronic
952686196 3:36151309-36151331 ATGTGTAACAATAACTTTGTGGG - Intergenic
956061226 3:65350060-65350082 GTGTGTGTGTATAACTGTATGGG - Intergenic
957709442 3:83835921-83835943 GTGTGTAAGGGTATCTGTGTGGG - Intergenic
958089028 3:88851614-88851636 CTATGTAAAAATACCTGTGTAGG - Intergenic
958620362 3:96550682-96550704 CTGTGTAAGAATAACTGAATAGG - Intergenic
959793087 3:110388221-110388243 CTGAGTGAGTATAGGTGTGTGGG - Intergenic
960446335 3:117753462-117753484 GTGTGTACGTATATGTGTGTCGG + Intergenic
961781193 3:129321096-129321118 ATGTGTGAGGATAAATGTGTGGG - Intergenic
965673635 3:171172766-171172788 ATGTGTAAGGAAAACTGAGTAGG - Intronic
966257537 3:177934565-177934587 TTGTGTATTTATAACTGTGCAGG - Intergenic
969410886 4:7027410-7027432 CTGTGTATGTGTAGGTGTGTGGG - Intronic
971496944 4:27276604-27276626 ATGTGTAAGTCTCAGTGTGTTGG - Intergenic
975320140 4:73000759-73000781 TTGTGTAAATATAATTATGTAGG - Intergenic
978202883 4:106043753-106043775 GTGTGTATGTATATCTGTGTGGG + Exonic
978493348 4:109332932-109332954 CTGTGTAAGGTTCTCTGTGTGGG - Intergenic
982477957 4:155876252-155876274 CTGTGTAGTTATATATGTGTTGG - Intronic
982878366 4:160676445-160676467 CTGAGTAAGGATAAATGTGAAGG + Intergenic
984308932 4:178031951-178031973 CTATGTAATTATAAATCTGTTGG + Intergenic
984871570 4:184330008-184330030 CTGTGGCAGGATACCTGTGTTGG + Intergenic
987053532 5:14168452-14168474 CTGTGTAAGTCTCATTCTGTTGG - Intronic
988083392 5:26441815-26441837 GTGTGTATGTGTATCTGTGTGGG - Intergenic
988175705 5:27721992-27722014 CTGTGTAAGAACAACTATTTGGG - Intergenic
991405601 5:66298345-66298367 CTTTGTAATTATTACTTTGTGGG + Intergenic
993920118 5:93791438-93791460 CTGTCTAAAAATAACTATGTAGG + Intronic
995426923 5:112035138-112035160 CTGTGGAAATATAAATATGTAGG - Intergenic
996886460 5:128360946-128360968 CTGTTTAAATCTCACTGTGTGGG - Intronic
998363944 5:141616536-141616558 CTGTGTATGTATACGTGGGTGGG - Intronic
998392652 5:141797287-141797309 CTGTGTGTGGATATCTGTGTTGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1008025582 6:46632322-46632344 CTGTAGAAGTATTATTGTGTAGG + Intronic
1008130748 6:47718260-47718282 CTGTGTAGCTATATCAGTGTGGG + Intronic
1010740243 6:79494283-79494305 CTGTGTAATTTTATCTGTCTTGG - Intronic
1013921124 6:115405030-115405052 ATGTGTAAATATAAATGTATGGG - Intergenic
1015118315 6:129673944-129673966 GTGTGTATGTATTACTCTGTGGG - Intronic
1016039354 6:139416146-139416168 ATGTGTAAGTTTAACAGTTTTGG + Intergenic
1017769022 6:157630776-157630798 CTGTGTAAGGGTATGTGTGTGGG - Intronic
1018553241 6:165022983-165023005 CTGTCTAAGTATTACTCTCTAGG - Intergenic
1020729259 7:11860996-11861018 ATGTGTGAGTATATGTGTGTAGG - Intergenic
1024458403 7:49634582-49634604 CTCTGTAACAAGAACTGTGTAGG - Intergenic
1024872855 7:53985721-53985743 GTGTGTATGTATAAGTGTGCGGG - Intergenic
1029875690 7:103748982-103749004 CTGTTTAAGTGTAACTCTGTGGG - Intronic
1035030880 7:155858385-155858407 CTGTGTGAGTGTAAATATGTGGG + Intergenic
1035291153 7:157839682-157839704 ATGTGTATGTGCAACTGTGTGGG + Intronic
1039784451 8:40820789-40820811 CTGTGTGTGTATATATGTGTGGG + Intronic
1040946122 8:52886354-52886376 GAGTGTAAGCAAAACTGTGTTGG - Intergenic
1042032997 8:64498150-64498172 ATGTGTATGTTTCACTGTGTTGG - Intergenic
1042712190 8:71730526-71730548 CTTTGTGAGAATCACTGTGTTGG - Intergenic
1043716711 8:83496109-83496131 CTGTGTGAGTCTAAGTCTGTAGG - Intergenic
1044087876 8:87963515-87963537 ATGTGTAAGTATATATGTCTAGG + Intergenic
1048674254 8:136759601-136759623 CTGAGTGAGTATATGTGTGTGGG + Intergenic
1049305526 8:141900953-141900975 CTGTGTATGTGTAAGTGTGTGGG + Intergenic
1049647767 8:143743403-143743425 CTCTTTCAGTATAACTGTATGGG + Intergenic
1052592760 9:30519958-30519980 CTCTGTAAGTTAAACTGTCTTGG - Intergenic
1053337699 9:37290757-37290779 CTGTTTCAGAATTACTGTGTGGG + Intronic
1056840328 9:89993666-89993688 GTGTATAAGTATGAGTGTGTAGG + Intergenic
1056910317 9:90694741-90694763 GTGTGTGACTATAAATGTGTGGG + Intergenic
1059387038 9:113972703-113972725 CTATGTAAGTAATAGTGTGTTGG - Intronic
1059786836 9:117595534-117595556 CTGTGTAAGGAATACTGTGGTGG + Intergenic
1061280100 9:129593051-129593073 CTGTGTAAGTATAAATGGAAAGG + Intergenic
1061861373 9:133470221-133470243 GTGTGTATGTATATGTGTGTGGG + Exonic
1186996751 X:15131753-15131775 CTATTTAAGTACAAGTGTGTTGG + Intergenic
1188574658 X:31632340-31632362 CTGTGGAATTGTAAGTGTGTAGG + Intronic
1188707171 X:33348987-33349009 CTGTATTACTATAACAGTGTTGG - Intergenic
1189283439 X:39835309-39835331 ATGTGTAAGTGAAGCTGTGTTGG + Intergenic
1192748645 X:73964949-73964971 CTTTTTAAGTATAACAGTCTTGG + Intergenic
1194633050 X:96310398-96310420 CACTGGAAGTAGAACTGTGTTGG + Intergenic
1196986824 X:121282548-121282570 CTGTGTGAGTATCACTGGGGAGG + Intergenic
1199518394 X:148705215-148705237 CTGTGTAAATGATACTGTGTTGG - Intronic
1201568311 Y:15389146-15389168 CTGTTTAAGGATAGTTGTGTTGG - Intergenic