ID: 1152875111

View in Genome Browser
Species Human (GRCh38)
Location 17:82781944-82781966
Sequence TGCCCTCTGCTGGCAACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 2, 2: 4, 3: 47, 4: 289}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152875111_1152875121 11 Left 1152875111 17:82781944-82781966 CCACCTGTTGCCAGCAGAGGGCA 0: 1
1: 2
2: 4
3: 47
4: 289
Right 1152875121 17:82781978-82782000 CAGCCGGGGCTCCCCAGGGTAGG 0: 1
1: 0
2: 2
3: 28
4: 295
1152875111_1152875116 -4 Left 1152875111 17:82781944-82781966 CCACCTGTTGCCAGCAGAGGGCA 0: 1
1: 2
2: 4
3: 47
4: 289
Right 1152875116 17:82781963-82781985 GGCAGTGGTGCCACGCAGCCGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1152875111_1152875115 -5 Left 1152875111 17:82781944-82781966 CCACCTGTTGCCAGCAGAGGGCA 0: 1
1: 2
2: 4
3: 47
4: 289
Right 1152875115 17:82781962-82781984 GGGCAGTGGTGCCACGCAGCCGG 0: 1
1: 0
2: 3
3: 13
4: 211
1152875111_1152875119 6 Left 1152875111 17:82781944-82781966 CCACCTGTTGCCAGCAGAGGGCA 0: 1
1: 2
2: 4
3: 47
4: 289
Right 1152875119 17:82781973-82781995 CCACGCAGCCGGGGCTCCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 215
1152875111_1152875117 -3 Left 1152875111 17:82781944-82781966 CCACCTGTTGCCAGCAGAGGGCA 0: 1
1: 2
2: 4
3: 47
4: 289
Right 1152875117 17:82781964-82781986 GCAGTGGTGCCACGCAGCCGGGG 0: 1
1: 0
2: 2
3: 9
4: 135
1152875111_1152875120 7 Left 1152875111 17:82781944-82781966 CCACCTGTTGCCAGCAGAGGGCA 0: 1
1: 2
2: 4
3: 47
4: 289
Right 1152875120 17:82781974-82781996 CACGCAGCCGGGGCTCCCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 208
1152875111_1152875126 26 Left 1152875111 17:82781944-82781966 CCACCTGTTGCCAGCAGAGGGCA 0: 1
1: 2
2: 4
3: 47
4: 289
Right 1152875126 17:82781993-82782015 AGGGTAGGTTTCTCTGCATCTGG 0: 1
1: 0
2: 1
3: 11
4: 112
1152875111_1152875127 27 Left 1152875111 17:82781944-82781966 CCACCTGTTGCCAGCAGAGGGCA 0: 1
1: 2
2: 4
3: 47
4: 289
Right 1152875127 17:82781994-82782016 GGGTAGGTTTCTCTGCATCTGGG 0: 1
1: 0
2: 0
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152875111 Original CRISPR TGCCCTCTGCTGGCAACAGG TGG (reversed) Intronic
900152097 1:1183189-1183211 TCCCCTCTGCTGGCTACACGGGG - Intronic
900458035 1:2786801-2786823 TGCCCCCTGCTGGCTGCTGGTGG + Intronic
900968362 1:5975352-5975374 TGGCCTCTGCTGCCCACACGGGG + Intronic
902231013 1:15027676-15027698 GGCCCCCTGCTGGCAGCAGCTGG + Intronic
902528533 1:17075601-17075623 TGCCCTCTGCTGGCAGGGGCGGG + Intronic
903732081 1:25503974-25503996 TGCCCTCTGGTGGCAGCTGGGGG - Intergenic
903853458 1:26321720-26321742 CGCCCTCTGATGGCAGAAGGAGG + Intergenic
904264748 1:29311773-29311795 CACCCTCTGCAGGGAACAGGCGG - Intronic
905245613 1:36611131-36611153 TGTCAGCTGCTGGCAACAGAGGG + Intergenic
906345144 1:45010280-45010302 TGCCCACAGGTGGGAACAGGTGG - Exonic
907268257 1:53275747-53275769 TGCCCTCTCCTGGCAGCACTGGG - Exonic
909329859 1:74398040-74398062 TTACCTCTGCTGGAAGCAGGAGG - Intronic
909902620 1:81157177-81157199 TTCCATCACCTGGCAACAGGAGG + Intergenic
910028681 1:82689281-82689303 TGCCCTCTTCCAGCACCAGGCGG - Intergenic
913160294 1:116139197-116139219 TGCCCTCTGCTGGCAAGAATTGG - Intergenic
915309083 1:154998355-154998377 TGCCCTCTAATGGTCACAGGGGG + Intergenic
915598946 1:156910403-156910425 TGCCCCCTGCTGGTGGCAGGTGG - Intronic
917076033 1:171206172-171206194 TGCCCTGTGCTGGGAACTGGTGG + Intronic
920144524 1:203847483-203847505 TGTCCTCTGCTGGCAACAATGGG - Exonic
920581405 1:207111449-207111471 TTCCCACAGCTGACAACAGGTGG + Intronic
920727596 1:208450743-208450765 TGCTTTCTGCTGGCTACAGCTGG - Intergenic
921820448 1:219610699-219610721 TGTCCTTTGCTGGCAACAATGGG + Intergenic
922867237 1:228870525-228870547 GGCCCTGAGCTGGCCACAGGCGG - Intergenic
922932765 1:229403213-229403235 AGCACTCTGCTGGCCACTGGGGG - Intergenic
922947543 1:229529885-229529907 TGCCCTCTACTGGGAGCAGGTGG - Intronic
1069363099 10:67666615-67666637 TACCCTCTGCTGGCTAAATGAGG - Intronic
1069849361 10:71395367-71395389 TGCCCACTGCAGGCAACGGCTGG - Intergenic
1070078239 10:73159233-73159255 CGCCCTCTGCTGGCAATACGTGG + Intronic
1070671663 10:78381608-78381630 TGTTCTCTGCTGGCGACAGGAGG - Intergenic
1071523406 10:86344837-86344859 GGCTCTCTGCTGGCACCAGGCGG + Intronic
1071529404 10:86377405-86377427 TGCCCCCTGCCGGCAACCGCGGG + Intergenic
1072202856 10:93176767-93176789 TGTCCTGTGGTGGCTACAGGAGG - Intergenic
1073098232 10:100993407-100993429 AGCCCTCTTCTGGCAAAAAGGGG + Exonic
1075863672 10:125698819-125698841 TGGCCCCTGCTGCCAGCAGGAGG - Intergenic
1076720360 10:132389706-132389728 TGGCCTCTCCTGGCCACTGGAGG + Intergenic
1076832221 10:133001391-133001413 TGCTCTCTGCAGATAACAGGTGG + Intergenic
1076978042 11:190122-190144 TGTCCTCAGCTGCCAGCAGGCGG - Intronic
1077056065 11:593781-593803 TGCCCTCTGCTCCCAGCAGCCGG + Intronic
1077793169 11:5462966-5462988 TACCCTCTGCAGGGAATAGGAGG + Intronic
1078169041 11:8914590-8914612 TGCCCTATGGAGGCAGCAGGTGG + Intronic
1081667709 11:44926270-44926292 TGCCTTCGGGTGCCAACAGGTGG - Intronic
1081888775 11:46522565-46522587 TGCCCCCTACATGCAACAGGTGG + Intronic
1082813547 11:57493596-57493618 TGCCCCCTGCTGGTCACAGGAGG - Intronic
1083528833 11:63397994-63398016 TGCCTTGTGCTGGCTTCAGGTGG - Intronic
1083610766 11:64003123-64003145 GGCCATCTTCTGGCCACAGGTGG - Intronic
1084473083 11:69374577-69374599 TGCCCTGTCCTGGGCACAGGAGG - Intergenic
1088598106 11:111454864-111454886 CGCCCCCTGCTGCCAACAGCTGG - Intronic
1088934315 11:114383700-114383722 TTTCCTCTGATGGCATCAGGAGG - Intergenic
1089158908 11:116423140-116423162 TGACCCCTCCTGGCAACAGCTGG + Intergenic
1090203345 11:124871108-124871130 TGCCATCTTCTGGCAGAAGGAGG + Exonic
1090657930 11:128860027-128860049 TGCCCTCGGCAGGCGCCAGGGGG - Intronic
1092492247 12:8956205-8956227 TGCCCTCTCCTGGCACCAGGCGG + Intronic
1092863184 12:12737256-12737278 AGACCTCTGCTGGCTACAGTGGG + Intronic
1093092554 12:14937864-14937886 TGCCATCTGCCAGCAGCAGGTGG + Intronic
1096242546 12:49967135-49967157 CGCCCTCTGCTGGCCAGAGCTGG - Intergenic
1096493496 12:52025817-52025839 TGCCCTCTGCTGGTAACAGGAGG - Intronic
1096669685 12:53191219-53191241 TGCCCTCAGGTGGCAAGAGGAGG + Exonic
1096816979 12:54207970-54207992 TTCCCTCTGCTGGCCAGAGAAGG + Intergenic
1097289854 12:57905530-57905552 TGTCCTCTCGTGGCAAGAGGTGG + Intergenic
1097626371 12:62006315-62006337 TGCCCTCTGCTGGTAAGAAGAGG + Intronic
1103401976 12:120649369-120649391 TGCCCCCTGCTGGAAAAAGCTGG + Intronic
1103699893 12:122843622-122843644 TGCCCAGTGCTGGCAGCAGGAGG - Intronic
1103717317 12:122952489-122952511 TGCCCTCTGCTGGGACCATGAGG + Intronic
1103838328 12:123842068-123842090 GGCCCTGTGCTGCCACCAGGGGG - Intronic
1104048538 12:125181244-125181266 TGCCCACTGATGGCTACTGGTGG - Intergenic
1104416871 12:128602851-128602873 TGCACTTTGCTGGCAGCATGTGG - Intronic
1105899152 13:24741560-24741582 GGCCAGCTGCTGGCAACAGCTGG - Intergenic
1107814592 13:44233024-44233046 ACCCTTCTGCTGGCACCAGGAGG + Intergenic
1110730724 13:78876400-78876422 TGCCCTCTGCTGGCACCAGGTGG - Intergenic
1110980402 13:81890021-81890043 TGCCCTCTGCTGGCACTGGGTGG + Intergenic
1111324863 13:86681322-86681344 TGGCCTCTGCTGGCAACACTAGG + Intergenic
1111822086 13:93227317-93227339 TCCCCTCGGCTGGCAGAAGGGGG + Exonic
1114361466 14:21978359-21978381 CGCCCTCTAGAGGCAACAGGAGG - Intergenic
1114621151 14:24097018-24097040 TGCCCTCTGGTTGGCACAGGCGG - Exonic
1115821827 14:37221279-37221301 TGTCATCTCATGGCAACAGGTGG + Intronic
1115877273 14:37874832-37874854 TGCCCTCTGCTGGCGACATCTGG + Intronic
1117334932 14:54749032-54749054 TGCCCTGTGCTGGAAACTGTGGG + Intronic
1118096942 14:62547251-62547273 TGCCCTCTTCTGGCCCAAGGTGG - Intergenic
1118168627 14:63362513-63362535 AGCCCAGTGCTGGCTACAGGAGG - Intergenic
1118470558 14:66070912-66070934 TGCCCTCTGCTGGAAACTATTGG + Intergenic
1119401038 14:74362489-74362511 TGCCATCTGCTGGCTATATGTGG - Intergenic
1119475054 14:74922439-74922461 TGCTCTCTGCTGGCTCCAGGAGG - Exonic
1119477876 14:74941614-74941636 TGTCCTCAGCTGTCAAAAGGAGG + Intergenic
1119931726 14:78554022-78554044 TGCACTCTGATGGGAACAGATGG + Intronic
1119936150 14:78594040-78594062 TGCCCTCGGCACGCAACAAGCGG + Intronic
1121274150 14:92656477-92656499 GGACCTCTGCTGGAAACAGCAGG + Intronic
1121507237 14:94486435-94486457 TGCCCTCTAGTGGCCACAGGCGG + Intergenic
1122157851 14:99761291-99761313 GGCCCTGTGCTGGCAACCAGAGG - Intronic
1122770284 14:104094813-104094835 CGCCCTCTGCTGGCCACTCGCGG - Intronic
1122915597 14:104856923-104856945 TGCCCCCTTCTGGGAACAAGGGG - Intergenic
1125729175 15:41883190-41883212 TGCCAGCTGCTGCCCACAGGCGG + Exonic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128469137 15:67937402-67937424 TGTCCCCTGTTGGCAGCAGGGGG + Intergenic
1128498409 15:68210976-68210998 TGCCCTCTGCTGGCCACAGCGGG + Intronic
1129624132 15:77179179-77179201 TGCACTCTGAAGGCAGCAGGCGG - Exonic
1132672183 16:1106471-1106493 CACACTCTGCTGGCCACAGGGGG - Intergenic
1133090044 16:3397076-3397098 AGCCCTCTGCTGCCCACAGAAGG - Intronic
1133382733 16:5345001-5345023 TGCCCTTTGCAGGCACCACGTGG + Intergenic
1133797042 16:9054385-9054407 GGCCCTGAGCTGGGAACAGGAGG - Intergenic
1134248513 16:12557878-12557900 GGGCCTCTGCAGGCAACTGGAGG + Intronic
1134672264 16:16064542-16064564 TGCCCTGTGCTGCCAGCAGCCGG + Intronic
1135036983 16:19086636-19086658 CGCCCTCTGCCGGACACAGGCGG - Intergenic
1137275381 16:46929890-46929912 CGCCCCCTGCTGGCGACAGCGGG + Exonic
1137440832 16:48497431-48497453 TGCCCTTTGATGGCAACAAGTGG + Intergenic
1137982132 16:53078942-53078964 TGACCTCTGCAGGCAGGAGGCGG - Intronic
1138234410 16:55369629-55369651 TGCCCTCTACCAGCAAAAGGAGG + Intergenic
1138578881 16:57926646-57926668 TGCCCTGTGCTGGGCACAGGAGG - Intronic
1139464558 16:67147328-67147350 TGTCCCCTGCTGGCACCAGCAGG - Exonic
1140860101 16:79010760-79010782 TCCCCTCTGCTGGCAGCATCGGG - Intronic
1141409947 16:83826264-83826286 TGCCCTCTGCTGGCCACAGATGG - Intergenic
1141547997 16:84785245-84785267 TGTCTTCTGATGGAAACAGGAGG - Intergenic
1141645193 16:85363721-85363743 TGCCCTCTGTTGGCCACCTGAGG + Intergenic
1141768288 16:86072995-86073017 TGCCCTCTGCTGGACAAACGAGG - Intergenic
1142113179 16:88342784-88342806 CGCCCTACGCTGGCATCAGGCGG - Intergenic
1142144864 16:88488691-88488713 TCCCCTCTGCTGGCAGCTGGGGG - Intronic
1142270695 16:89088013-89088035 TGCCCTGTGTCGGCAACAGGAGG - Intergenic
1142465467 17:134587-134609 TGTCCTCAGCTGCCAGCAGGCGG - Intergenic
1142579507 17:932686-932708 TGCCCACTGATGGCAAAAGTCGG - Intronic
1142953348 17:3502872-3502894 CCACCTCTGCTGGCAACAGCTGG - Exonic
1143347490 17:6260709-6260731 TGCCTTCTGCAGGCAGCTGGAGG - Intergenic
1143765541 17:9135214-9135236 TGCCCTTTACTGGCTACAGGAGG + Intronic
1143948626 17:10615922-10615944 TGCCTTCTGCTGGAAAAAGTGGG + Intergenic
1144829125 17:18121860-18121882 TGGTCTCTGCTGGCAGCTGGGGG - Exonic
1145750055 17:27349224-27349246 TGCCCGCTGCTGCCGCCAGGAGG + Intergenic
1145901842 17:28494871-28494893 TGCCCTCCGCAGCCACCAGGGGG + Intronic
1145998135 17:29116061-29116083 TGCCCTCCGGTGGCAGCATGTGG - Intronic
1146627255 17:34444039-34444061 TGCCCTCTCCTGACCACAGAGGG - Intergenic
1146793758 17:35767099-35767121 TGCCCTCTGCTGACACCTGCTGG - Intronic
1147336205 17:39728101-39728123 TGACTTCTGCTGGCATCAAGAGG + Exonic
1148128090 17:45247105-45247127 TGCCCTCTGTGGCCAAGAGGAGG - Exonic
1148695635 17:49556503-49556525 CGCCCTCTGTTGGCCAGAGGCGG + Intergenic
1148864689 17:50622441-50622463 GGCCCTCCTCTGACAACAGGAGG - Intronic
1151006723 17:70446591-70446613 TGCTCTCTGATGACAACAGTAGG - Intergenic
1151582641 17:74988828-74988850 TGTCCTCAGATGGCAACTGGGGG - Intronic
1151832891 17:76565992-76566014 TGCCCTCTGTTGGCAAGGGAAGG + Exonic
1152875111 17:82781944-82781966 TGCCCTCTGCTGGCAACAGGTGG - Intronic
1153381869 18:4449313-4449335 TGCACTCTGCTGGCAAGCAGAGG - Intronic
1153829917 18:8912909-8912931 AGCCATCTGCCGGTAACAGGCGG - Intergenic
1154156478 18:11947956-11947978 GGCCCGCAGCTGGCATCAGGGGG - Intergenic
1154400609 18:14033360-14033382 TGGCCTGTGCTGGCAGAAGGGGG + Intergenic
1155021663 18:21902257-21902279 TTTCCTCTGCCGGAAACAGGGGG + Intergenic
1156506554 18:37599485-37599507 GGGCCTCTGCTGGTAACAGGTGG - Intergenic
1157227450 18:45880135-45880157 TGCCCCCTGCTGGCAGCTGGGGG + Exonic
1157230421 18:45910597-45910619 TGCCCTCTGCTGGAACACGGAGG + Exonic
1158025129 18:52886648-52886670 TTTCCTCTGCTGGGAAAAGGGGG + Intronic
1160970969 19:1767618-1767640 TGCCCTCTGCTGGACACAGCGGG + Intronic
1161788474 19:6343554-6343576 TGCCCTTTGCTCCCAACATGTGG + Intergenic
1161867366 19:6843074-6843096 TGCCCTCTGCTGTCAAGCTGGGG + Intronic
1163152896 19:15425313-15425335 TGACCTCTGCTGGGAGGAGGCGG + Exonic
1163376148 19:16931699-16931721 TGCCCACTGCTGCCAACACTGGG + Intronic
1163632991 19:18426570-18426592 GGCCCTCTGCAGGTCACAGGGGG - Intronic
1164402270 19:27910515-27910537 TGTCCTGTTCTGGCAAAAGGAGG + Intergenic
1164630777 19:29760244-29760266 CGCCCTCTGCTGGCCAGTGGCGG - Intergenic
1166532260 19:43550095-43550117 TCCCCTCTGCTCACAAGAGGAGG + Intronic
925364681 2:3303781-3303803 CGCCCTCTGCTGGCAGACGGCGG + Intronic
925924098 2:8658277-8658299 TGCCCTCTTCTGACAACTGCAGG + Intergenic
926060087 2:9799838-9799860 TGCCCTCTGGTGGCAAGATCTGG - Intergenic
926145715 2:10396221-10396243 TGCCCTGTGCTGGGCCCAGGAGG + Intronic
927225933 2:20766731-20766753 AGCCCCCTGCTGCCATCAGGAGG - Intronic
927664275 2:25019012-25019034 TTTCCTCTGCTGGCAAAATGTGG + Intergenic
927864145 2:26577998-26578020 TGCCCTCTGGTGGATACAGAGGG + Intronic
928088665 2:28360979-28361001 TGCCCTCTGCTTGTAGCTGGTGG - Intergenic
929906506 2:46050697-46050719 TGCTCTTTGCAGGCCACAGGTGG - Intronic
931086499 2:58836891-58836913 TACGGTCTGCTGGAAACAGGTGG + Intergenic
931436846 2:62254976-62254998 TGGCCTCTGCTGGGAACTGAGGG + Intergenic
932891099 2:75598053-75598075 TGCCCTTTGCATCCAACAGGGGG + Intergenic
933239629 2:79905657-79905679 TGCCCTCTGCTAGCAGGAAGGGG - Intronic
933420937 2:82044011-82044033 TGCTCTCTGCCAGCACCAGGTGG + Intergenic
935732667 2:106077149-106077171 TGCCCTGTGCTGGGCACTGGAGG - Intronic
935821731 2:106899970-106899992 TCACCTCTGCTGGGAACATGTGG + Intergenic
936920999 2:117688023-117688045 TGCTCTCTGTTGGCACCAGAGGG - Intergenic
936923013 2:117708378-117708400 TGGCCTTTGCTGGCAAATGGTGG + Intergenic
937288609 2:120768484-120768506 GGCCCGCTGCTGGGAACAGAAGG + Intronic
937342390 2:121099538-121099560 TGCCCTCTGCTGGCATCATCAGG + Intergenic
937908834 2:127065556-127065578 TGCCCTCAACTGCCAACAGTGGG + Intronic
938392706 2:130917529-130917551 TGACCTCTGCAGGCAAGAGAAGG + Intronic
938803945 2:134788592-134788614 TGACCTCAGCGGGGAACAGGTGG - Intergenic
942261397 2:174168102-174168124 TGCCCTGTGTTGGCAACACTTGG - Intronic
942626462 2:177906255-177906277 TGCCCTCTGCTGGTTACAGCAGG - Intronic
944801193 2:203239208-203239230 TGCCCGCTGCGGGCCGCAGGGGG + Intronic
1168799216 20:633739-633761 TGCCCACGCCTGGCAAGAGGAGG - Intergenic
1169113555 20:3048003-3048025 TGCCCTCTGCTGTCACCACTTGG + Exonic
1169114390 20:3054028-3054050 TGCCCTCTGCTGGAGATAAGGGG - Intergenic
1169380315 20:5100926-5100948 TGCCCCCTGGTGGCAGAAGGAGG + Exonic
1171044308 20:21796249-21796271 TGCCCTCTGCTGGGCACCTGGGG - Intergenic
1171962254 20:31503297-31503319 TGCCCTCTGCTGGCAGGAGAGGG + Intergenic
1171962255 20:31503299-31503321 TGCCCTCTCCTGCCAGCAGAGGG - Intergenic
1173815815 20:45987443-45987465 TGCCCCCTGCTGGCAGCAAACGG - Intergenic
1174368624 20:50071442-50071464 CGCCCTCTGCTGGCCAAGGGCGG + Intergenic
1175172374 20:57089789-57089811 TGCCCTCTGCTGGCCGCCGGGGG - Intergenic
1175833826 20:61981156-61981178 TGCCGTCTGCTGGCCACATGGGG - Intronic
1179617829 21:42593414-42593436 GGCCCTCTTGTGGCAACAGAGGG - Intergenic
1180605883 22:17058375-17058397 TGCCCTCTCCTGGCAATGTGAGG + Intergenic
1181421507 22:22802521-22802543 TGCCTCCTGCTGTCCACAGGAGG - Intronic
1181522523 22:23457773-23457795 TCCTCTCTGCTGGCCTCAGGCGG - Intergenic
1181685589 22:24525622-24525644 TGCCCTCCAGTGGCAAGAGGTGG + Intronic
1183321294 22:37166686-37166708 TGCCCTCTGGTGGCAACTTCTGG - Intronic
1183422374 22:37719362-37719384 TGCCCTTTGCTGAGAGCAGGTGG + Intronic
1183521349 22:38297793-38297815 TGCCATCTCTTGGGAACAGGGGG + Intronic
1183620191 22:38967604-38967626 TGCCCTGTGCTGGCTATAGTAGG + Intronic
1184072465 22:42154548-42154570 TCCCCTCTGCTGACACCAGAAGG - Intergenic
950070602 3:10149057-10149079 TGCCTTTTGCTGGCAGCTGGGGG + Intronic
953387825 3:42516590-42516612 TGGCCTGTGCTGGCAGCCGGAGG + Intronic
953770037 3:45772612-45772634 TGCCCTCTGATGCCCGCAGGTGG - Exonic
955478703 3:59366951-59366973 TGTCCTCAGATGGCAAAAGGTGG - Intergenic
955582297 3:60437063-60437085 TGGCCTCTCCTGTGAACAGGGGG - Intronic
956167544 3:66407925-66407947 TGCCCTCTGCTGGCAGATGCAGG - Intronic
957912207 3:86634590-86634612 GGCCATCTGCAGGCAACAGAGGG - Intergenic
957961546 3:87260364-87260386 TGCCCTCTGGTGGCACAAAGTGG - Intronic
958993835 3:100878535-100878557 TGCTCTTTCTTGGCAACAGGAGG + Intronic
960543377 3:118884852-118884874 TGCCCTGTGCTGCCCCCAGGTGG - Intergenic
961330279 3:126134324-126134346 TGGCCTCTGCTGCCATCTGGTGG - Intronic
961452478 3:127008660-127008682 TGCCCCCTCCAGCCAACAGGCGG - Intronic
961591849 3:127987073-127987095 TGACCTCTGCTGGAGCCAGGAGG + Exonic
962036596 3:131658316-131658338 TGGCCTCTGTAGGCAACATGAGG + Intronic
962715123 3:138119065-138119087 TGCCCTCTGCTGCCAAATGCTGG + Intergenic
962932562 3:140051532-140051554 TGCCGTCTGCTGGCTGCAAGGGG + Intronic
963233228 3:142930754-142930776 TGCCCTCTCCTGGAAACAATGGG + Intergenic
964702730 3:159586766-159586788 TGCCCTCTGCTGGAATGATGAGG + Intronic
964874731 3:161353923-161353945 TTCACTCTGCTGTCAACATGAGG - Intronic
965266638 3:166552162-166552184 TGCCCTCTGCTGAAATCAGATGG - Intergenic
968292203 3:197547483-197547505 TGCACTCTGCTGGAAGCAGGTGG + Intronic
968490224 4:886196-886218 TGCCCTCAGCTGGAACCTGGGGG + Intronic
968573971 4:1356375-1356397 CGCCCTCTGCTGGCCCCTGGGGG - Intronic
969823152 4:9735732-9735754 AGCCCTCTGCAGGAAGCAGGTGG - Intergenic
970903473 4:21187529-21187551 TGCCCTCTGCTAGGAACAGAGGG + Intronic
971196783 4:24477618-24477640 TTGCCTGTGCTGGCCACAGGTGG - Intergenic
971211019 4:24616401-24616423 TTCCCTCTTGTGGGAACAGGAGG - Intergenic
971489822 4:27199711-27199733 TGCCCTATGGTGGCATCAGGAGG - Intergenic
972123471 4:35735103-35735125 TTCCCTATGCTGGCAAGAGCTGG + Intergenic
974075402 4:57164171-57164193 TGCCCTCTGCCGGCGACAGTGGG - Intergenic
977225862 4:94390997-94391019 AGCCACCTGCTGGCAAGAGGAGG + Intergenic
977285938 4:95106854-95106876 TGCACTCTGCTGGGATTAGGTGG + Intronic
979259501 4:118634264-118634286 TGCCCTCTGATGGCATCTGCAGG + Intergenic
979551214 4:121993089-121993111 TGCCCTGTCCTGGCATCAGGAGG + Intergenic
983877822 4:172897245-172897267 AGTCCTCTGATTGCAACAGGAGG + Intronic
985819210 5:2148381-2148403 TCCCTTCTGCTGGTGACAGGAGG + Intergenic
986102358 5:4625706-4625728 AGCCCACTGCTGGTAACAGATGG + Intergenic
990986938 5:61649356-61649378 GAGCCTCTGCTGGCAAAAGGTGG - Intronic
991007470 5:61843962-61843984 TTCCCTCTGCTGGAAGCATGAGG - Intergenic
992200471 5:74378911-74378933 GGCCATCAGCTGGAAACAGGTGG + Intergenic
994381569 5:99078150-99078172 TTCCTTCTTCTGGCTACAGGAGG - Intergenic
994653714 5:102562338-102562360 CGCCGTCTAGTGGCAACAGGAGG + Intergenic
995795379 5:115936135-115936157 TGCCTTCAGCAGGCAAGAGGAGG - Intergenic
996655031 5:125925359-125925381 TTATCTCTGCTGGAAACAGGAGG - Intergenic
998127323 5:139633453-139633475 TGCCCTCTGCTGGCCACTCAAGG - Intergenic
999257897 5:150220004-150220026 TGCCCTGTGGTGGCACCAGGTGG + Intronic
999311829 5:150556403-150556425 TCTCCTCTGCTGGGAACAGATGG - Exonic
999318716 5:150600432-150600454 TGCCTTCTTCTTTCAACAGGAGG - Intergenic
999812276 5:155139017-155139039 TGCTATCTGCTGAAAACAGGAGG + Intergenic
1000009830 5:157220534-157220556 GGACCTCTGCTGGCCCCAGGTGG - Intronic
1000578443 5:163006150-163006172 TGCCCTCTGCTGGTAATGGATGG + Intergenic
1001065872 5:168534759-168534781 TGCCCTGTGCTGGGAGCTGGGGG + Intergenic
1001315546 5:170638872-170638894 TGCCCTCTGCTGGTCATAGCTGG - Intronic
1001705444 5:173738015-173738037 GGCCCTGTGCTGGCAACTGAGGG - Intergenic
1003621375 6:7704229-7704251 TGCCTGCTGCTGGAAAAAGGAGG + Intergenic
1003644151 6:7900887-7900909 TCCCCAATGCTGGCAATAGGAGG - Intronic
1003926817 6:10884075-10884097 TGCCTTCGGTTGGCAAAAGGCGG + Intronic
1004534137 6:16483179-16483201 GGCCATCTGCTGGCAAGTGGTGG + Intronic
1007392649 6:41559120-41559142 TGCCCTTTCCTGGCAAAAGGAGG + Intronic
1007926758 6:45655908-45655930 AGCCCTCTGCAGGGAACAGGAGG - Intronic
1008113565 6:47520497-47520519 TGGCCTCCGCTGACAGCAGGGGG + Intronic
1008253150 6:49265171-49265193 CGTACTCTGTTGGCAACAGGTGG - Intergenic
1009565190 6:65303863-65303885 TGTCCTTTGCTGGCAACAATGGG - Intronic
1011553061 6:88547608-88547630 TGCACTCTGCTGGGATCATGGGG - Intergenic
1011748619 6:90433345-90433367 AGCTCTCTCATGGCAACAGGTGG - Intergenic
1013607596 6:111764901-111764923 TCCCCTTTGCTGGCAGCTGGAGG + Intronic
1014329873 6:120049641-120049663 TTTCTTCTGCTGGAAACAGGAGG + Intergenic
1014817662 6:125953219-125953241 TGCCCTCTGCTGGTGCCAGGTGG + Intergenic
1015573679 6:134648310-134648332 TGCCCTGTGCCAGCAACTGGGGG - Intergenic
1015685180 6:135851013-135851035 TGACTCCTGCTGGCATCAGGAGG + Intergenic
1016715471 6:147222728-147222750 TTCCCTCTGCTGGTAGCATGAGG + Intronic
1016834613 6:148464928-148464950 TGCCATCTGCTGGCATCCTGGGG + Intronic
1017410862 6:154166284-154166306 TGCCCTCACCTGGCCACTGGGGG - Intronic
1018062930 6:160104573-160104595 TGCTCTCTGCTGGCACGAGCTGG - Intronic
1018195497 6:161353219-161353241 TGCCCTGGGCTGGTAAAAGGAGG - Intronic
1018440333 6:163806445-163806467 TGGGCTCTGCTGGTAACAGTGGG + Intergenic
1019447114 7:1076992-1077014 GGCCCTCTGCCCGCAACAGCAGG - Intronic
1019979524 7:4611015-4611037 TGCCCTCTGCTGGAAAACTGGGG - Intergenic
1021522452 7:21551368-21551390 TTACCTCTGCTGGAAGCAGGAGG + Intronic
1021698387 7:23295048-23295070 GGTCCTCTGCTGTCAAAAGGGGG + Intergenic
1023131081 7:37003925-37003947 TACCCTCAGTTGGCAATAGGGGG + Intronic
1024326105 7:48110339-48110361 TGCCCTCTGCTGGCTATGTGAGG + Intergenic
1024618535 7:51136775-51136797 AGCCCCCTCCTGGCAACAAGTGG - Intronic
1024696157 7:51858685-51858707 TGTCCTCTGCTGATAACAGGTGG - Intergenic
1026661615 7:72307840-72307862 GGACATCTGCTGGCAAGAGGAGG + Intronic
1027215040 7:76178283-76178305 CTCCCTCTGCAGGCAGCAGGCGG - Intergenic
1027968270 7:85041783-85041805 TGCCCTCTGCTGGCAAGTACAGG - Intronic
1029022680 7:97382019-97382041 TTCCCTCTGGAGGCAAAAGGCGG + Intergenic
1029368584 7:100132791-100132813 TCCCCTCTGGTGGCAAGGGGAGG - Intergenic
1029433047 7:100544590-100544612 TGACCTCTGCTGGGCAGAGGTGG + Intronic
1029893615 7:103958204-103958226 TGCCCTTTCCTGGCAACATATGG + Intronic
1031265149 7:119572227-119572249 GGCCCACTGCTGCCATCAGGAGG - Intergenic
1032109434 7:129062951-129062973 TGCCCTCTCCTGGAATCACGGGG - Intergenic
1033269620 7:139918888-139918910 TTCCCTCTGCTGGTAGAAGGTGG - Intronic
1033278969 7:139992393-139992415 TCCCCTCTGCTGGGAGCTGGCGG - Intronic
1033308717 7:140243672-140243694 TCCTCTCAGCTGGCAAGAGGAGG - Intergenic
1034284359 7:149874418-149874440 TGCCCTTTACTGGCTGCAGGAGG - Intronic
1034543207 7:151772869-151772891 TGCCCTTTGCCCGCAATAGGTGG - Intronic
1035099173 7:156382378-156382400 TCCCCTGTTCTGGCCACAGGTGG + Intergenic
1035790580 8:2300478-2300500 TGCCCTCTGATGCCACCAGAAGG + Intergenic
1035790581 8:2300480-2300502 TGCCTTCTGGTGGCATCAGAGGG - Intergenic
1035802224 8:2421225-2421247 TGCCTTCTGGTGGCATCAGAGGG + Intergenic
1035802225 8:2421227-2421249 TGCCCTCTGATGCCACCAGAAGG - Intergenic
1037950173 8:23014525-23014547 TGACGTCTGCTGCCACCAGGGGG - Intronic
1040416904 8:47203347-47203369 TGCCCTCTGCTGGAGGAAGGAGG - Intergenic
1040621331 8:49096077-49096099 TGCTCTCTGTTGGCGACAGGGGG + Intergenic
1042189984 8:66177039-66177061 TGCCCTCGGCGGCCACCAGGAGG - Exonic
1044277078 8:90313709-90313731 TGCTCTATGCTGGCACCATGAGG - Intergenic
1046487290 8:114903049-114903071 TGCCCTCCGCCTGTAACAGGAGG + Intergenic
1047190322 8:122673631-122673653 TGCCCTCTTCTGGGCACTGGTGG - Intergenic
1047303258 8:123633324-123633346 TGCCCTTTGAAGACAACAGGAGG + Intergenic
1047426546 8:124751733-124751755 TGCCTTCTGTTGCCAGCAGGTGG - Intergenic
1048971419 8:139647061-139647083 CGCCCTCTGTTGGCGGCAGGGGG + Intronic
1049258235 8:141625169-141625191 GTCACACTGCTGGCAACAGGGGG - Intergenic
1049979837 9:893938-893960 TGCCCTCTGCTGGTGACAGCAGG - Exonic
1049990022 9:981763-981785 TGCCGTCTCCTTGCACCAGGGGG + Intronic
1053550437 9:39073755-39073777 TGCACCCTGATGGCAACAGCAGG + Exonic
1053814545 9:41893854-41893876 TGCACCCTGATGGCAACAGCAGG + Exonic
1054143692 9:61547867-61547889 TGCCCCCTCCGGGCACCAGGAGG + Intergenic
1054616051 9:67293586-67293608 TGCACCCTGATGGCAACAGCAGG - Intergenic
1057584565 9:96317538-96317560 TGCCCTCTGCTGGCCACACGTGG + Intergenic
1058875916 9:109244705-109244727 TGCCCTCTGCAGGCCAGAAGTGG - Intronic
1061471925 9:130834057-130834079 TGCCCACAGCTGGAAACAGGCGG - Intronic
1061584712 9:131558297-131558319 TTCCCTCTGCAGGCAAGAGCTGG - Intergenic
1061872543 9:133528524-133528546 TGCCATCTGCTGGGCAGAGGAGG - Intronic
1062442197 9:136575843-136575865 TGGCCTCTGCTGGGAGCTGGGGG + Intergenic
1185465046 X:349458-349480 TTCCCTGTGCTGGGAACAAGAGG + Intronic
1186391906 X:9169325-9169347 TGCTCTCTGCTTGCAAGATGGGG + Intergenic
1188192268 X:27186871-27186893 CGCCCTCTGCTGGTGACAAGAGG + Intergenic
1190176351 X:48153826-48153848 TGGTCTCTGCTGGAGACAGGTGG - Intergenic
1190340495 X:49292052-49292074 TGCCCCCTGCTGGCAAAGGCAGG - Intronic
1190626921 X:52345590-52345612 TGCCCCCTGCTGGCAAAGGTGGG - Intergenic
1190755358 X:53396614-53396636 TTCCCACTGCTGGGACCAGGAGG - Exonic
1192050817 X:67722347-67722369 TTTCCTCTTCTGCCAACAGGAGG + Intronic
1192679709 X:73239377-73239399 TGGCAGCTGCTGGCAACAGCTGG + Intergenic
1196079176 X:111612764-111612786 TTCCTTCTGCTGGCAAGAAGTGG + Intergenic
1199161016 X:144611837-144611859 TGTCCTCTGTTGCCAACAGGAGG - Intergenic
1199676194 X:150191198-150191220 TGCCATCTCCTGGAAAGAGGGGG + Intergenic
1200002013 X:153067051-153067073 TGCCTTCTGCTGGCAATCAGGGG + Intergenic
1200005719 X:153082974-153082996 TGCCTTCTGCTGGCAATCAGGGG - Intergenic
1200114448 X:153764099-153764121 TGCCCTCTGCTGGCCGCAGCGGG - Intergenic
1200948067 Y:8865666-8865688 TGCCCTCCTCTGGCACCTGGAGG + Intergenic