ID: 1152878122

View in Genome Browser
Species Human (GRCh38)
Location 17:82800010-82800032
Sequence CAGAGCAGGGGGATGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1532
Summary {0: 1, 1: 0, 2: 11, 3: 162, 4: 1358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152878122 Original CRISPR CAGAGCAGGGGGATGGGGGC TGG (reversed) Intronic
900145846 1:1158352-1158374 CAGGGCTGGGGGCTGGGGGCTGG + Intergenic
900164877 1:1240629-1240651 ATGAGGTGGGGGATGGGGGCTGG - Intergenic
900179732 1:1305865-1305887 CAGACCAGGAGGGTGCGGGCAGG + Intronic
900181386 1:1312551-1312573 CAGGGCAGGGTGCTCGGGGCAGG - Intronic
900238001 1:1601541-1601563 CAGAGGTGGGAGCTGGGGGCAGG - Intergenic
900244114 1:1629850-1629872 CGGGGCTGGGGGCTGGGGGCTGG - Intronic
900342637 1:2195956-2195978 CCGGGCAGGGGGAGGGGGCCTGG + Intronic
900395656 1:2452288-2452310 CAGGGCCGGGGGATGGGGGGCGG - Intronic
900404052 1:2484751-2484773 CAGAGCAGGGGCATGAGCCCAGG - Intronic
900404587 1:2486878-2486900 CAGAGCAGGGGCATGAGTCCAGG - Intronic
900484433 1:2914719-2914741 CAGAGCAGGATGAGGGAGGCTGG + Intergenic
900488478 1:2934804-2934826 CAGGGCTGGGGGCTGGAGGCCGG - Intergenic
900496584 1:2978610-2978632 GACAGGAGGGGGACGGGGGCTGG + Intergenic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900601378 1:3504145-3504167 CAGAGGAGGGGGCTGGCGCCGGG + Intronic
900623528 1:3598091-3598113 CAGAGATGGGGGAGGGTGGCTGG - Intronic
900644389 1:3702476-3702498 CTGGGCTGGGGGCTGGGGGCTGG - Intronic
900715443 1:4140923-4140945 TAGAGCTGGGGGATGGGGCAGGG + Intergenic
900809038 1:4787296-4787318 CAGAGCAGAGTGATGGGGCTGGG + Exonic
901001120 1:6149212-6149234 CAGAGCCCCGGGCTGGGGGCGGG - Intronic
901004067 1:6163271-6163293 CAGTGCAGGTGGATGGAGGAGGG - Intronic
901032959 1:6319026-6319048 CAGTGAATGGGGTTGGGGGCTGG - Intronic
901059193 1:6464308-6464330 CAGAGCAGGGGCCTGGGGTGGGG - Intronic
901441321 1:9280216-9280238 CAGGGCTGGGCGATGGGCGCCGG + Intergenic
901443960 1:9295625-9295647 CAGAGCTGGGGAATGGGGTGGGG + Intronic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
901754749 1:11434743-11434765 GAGAGCAGGTGGCTGGGGCCTGG + Intergenic
902078652 1:13806235-13806257 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902078664 1:13806268-13806290 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902094265 1:13929701-13929723 CATAGGAAAGGGATGGGGGCTGG + Intergenic
902226458 1:14999491-14999513 CGGGGCGGGGGGAGGGGGGCAGG - Intronic
902232405 1:15036326-15036348 CAGGGCAGGGGGAGCCGGGCGGG - Intronic
902232426 1:15036378-15036400 CAGGGCAGGGGGAGCTGGGCAGG - Intronic
902410408 1:16208587-16208609 CATGGCAGGGGGATAGGGGAGGG - Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902658826 1:17887424-17887446 GAGAGCAGGGGGCTGGGAGAGGG + Intergenic
902664161 1:17925865-17925887 CACAGAGGGGGGAGGGGGGCAGG + Intergenic
902676388 1:18011405-18011427 CAGGGTGGGGGGATGGGGGAGGG + Intergenic
902762015 1:18587428-18587450 CTGAGAATGGGGATGAGGGCAGG + Intergenic
902955935 1:19924076-19924098 CAGAGCAGGAGGGTCGGGGAGGG - Intergenic
903142956 1:21350683-21350705 CAGGGCAGGGGGAAGGGTCCTGG - Intergenic
903318395 1:22526705-22526727 AAGAGCAGTGGGATGGGAGCTGG + Exonic
903334320 1:22614691-22614713 AAGAGCATGGGGATGGGGGCTGG - Intergenic
903543918 1:24111807-24111829 CAGAACAGTGGGATGGGGCAGGG + Intronic
903605224 1:24570670-24570692 CTGAGCAGGGGCCTGGGGGAGGG - Intronic
903790105 1:25886971-25886993 CAGAACAGGGTGGTGGGGACCGG - Intronic
903810172 1:26030957-26030979 CAGAGGTGGGAGATGGTGGCAGG - Intronic
903996457 1:27307966-27307988 GAGAGCAGGAGTATTGGGGCTGG + Exonic
904039921 1:27577762-27577784 CAGGTCAGGGGGAGGGGAGCAGG - Intronic
904285835 1:29452806-29452828 CAGAGCACGGGGATGCAGGAGGG + Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904616588 1:31753425-31753447 AAGAGCACTGGGCTGGGGGCTGG - Intronic
904772171 1:32886537-32886559 CGGGGCCGGGGGATGAGGGCAGG + Intronic
904855070 1:33491571-33491593 ATGAGCAGGAGGAAGGGGGCTGG + Exonic
904964699 1:34362418-34362440 TGGAGCAGTGGGATTGGGGCGGG + Intergenic
905018434 1:34792941-34792963 CAGAGGGGCGGGGTGGGGGCAGG - Intronic
905214537 1:36397619-36397641 CAGAGCAGCGGGAGCGGGTCTGG + Intronic
905245074 1:36607102-36607124 CAGAGCTGGGGTGTGGGGTCAGG - Intergenic
905257858 1:36696619-36696641 CTGAGCAGTGGGATGGAGCCAGG - Intergenic
905299943 1:36980307-36980329 CAGAGCACGGGAAGTGGGGCTGG - Intronic
905309984 1:37042536-37042558 CGGGGCAGGGGGTGGGGGGCTGG + Intergenic
905337677 1:37256713-37256735 GAGAGAAGGAGGATGGGAGCAGG - Intergenic
905356841 1:37390644-37390666 CAGAGCAGGGGACGAGGGGCTGG + Intergenic
905369730 1:37476647-37476669 CTGTGCTGGGGGATGGGGGTGGG - Intronic
905371832 1:37486583-37486605 TAGAGAAGTGGGATGGGGACTGG - Intergenic
905895407 1:41542663-41542685 CAGTGCAAGGGGATGATGGCAGG + Intronic
905932984 1:41802817-41802839 AAGAGCAGGGGGATGGGACTGGG - Intronic
906020026 1:42619792-42619814 GGGAGCAGGTGGATGGGGGGCGG - Intronic
906318862 1:44804596-44804618 CAGAGGAGGGGCATTGGTGCAGG + Intronic
906816253 1:48882770-48882792 CAGAGGCTGGGGATGGGGGTTGG - Intronic
906942823 1:50271314-50271336 AAGGGCAGGGGGTGGGGGGCGGG - Intergenic
907241969 1:53085895-53085917 GAGAGCAGGGGACTGGAGGCAGG + Intergenic
907249786 1:53130484-53130506 GGGAGTGGGGGGATGGGGGCAGG - Intronic
907303705 1:53502731-53502753 GAGAGGAGAGGGAAGGGGGCAGG + Intergenic
907397980 1:54205478-54205500 GGGGGCAGGGGGATGGGAGCTGG - Intronic
907414273 1:54303374-54303396 CAGCCCAGGGGGCAGGGGGCAGG + Intronic
907440425 1:54475081-54475103 CAGAGCAAAGGGGTGGGGCCAGG + Intergenic
907793374 1:57690327-57690349 CAGAGGAGGGGCATGGTGGGGGG + Intronic
907828628 1:58042577-58042599 AAAAGGAGGGAGATGGGGGCAGG + Intronic
907920869 1:58910600-58910622 CAGAGCAGGGTGTGGGGGGATGG - Intergenic
908096723 1:60746862-60746884 CGGGGCAGGGGGATGGTGTCAGG + Intergenic
908833839 1:68208973-68208995 CTGAGTAGAGGGATGGGGACCGG - Intronic
909015332 1:70373900-70373922 CAGAGAAGGGAGATAGGGGTGGG - Intronic
909475236 1:76074664-76074686 CAGTGGATGGGGACGGGGGCGGG + Intergenic
910106475 1:83636448-83636470 CAGAGCAAGGGGATGGAGCAAGG + Intergenic
910207744 1:84764834-84764856 CAGTACAGGGGGATGAGGGAGGG + Intergenic
910288263 1:85577312-85577334 CAAGCCAAGGGGATGGGGGCGGG + Intronic
910394094 1:86774534-86774556 GGGGGCAGGGGTATGGGGGCGGG - Intergenic
910851152 1:91650972-91650994 AAGAGCAGGGAGATGAGGGGAGG + Intergenic
911018271 1:93358505-93358527 CAGAGTGGGGGGATGGGGTGCGG - Intronic
911086111 1:93978703-93978725 CAGAGCAGAGGGAGGGGTGCTGG - Intergenic
911168394 1:94745398-94745420 CAGAGCAGTGGGAATGGGGATGG + Intergenic
911582092 1:99645631-99645653 CTGAGCAGGGGGGTCGGGGGTGG + Intergenic
911642752 1:100306426-100306448 CAGAGCAGGAGGAATGGGGGGGG - Intergenic
911681061 1:100716276-100716298 TAGAGTAGGGGGCTGGGGGAGGG - Intergenic
911811198 1:102284316-102284338 CAGAGCAGGAGGAAGTGGGTGGG + Intergenic
911960825 1:104300862-104300884 CACTGCGGGGGGATGGGGGAGGG - Intergenic
912445148 1:109730068-109730090 CAAAGCAGGGGGGAGGGGGTTGG + Intronic
912511782 1:110194782-110194804 CAGAGCCTGGGCATGGGGGCAGG - Intronic
913111506 1:115661445-115661467 CAGGGCGGGTGGGTGGGGGCAGG - Intronic
913531782 1:119738767-119738789 CAGAGCGAGGGGGTGGGGGAGGG + Intronic
913568885 1:120100816-120100838 CAAAGCAGGGGGCTGTGGGTGGG - Intergenic
914385550 1:147166381-147166403 GAGAGCAGGGGGTTGGGGGGAGG - Intronic
914550738 1:148712590-148712612 CAAAGCAGGGGGCTGTGGGTGGG - Intergenic
914802548 1:150972061-150972083 CAAAACAGGGGGTGGGGGGCAGG + Intronic
915022994 1:152798495-152798517 CAGAGGATGGGGAAGGGGTCAGG + Intronic
915224432 1:154402141-154402163 CAGACCTGGAGGTTGGGGGCAGG + Intergenic
915340676 1:155175061-155175083 CAGAGATGGGGGATGGAGGCAGG + Intronic
915555220 1:156657491-156657513 GAAAGCAGGGGAATGGGGGTGGG - Intronic
915601795 1:156927280-156927302 CAGAGAAAGGGGGTGAGGGCAGG - Intronic
915604241 1:156940728-156940750 CAGGGCATGGGGCTAGGGGCTGG + Intronic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
916415951 1:164592093-164592115 CAGATGAAGGGGATGGGGGTTGG + Intronic
916611357 1:166395141-166395163 CAGAGCTGGGGGAAAGGGGAAGG + Intergenic
916641202 1:166730197-166730219 CAGAGCAGGGGTCAGGGGGAGGG - Intergenic
916717179 1:167455705-167455727 CAGCGCGGGGGCCTGGGGGCGGG - Intronic
917288637 1:173448516-173448538 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
917336797 1:173931918-173931940 CTGAACAGGGGGGTGGAGGCAGG + Exonic
917547142 1:175982862-175982884 CAGAGGTGGGGGATGGGAGTGGG + Intronic
918239498 1:182609372-182609394 GAGAGCTGGGGGATGGCGCCTGG + Intergenic
918271922 1:182910297-182910319 CAGAGCAGGGGATTGGGGGATGG - Intronic
918656809 1:187037010-187037032 ATGAGAAGGGGGATGGGGGAGGG + Intergenic
918750909 1:188268313-188268335 TGGACCAGGGGGATGGGGGTGGG + Intergenic
919067648 1:192713837-192713859 CACTGCTGGGGGATAGGGGCAGG - Intergenic
919130072 1:193440225-193440247 CAAAGAAGGGTGATGGGAGCAGG - Intergenic
919767734 1:201138171-201138193 CAGAGCAGTGGAAGGAGGGCAGG - Intronic
919805920 1:201380979-201381001 CAGAGCATGGGGGTGGGGGTTGG + Exonic
920007924 1:202846883-202846905 CAGAGCAGTGAGATGGGGGAGGG - Intergenic
920106393 1:203556331-203556353 CAGGGTTGGGGGATGGGGGGTGG + Intergenic
920194643 1:204218751-204218773 CAGGAAAGGGGAATGGGGGCTGG - Intergenic
920264552 1:204712110-204712132 CTGAGTAGAGGGATGGAGGCCGG - Intergenic
920311609 1:205052073-205052095 AAGAGCAGTGGGAGGGGGTCAGG - Intronic
920370627 1:205477351-205477373 TAGGGGTGGGGGATGGGGGCAGG - Intergenic
920382500 1:205543581-205543603 CAGAGCTGGGGGAGTGGGGCGGG - Intergenic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
921472062 1:215561551-215561573 CGGAGTAGGGGGATGGCGGCAGG - Intergenic
921826594 1:219678966-219678988 CAGGGCAGTGGGGTGGGGGATGG + Intergenic
922116371 1:222618035-222618057 CAGAGGGGCGGGACGGGGGCGGG - Intergenic
922151436 1:223008184-223008206 CAGAGATGGGGGATGGGGGACGG - Intergenic
922556295 1:226534977-226534999 GAGAGCTGAGAGATGGGGGCGGG + Intergenic
922801539 1:228366897-228366919 CAGTCCAGGGGAAAGGGGGCTGG - Intronic
922822703 1:228494998-228495020 CAGGGCAGGGGGAAGAGGCCAGG - Exonic
922856372 1:228778526-228778548 CAGGGCAGGGGGAGGGGGGAGGG - Intergenic
922875606 1:228937627-228937649 CAGTGCAGGGGGGAGGGTGCTGG - Intergenic
923097722 1:230788732-230788754 CAGAGCATGGTGAGGGGGGAAGG + Intronic
923211135 1:231805474-231805496 CAGAGCAGGAGGAGGGGGGTGGG + Intronic
923546778 1:234929044-234929066 CAGAGCTGGGGGATCAGGGATGG + Intergenic
923907507 1:238401782-238401804 CGGAGCAGGGGGAAGAGGGTGGG + Intergenic
924091686 1:240507778-240507800 CAGAGAAGGAGGGTGGGGGTGGG + Intronic
924384313 1:243487953-243487975 CTGAGCAGGGCGATGGGGCAGGG + Intronic
1062768525 10:82738-82760 CACGGCAGGGCGTTGGGGGCAGG - Intergenic
1062923364 10:1296598-1296620 GAGGGCAGGGGGAAGGGGTCAGG + Intronic
1062931288 10:1354448-1354470 CAGCGAAGGGAGATGGGGGTGGG - Intronic
1062951050 10:1503799-1503821 CAGAGTAGGAGCAAGGGGGCGGG - Intronic
1062958193 10:1554004-1554026 CAGAGCTGAGCGCTGGGGGCAGG - Intronic
1063352985 10:5373686-5373708 CAGAAAAGAGGGATGTGGGCAGG - Intronic
1063455930 10:6182703-6182725 CAGAGCCTGGGTGTGGGGGCAGG + Intronic
1063509972 10:6635194-6635216 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063527204 10:6797184-6797206 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1064531030 10:16309655-16309677 CAGAAAAGTGGGATGGGGGTTGG + Intergenic
1064622164 10:17228179-17228201 GAGACCAGAGGGACGGGGGCGGG + Intergenic
1064887334 10:20124635-20124657 CAGCGAAGGGAGATGGGGGTGGG + Intronic
1065197579 10:23281516-23281538 CGGGGCTGGGGGCTGGGGGCTGG + Intronic
1065214791 10:23439237-23439259 CAGCGCAGGGGGGCGGGGACGGG - Intergenic
1065780461 10:29162054-29162076 CAGAGAAGGGGGAGGGTGGAGGG - Intergenic
1065821981 10:29534160-29534182 CAGGACAGGGGGATGGTGGTGGG - Intronic
1066240823 10:33533225-33533247 CAGCGCAGGGAGATAGGGGTGGG - Intergenic
1067057440 10:43060574-43060596 CACACCAGGTGCATGGGGGCTGG - Intergenic
1067078982 10:43203183-43203205 TAGAGCTGGGGGATGGGGTCAGG - Intronic
1067276025 10:44834780-44834802 CAGGGCAGGGGCAGGGGGCCTGG + Intergenic
1067370888 10:45680599-45680621 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067388889 10:45845546-45845568 CAGAGGCAGGGGATGGGAGCCGG - Intronic
1067417173 10:46111402-46111424 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067445372 10:46339004-46339026 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067502588 10:46818296-46818318 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067592001 10:47521727-47521749 CAGAGGCAGGGGATGGGAGCCGG - Intronic
1067639118 10:48029798-48029820 CAGAGGCAGGGGATGGGAGCCGG - Intergenic
1067659550 10:48224194-48224216 GAGAGCAGAGGGGTGGGGGAGGG - Intronic
1067843445 10:49700202-49700224 CAGAACATGGGAATGGGGCCTGG - Intronic
1067862751 10:49869989-49870011 GAGTGGAGGGGAATGGGGGCAGG + Intronic
1067874365 10:49990497-49990519 CAGAGGCAGGGGATGGGAGCCGG + Intronic
1068464063 10:57364964-57364986 CAGAGACGAGGGATGGGAGCAGG + Intergenic
1068525563 10:58125538-58125560 AAGGGCAGGGGGCAGGGGGCAGG + Intergenic
1068664419 10:59657910-59657932 AAGGTCAGGGGGATGGGGGCTGG + Intronic
1068710684 10:60130207-60130229 CAGAGCTGGGGGAGGGGAGTGGG - Intronic
1068891355 10:62151295-62151317 CAGAGCAGGAGGAAGGGGATGGG - Intergenic
1069591779 10:69646384-69646406 CCGTGCTGGGGGCTGGGGGCTGG + Intergenic
1069745106 10:70710050-70710072 CAGATGCTGGGGATGGGGGCCGG + Intronic
1069885794 10:71622808-71622830 CAGAGGAGAGGGATCGGGGTAGG + Intronic
1069898072 10:71691128-71691150 CTGAGCTGGGAGCTGGGGGCAGG - Intronic
1069898323 10:71692635-71692657 CTGAGCAGGGAGCTGGGGGTGGG - Intronic
1069967869 10:72136565-72136587 ATCAGCAGGGGGATGTGGGCGGG + Intronic
1070136108 10:73695955-73695977 CAGAGGCAGGGGATGGGAGCTGG - Intronic
1070604890 10:77891769-77891791 CACAGCAGGTGGCTGAGGGCTGG + Intronic
1070624931 10:78044280-78044302 GAAAGCAGGGAGATGGGAGCAGG + Intronic
1070649025 10:78221791-78221813 CAGAGGAGAGGGCTGGGGTCAGG - Intergenic
1070751222 10:78965194-78965216 CAGGGGAGGGGGCTGCGGGCAGG - Intergenic
1070751874 10:78968658-78968680 CAGAGCTGGGTAATGGGGCCAGG + Intergenic
1070959484 10:80488554-80488576 GGGAGCAGGGGGATGGCTGCTGG + Intronic
1071064447 10:81614269-81614291 CTGGGCATGGGGATGGGGGTCGG + Intergenic
1071164712 10:82791996-82792018 CAGAGCTGGGGAAAGGGGGATGG + Intronic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1071566581 10:86674371-86674393 GAGTGCTGGGGGCTGGGGGCGGG - Intronic
1072201943 10:93168175-93168197 CAGAGGAGGGGTATGGGGGGAGG - Intergenic
1072534938 10:96355408-96355430 CTGTGCAGGACGATGGGGGCTGG - Intronic
1072614658 10:97041429-97041451 CAGAGTTGGGGCATGGGGGCCGG + Intronic
1072881347 10:99232680-99232702 CAGAGCCGGGCGGTGAGGGCGGG - Intronic
1073012787 10:100374226-100374248 AGTAGCGGGGGGATGGGGGCTGG + Intergenic
1073288554 10:102402384-102402406 CCGGGAAGGGGGCTGGGGGCAGG - Exonic
1073466824 10:103699103-103699125 GACAGCTGGGGGTTGGGGGCAGG + Intronic
1073470386 10:103718473-103718495 CAGGGCAAAGGGCTGGGGGCTGG + Intronic
1073471632 10:103726094-103726116 CAGAGCTGAGGGACGGGGACAGG + Intronic
1073564085 10:104520629-104520651 AAGAGCAGAGGGATTGGGGCTGG + Intergenic
1073690907 10:105808620-105808642 GGGAGTAGGGGGATGGGGGTGGG - Intergenic
1074051220 10:109882808-109882830 CAGATTGGGTGGATGGGGGCAGG - Intronic
1074163908 10:110858243-110858265 CAGATCAGAGCCATGGGGGCTGG - Intergenic
1074190208 10:111128904-111128926 CGGAGCAGGGGGCAGGGGGGAGG - Intergenic
1074432270 10:113404166-113404188 CAGAGCTGGGAGCTGGGAGCTGG + Intergenic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1075711670 10:124534018-124534040 CAGAGTTTGGGGATTGGGGCGGG + Intronic
1075898391 10:126018335-126018357 CAGCCCATGGGGTTGGGGGCAGG + Intronic
1076047259 10:127304175-127304197 CACAGGATGGGGGTGGGGGCCGG + Intronic
1076150094 10:128154803-128154825 CAGAGGAGGGGGCTGGGAGTAGG - Intergenic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1076314413 10:129530790-129530812 GAGAGCTGGGGGATGAGGCCTGG - Intronic
1076318879 10:129564217-129564239 AAGAGGAGGGGGAAGGGGGAAGG - Intronic
1076384365 10:130046084-130046106 CAGGGCATGGGGATGGGGCGGGG + Intergenic
1076461470 10:130650131-130650153 CAGGTGAGGGGGCTGGGGGCGGG + Intergenic
1076481419 10:130787596-130787618 CAGAGCGTGGGGGTAGGGGCAGG - Intergenic
1076521586 10:131084673-131084695 CAGCGCAGGATGATGTGGGCTGG + Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076560474 10:131360097-131360119 CAGTCCAGTGGGTTGGGGGCAGG - Intergenic
1076584641 10:131537256-131537278 CAGAGGCTGGGGGTGGGGGCTGG - Intergenic
1076591579 10:131587248-131587270 CAGACCATGGGGATGTGGTCAGG + Intergenic
1076614454 10:131746672-131746694 CAGAGCTGGGGGGAGGGGACAGG + Intergenic
1076788460 10:132763922-132763944 CAGAGTAGGGGCATGGGCTCTGG - Intronic
1076801926 10:132834966-132834988 CAGAGGAGATGGGTGGGGGCTGG - Intronic
1077058537 11:607700-607722 GGGAGCTGGGGGCTGGGGGCCGG - Exonic
1077155236 11:1088163-1088185 CAGGGCAGGGGGTGGGGGGCTGG - Intergenic
1077298846 11:1838114-1838136 CAGGGCGGGGGCCTGGGGGCTGG + Intergenic
1077334460 11:1997278-1997300 CAGAGGGGCAGGATGGGGGCAGG - Intergenic
1077404130 11:2375243-2375265 CAGAGCCAGGGGAAAGGGGCTGG - Intergenic
1077412620 11:2410659-2410681 CAGTGCAGTGGGGAGGGGGCGGG - Intronic
1077578033 11:3399072-3399094 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1077971136 11:7192426-7192448 CAGGGTGTGGGGATGGGGGCAGG - Intergenic
1077993526 11:7433124-7433146 CAGAGCAGGAGCAAGGGGGGTGG - Intronic
1078042302 11:7879119-7879141 CAGAGCAGGAGGAAGAGGGTGGG + Intergenic
1078106533 11:8361466-8361488 GTGAGCAGGTGGGTGGGGGCTGG - Intergenic
1078622913 11:12925442-12925464 CAGAGGAGGGGCCTGGTGGCAGG - Intronic
1079642977 11:22829844-22829866 CAGTGGAGGGCGGTGGGGGCGGG - Exonic
1079642995 11:22829893-22829915 CAGAGCTGCGGGGTGGGGGCGGG - Intronic
1079867652 11:25756408-25756430 CAGAGCAGGGGGAGTGCGGGAGG - Intergenic
1080107830 11:28529596-28529618 CATAGCAGGGGGTGGGGGGCGGG + Intergenic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1080886964 11:36376499-36376521 CAGAGCTGGGGGAGGAGGGAGGG + Intronic
1081537310 11:44005208-44005230 CCAGGCAGGGGGCTGGGGGCAGG - Intergenic
1081612057 11:44568650-44568672 CACAGTAGGGGGACTGGGGCAGG + Intronic
1082176699 11:49068468-49068490 CAGAGCAGGAGGCTGGGGACAGG - Intergenic
1082196072 11:49307639-49307661 CAGAGCATGAGAATGAGGGCAGG + Intergenic
1083193488 11:61069004-61069026 AAGAGAAGGGGGAAGGGGGAGGG - Intergenic
1083266751 11:61550439-61550461 GAGGGCAGGGGGAGGGTGGCTGG + Intronic
1083278296 11:61609973-61609995 CAGTGCAGAGGGATGGGGGAGGG + Intergenic
1083300802 11:61738825-61738847 CGGGGCAGGGGGCGGGGGGCAGG - Intronic
1083443134 11:62690021-62690043 CAGAGGAGGGGGATGGTGTAGGG - Intergenic
1083547239 11:63558169-63558191 CAGTGCAGTGGGTTGGGGGGTGG - Intronic
1083560765 11:63671372-63671394 CAGAGGAGAGGGACGGGTGCGGG + Exonic
1083665379 11:64271417-64271439 AAGAGCTGGGGAGTGGGGGCGGG + Intronic
1083852228 11:65375086-65375108 CAGAGCAGGAAAATGGGGGCTGG + Intergenic
1084113887 11:67030744-67030766 CTCAGCAGGGAGATGGGAGCTGG + Intronic
1084151530 11:67289873-67289895 CAGAGCCGGGGTCTGGCGGCGGG - Intronic
1084171754 11:67404345-67404367 CAGAGCCAGGGTAAGGGGGCAGG + Exonic
1084182705 11:67454707-67454729 CAGGGCTGGGGGAGGGGGTCTGG - Intronic
1084232772 11:67765243-67765265 CAGTGCAGGGAGATAGGGGTGGG - Intergenic
1084350728 11:68597195-68597217 CAGTGCAGGGGAATGGGTACAGG + Intronic
1084369976 11:68734904-68734926 CAGAGCAGTGAGGTGAGGGCAGG - Intronic
1084403030 11:68956036-68956058 CAGAGTAGGGGTCTGGGGGTGGG + Intergenic
1084499888 11:69529265-69529287 GAAAGCAGGGAGACGGGGGCCGG - Intergenic
1084768491 11:71327471-71327493 CAGAGCAAGGTGCTGGGAGCCGG - Intergenic
1085040799 11:73325222-73325244 CAGGGCAGGAGGCTGGGGGTGGG - Intronic
1085270117 11:75265270-75265292 CAGAGATGGGGGCAGGGGGCGGG - Exonic
1085281153 11:75331670-75331692 CAGTGGAGGGGGATAGGGGTGGG - Intronic
1085297116 11:75437521-75437543 GAAAGCAGGGGGGTGGGGCCAGG + Intronic
1085351861 11:75802811-75802833 CAGAGCAGTGGGAGGAGTGCTGG + Intergenic
1085383202 11:76139242-76139264 GAGAGCAGGGAGCTGGGGCCAGG + Intronic
1085386665 11:76161700-76161722 CAGAGCAGAGGGGAGGGGGTGGG - Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085732761 11:79013440-79013462 CAGTGAAGGGGGTTGGGGGAAGG - Intronic
1085733353 11:79018058-79018080 GAGGGCTGGGGGATGAGGGCTGG + Intronic
1085743814 11:79098222-79098244 CTGAGCTGGGAGATGGGGGGGGG - Intronic
1085946484 11:81278975-81278997 TAGAGATGGGGGATGGGGGAAGG - Intergenic
1086371094 11:86156542-86156564 TAGGGCTGGGGGCTGGGGGCTGG - Intergenic
1086689006 11:89767409-89767431 CAGAGCAGGAGGCTGGGGACAGG + Intergenic
1086699844 11:89888770-89888792 CAGAGCAGGAGGCTGCGGACAGG - Intergenic
1086716850 11:90072551-90072573 CAGAGCAGGAGGCTGGGGACAGG - Intergenic
1087938076 11:104058964-104058986 CAGAGCATGAGGATAGGGGAGGG + Intronic
1088067460 11:105738006-105738028 CAGGGCAGGGGGGTGGGAGGGGG - Intronic
1088613611 11:111602361-111602383 CGGGGCAGGGGGGCGGGGGCGGG - Intergenic
1088618902 11:111662451-111662473 CAGAGCAGGGTAAAGGGGCCAGG + Intronic
1088890708 11:114041953-114041975 CAAAGGAGAAGGATGGGGGCGGG + Intergenic
1089123928 11:116162765-116162787 CCGGGCTGGGGGCTGGGGGCTGG - Intergenic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089207977 11:116780358-116780380 GAGAGCTGTGGGAAGGGGGCTGG - Intronic
1089465115 11:118679882-118679904 CAGAGCATGGTGGTGGGGGTGGG + Intergenic
1089572455 11:119419528-119419550 AAGAGAAGGGGGCCGGGGGCAGG + Intronic
1089618958 11:119711600-119711622 CACAGAAGGGGAAGGGGGGCTGG + Intronic
1089688594 11:120172262-120172284 CAGAGCACCGGGATGGGGAAAGG + Intronic
1090022284 11:123138599-123138621 CAGGGGAGGGGGAGGGGGGTGGG - Intronic
1090062598 11:123477206-123477228 GAGAGGAGGGGGAGGGGGGAGGG - Intergenic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090238548 11:125166144-125166166 CAGAGCAGAGGGCTGGAGGTCGG + Intronic
1090385609 11:126356111-126356133 CAGGGCTGGGGGATTGGGGGCGG - Intronic
1090391778 11:126393467-126393489 AGGAGGAGGGGGATGGGGACGGG + Intronic
1090394107 11:126407700-126407722 CAGAGCGGGGGGGTGGGGAGTGG - Intronic
1090743793 11:129691339-129691361 CTGAGCAGGAGGCTGGGGGAGGG - Intergenic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1090875635 11:130786451-130786473 CACAGCAGGAAGGTGGGGGCAGG - Intergenic
1091213911 11:133887887-133887909 CAGAGCAGGGGAATGGGCAGTGG - Intergenic
1091295151 11:134468567-134468589 CAGTGCAGCGGGCTTGGGGCCGG + Intergenic
1091344879 11:134845940-134845962 CAGTGCTGGGAGATTGGGGCAGG - Intergenic
1091366127 11:135022180-135022202 CAGAGCAGGGTGGTGGTGGCAGG + Intergenic
1202817443 11_KI270721v1_random:52460-52482 CAGAGGGGCAGGATGGGGGCAGG - Intergenic
1091394135 12:143210-143232 CTGGGCTGGGGGCTGGGGGCTGG + Intronic
1091407885 12:220470-220492 CTCAGCACGGTGATGGGGGCGGG - Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1091691122 12:2598235-2598257 AAGGGCTGGGGGCTGGGGGCTGG - Intronic
1092020794 12:5200726-5200748 CAGACCACGGGGTCGGGGGCGGG + Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092259619 12:6946070-6946092 CTGTTCAGGGGGATGGGGCCTGG - Intergenic
1092462420 12:8698179-8698201 GAGAGGAGGGGGAGGGGGTCGGG - Exonic
1092817364 12:12323167-12323189 GAGAGGAGGGGGAGGGGAGCGGG + Intergenic
1093653880 12:21674099-21674121 CAGAGCTGGGGGGTGGGGGTGGG + Intronic
1094679773 12:32657925-32657947 CAGAGCAGGATAAGGGGGGCTGG - Intergenic
1095426642 12:42081536-42081558 GAGAGCAAGTGAATGGGGGCAGG + Intergenic
1095943514 12:47740882-47740904 CAGAGCTGGGGGAGGAGAGCAGG - Intronic
1095999654 12:48118691-48118713 CAGTGGGGAGGGATGGGGGCGGG - Intronic
1096148416 12:49294539-49294561 CAGGGGAGGGGGAGGGGGGCTGG + Exonic
1096191689 12:49623742-49623764 CCGGGAGGGGGGATGGGGGCGGG + Intronic
1096214326 12:49791244-49791266 CGGGGCTGGGGGCTGGGGGCTGG + Exonic
1096520358 12:52181404-52181426 CAAAGCAGAGGGGTGGTGGCTGG - Intronic
1096521576 12:52187488-52187510 CAGAGCAGAGAGAGAGGGGCTGG - Intronic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096649432 12:53054552-53054574 CAGAGTGGTGGGGTGGGGGCGGG + Intronic
1096678924 12:53242075-53242097 CAGTGCAGGAGCATGGGGGTGGG - Intergenic
1096743702 12:53712353-53712375 GAGAGCAGGAGGCTGGGGGATGG - Intronic
1096842146 12:54385919-54385941 CACAGCTGGGGGCTGGGAGCTGG + Intronic
1096864938 12:54556874-54556896 GAGGGCTGGGGGCTGGGGGCTGG + Intronic
1096867029 12:54570743-54570765 CAGAACTGGGGGACGGGGGAGGG - Intronic
1097012502 12:55963251-55963273 CAGAGATTGGGGATGGGGACAGG + Intronic
1097069381 12:56343656-56343678 AAGAGCAGGGAGGTGGGGGAAGG + Intronic
1097178331 12:57156460-57156482 CTGAGTGGGTGGATGGGGGCTGG - Intronic
1097262057 12:57725758-57725780 CCCAACATGGGGATGGGGGCGGG - Intronic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1097544289 12:60979375-60979397 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1097693243 12:62753805-62753827 CAGATAAGGGGGATCAGGGCGGG + Intronic
1097904944 12:64910024-64910046 TAAAGCAGGGGCATGGGGTCTGG + Intergenic
1098391099 12:69970917-69970939 CAGAGCAGGAGGAAGGGAGGGGG - Intergenic
1098558957 12:71851174-71851196 TAGAGCAGGAGGAAGGGGGAGGG + Intronic
1098601895 12:72341281-72341303 AACATCAGGGGGTTGGGGGCTGG - Intronic
1099119333 12:78668425-78668447 CAGGGCAAGGGGATGGGAGGTGG - Intergenic
1099177776 12:79441609-79441631 GAGAACAGAGGGTTGGGGGCTGG - Intronic
1099973594 12:89524921-89524943 CCGGGCCGGGGGCTGGGGGCCGG + Intronic
1101326949 12:103723983-103724005 CAAAGCCAGGGGATGGGGACAGG + Intronic
1101396786 12:104355819-104355841 CAGAACAGGGAGAGAGGGGCAGG + Intergenic
1101880554 12:108622980-108623002 CAGAGCTGTGGAATGGGGTCTGG + Exonic
1101911104 12:108860662-108860684 CAGAGCAGGGGGATTAGGATTGG - Intronic
1102045245 12:109825774-109825796 CAGAGGAGGGGGAAGAGGGCAGG + Intronic
1102245681 12:111354130-111354152 AAGAGCAGGGGGCCTGGGGCAGG + Intergenic
1102277745 12:111597144-111597166 CAGAGAAGGGGAAGGGGGGGCGG + Intronic
1102452986 12:113055627-113055649 CAGAGCAGGGGCCTGGGGAGGGG + Intergenic
1102506126 12:113385488-113385510 CAGAGCAGGGTGGTGTGGGGTGG + Intronic
1102884114 12:116508737-116508759 CAGGGCAGGGGGAACGGGGAAGG - Intergenic
1102904450 12:116663332-116663354 CAGAGCAGGGAGAGGTGGGGAGG - Intergenic
1103361712 12:120358615-120358637 CGGGGCTGGGGGCTGGGGGCTGG + Intronic
1103587149 12:121964410-121964432 CAGAGCTGGAGAATGAGGGCTGG + Intronic
1103613025 12:122135558-122135580 AAGAGCCGGGAGACGGGGGCAGG - Exonic
1103725592 12:122996014-122996036 CAGGGCAGGTACATGGGGGCAGG - Intronic
1103919722 12:124393093-124393115 CAGAGAAGAGGGCTGGGGCCTGG + Intronic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1104134093 12:125921217-125921239 CGGAGCAGGTGGATGGAGTCGGG - Intergenic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1104538085 12:129637540-129637562 CAGACCAGGAGGAAGGGGGTGGG - Intronic
1104551811 12:129764027-129764049 CAAAGCTGGGGCATGGGGGCAGG - Intronic
1104674029 12:130700574-130700596 CAGAGGTGGGGGCAGGGGGCTGG + Intronic
1104745618 12:131208470-131208492 CTAAGCAGGGGGATGGGTGGAGG + Intergenic
1104893393 12:132150809-132150831 CAGGGCAGGGGAGTGGGGGGTGG - Intronic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1104902367 12:132196461-132196483 CCGAGCTGGGGGTTGGGGCCCGG - Exonic
1104915728 12:132263499-132263521 GAGCCCAGGGGGAGGGGGGCAGG + Intronic
1104917709 12:132274416-132274438 CAGAGCAGCAGGCTGGAGGCCGG - Intronic
1104957014 12:132471919-132471941 CAGGGTACGGGGATGGGGCCTGG + Intergenic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105069895 12:133227919-133227941 CTGGGCAGAGGGAGGGGGGCGGG + Exonic
1105205230 13:18217730-18217752 CAGAGCAGGGAGATGGGCCCTGG - Intergenic
1105388964 13:19958451-19958473 CAGACCCGGTGGGTGGGGGCGGG + Intergenic
1106020709 13:25912379-25912401 CAGAGGCTGGGGATGGGGGATGG + Intronic
1106028483 13:25977032-25977054 CAGGGAAGGGGGGTGGGGGTGGG - Intronic
1106328783 13:28719324-28719346 CAGAAGAGGGGAATGGGCGCAGG + Intergenic
1106529960 13:30581488-30581510 CAGAGCTGGGTGGTTGGGGCAGG + Intronic
1106644984 13:31624053-31624075 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1107468129 13:40667063-40667085 CAGGGCAGGGGGCCGAGGGCCGG + Intergenic
1107567217 13:41617630-41617652 CAGGGCGGGGGGCTGGGGGAGGG - Intronic
1108409347 13:50131146-50131168 AAGGGATGGGGGATGGGGGCGGG - Intronic
1108601301 13:51997543-51997565 CAGAAAAGGGGGCTGGGGCCAGG + Intronic
1108706578 13:52993903-52993925 CAGGGGTGGGGGCTGGGGGCTGG + Intergenic
1109220915 13:59640021-59640043 CAGAGCAGGAGGAAGAGAGCAGG - Intergenic
1110319781 13:74148346-74148368 CAGAGAAATGGGATGGGAGCTGG - Intergenic
1110665268 13:78109561-78109583 CAGTACAGGGGAATGGGGGATGG - Intergenic
1111711500 13:91820476-91820498 CAGAGTAGTGGGATGGTGGTGGG - Intronic
1111791249 13:92858312-92858334 AAGAGCAAAGGGATGGTGGCAGG - Intronic
1111942495 13:94625515-94625537 CAGAGGAGGGGGAGCTGGGCAGG - Intronic
1112105095 13:96231499-96231521 CAGAGCAGGAGGAAGGCGGGAGG + Intronic
1112492169 13:99876990-99877012 CAGGGCTGGGGGATGAGGGCAGG - Intronic
1113541996 13:111115872-111115894 CGGGGCAGGGGGAGGGGGCCGGG + Intronic
1113794427 13:113048972-113048994 CAGCCCAGGTGGATGGGGCCTGG - Intronic
1114532519 14:23404664-23404686 CAGAACAGGGGTTGGGGGGCAGG - Intronic
1114547262 14:23512188-23512210 GGGTGCAGGGGGTTGGGGGCTGG + Intergenic
1114616465 14:24071399-24071421 CAGAACCGGGGGAGGAGGGCAGG - Intronic
1114796164 14:25717667-25717689 TGGAGTAGGGGGATGGGGGAGGG - Intergenic
1115093605 14:29607865-29607887 CAGGGCAGGGGTATGTGGGGGGG + Intronic
1116795377 14:49384603-49384625 ATGAGCAGGGTGGTGGGGGCGGG - Intergenic
1117070180 14:52049059-52049081 CACAGCAGGAGGGTGGAGGCTGG + Intronic
1117291074 14:54333542-54333564 AAGGGCCGGGGGATGGGGGGAGG - Intergenic
1117495421 14:56297259-56297281 CAGAGGAGGGTGACAGGGGCTGG + Exonic
1117496668 14:56312492-56312514 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1117776532 14:59189409-59189431 GAGAGCAGGGTGTTGGCGGCCGG + Intronic
1118615558 14:67572384-67572406 TAGAGCTGGGGGATGGGGGCAGG + Intronic
1118709887 14:68510368-68510390 TAGAGTAGGAGGCTGGGGGCGGG + Intronic
1118776884 14:68978899-68978921 CGGGGCTGGGGGCTGGGGGCTGG + Intronic
1118835123 14:69472437-69472459 CAGAACATGGGGGTGGGGACAGG - Intergenic
1119172900 14:72547993-72548015 GTGAGCAGGGGGAGGGAGGCAGG - Intronic
1119318882 14:73717912-73717934 CAGAGCAGAGGCAAGGAGGCTGG + Exonic
1119643411 14:76330798-76330820 CAGGTCTGGGGGATGGGGGCAGG + Intronic
1119728356 14:76935846-76935868 CAGGGCTGTGGGCTGGGGGCTGG - Intergenic
1119779670 14:77269808-77269830 CAGCGCAGGGGGGGGGGGGGGGG - Intronic
1119788069 14:77327360-77327382 CAGGGAAGGGAGATGGGGGTGGG + Intronic
1119886976 14:78151585-78151607 CAGAGCAGGGGACTGAGGGTGGG - Intergenic
1120095197 14:80380529-80380551 CAGAGCTGGGGTATGGAGCCAGG - Intronic
1120188323 14:81417276-81417298 CAGAGCTGGGGGCCGGGGGCGGG - Intronic
1120369728 14:83617660-83617682 TGGAGCAGGAGGAAGGGGGCTGG + Intergenic
1120625978 14:86827054-86827076 GAGGGCAGGGGGTGGGGGGCAGG + Intergenic
1120745492 14:88147440-88147462 CAGGCCAGGAGGTTGGGGGCTGG + Intergenic
1121102188 14:91257507-91257529 TAGAGTAGGGGGATGGAGACTGG - Intergenic
1121405630 14:93717703-93717725 CAAAGCAGCGGGGTGGTGGCGGG + Intergenic
1121604290 14:95229237-95229259 GTGAGAAGGGGGATGGGAGCAGG - Intronic
1121732173 14:96194484-96194506 CAGAGGGTGGTGATGGGGGCTGG + Intergenic
1122056575 14:99102468-99102490 CAGAGCAGGAGGAAGAGGGAGGG - Intergenic
1122117947 14:99536951-99536973 CAGGGCAGAGGGCTGGGGGAAGG + Intronic
1122130464 14:99602225-99602247 CTGAGCAGGGGGCTGGGAGAGGG + Intronic
1122295067 14:100700847-100700869 CCGGGCAGGGGGAAGGGAGCTGG + Intergenic
1122349782 14:101082282-101082304 CAGAGCTGGGGGCTTGGGGGAGG + Intergenic
1122366805 14:101199221-101199243 CTGGGCAGGGGGCAGGGGGCAGG + Intergenic
1122437407 14:101709508-101709530 CAGGGGTGGGGGATGGGGGAGGG + Intergenic
1122480424 14:102043550-102043572 GAGAGGAGGGGGATTGTGGCAGG + Intronic
1122630110 14:103103910-103103932 CAGGGCAGGGGGCTGGGGGCGGG - Intronic
1122643992 14:103179416-103179438 CAGAGCTGGGGGCTTGGGGGAGG + Intergenic
1122809564 14:104281336-104281358 GTGAGCAGGGGGAGGGCGGCAGG - Intergenic
1122822538 14:104354795-104354817 GGGGGCAGGGGGCTGGGGGCAGG + Intergenic
1122822546 14:104354809-104354831 GGGGGCAGGGGGCTGGGGGCTGG + Intergenic
1122822558 14:104354830-104354852 GGGGGCAGGGGGCTGGGGGCTGG + Intergenic
1122822574 14:104354858-104354880 GGGGGCAGGGGGCTGGGGGCTGG + Intergenic
1122822609 14:104354921-104354943 GGGGGCAGGGGGCTGGGGGCTGG + Intergenic
1122822634 14:104354963-104354985 GGGGGCAGGGGGCTGGGGGCTGG + Intergenic
1122826287 14:104372393-104372415 GATAGGAGGGGGATGGGGGCTGG + Intergenic
1122875146 14:104660480-104660502 AAGTGCAGGGGGGTGGGGGCAGG - Intergenic
1122910606 14:104826127-104826149 CAGAGCAGGGGGATATGCGGGGG + Intergenic
1122969821 14:105147979-105148001 CAGACCCGGGGGCAGGGGGCAGG + Intronic
1123029866 14:105446553-105446575 CAGAGCAGGGGGAGGTTGCCTGG - Intronic
1123042258 14:105495274-105495296 CAGAGAAGGGGGACTGGGTCTGG - Intronic
1123054356 14:105562091-105562113 CAGGGCACGGGTCTGGGGGCTGG + Intergenic
1123078940 14:105682510-105682532 CAGGGCACGGGTCTGGGGGCTGG + Intergenic
1123154368 14:106210147-106210169 CAGAGCGGGTGGAAGGAGGCTGG - Intergenic
1124042040 15:26114511-26114533 TAGAGCAGGCGGTTGGGGGTTGG - Intergenic
1124177687 15:27441664-27441686 CAAATCAGGGGGATTGGGGGAGG + Intronic
1124378431 15:29143553-29143575 CAGAGAAGGGCCGTGGGGGCTGG + Intronic
1124630263 15:31332464-31332486 TGGAGCAGTAGGATGGGGGCTGG + Intronic
1125091094 15:35793757-35793779 CAGGGTTGGGGGATTGGGGCAGG - Intergenic
1125766457 15:42139798-42139820 AAGGGCAGGGGGCAGGGGGCAGG - Exonic
1125832604 15:42727568-42727590 CAGAGCAGGGGGGTGGGAGCAGG + Intronic
1125874977 15:43136026-43136048 AAGGACTGGGGGATGGGGGCAGG - Intronic
1126835414 15:52659078-52659100 AAGAGCTGGGGGTTGGGGGTAGG - Intronic
1127313868 15:57776639-57776661 GAGAACAAGGGGTTGGGGGCAGG + Intronic
1127395718 15:58542505-58542527 GACAGCAGCGGGATGGGGGCAGG - Intronic
1127554897 15:60078251-60078273 GACAGCAGGGGGACGGTGGCAGG - Intergenic
1128035247 15:64519114-64519136 CAGGGCGGGGGGCGGGGGGCGGG + Intronic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128156887 15:65396760-65396782 TAGAGCAGGGGGAGGTGGACGGG - Intronic
1128186083 15:65644545-65644567 GACAGCAGGGAGAGGGGGGCAGG - Intronic
1128254131 15:66184782-66184804 AAGAGAAGGGGGTTGGGGGTGGG - Intronic
1128354920 15:66919358-66919380 CTGAGCAGGGGCAAGGAGGCAGG + Intergenic
1128478060 15:68014155-68014177 CAGAGTAGGGGGATGTGGGAAGG - Intergenic
1128512161 15:68319893-68319915 CAGAGGAGGAGTCTGGGGGCAGG + Intronic
1128726288 15:69990806-69990828 CAGGGTAGGGGGCTGGGGGGAGG + Intergenic
1128743725 15:70099564-70099586 CAGAGAAGGGGGAGGGGGAAAGG - Intergenic
1129231827 15:74201343-74201365 CAGAGCAGGGAGATAAGGGATGG + Intronic
1129250223 15:74304677-74304699 CAGGGCTGGGGGCTGGGGGTGGG - Intronic
1129385555 15:75194251-75194273 CAGAGCAGAGAGATGTGGCCAGG + Intergenic
1129596959 15:76973067-76973089 CAGAGCAGATGGGTGGGGACTGG - Intergenic
1129602436 15:77008071-77008093 CAGAGCTGGGGGTGGAGGGCGGG + Intronic
1129697028 15:77746595-77746617 CAAGGCTGGGGGCTGGGGGCTGG + Intronic
1129852125 15:78799310-78799332 CAGAGCTGGGAGAGTGGGGCTGG + Intronic
1129960768 15:79682053-79682075 CAGCACTGGGGGATGGTGGCTGG + Intergenic
1130250878 15:82299777-82299799 CAGAGCTGGGAGAGTGGGGCTGG - Intergenic
1130889318 15:88119941-88119963 CAGAGCAGGGGAATTGGTACTGG - Intronic
1131294925 15:91139452-91139474 CAGAGCTGGGAAATGGAGGCAGG + Intronic
1131569959 15:93524648-93524670 AAGAGCAGGTGGATGGTGGCCGG - Intergenic
1131920630 15:97324176-97324198 CAGAGAAGTGGGATGGGAGGTGG + Intergenic
1132055632 15:98648839-98648861 CAGAGCAGGCGGCGGCGGGCGGG + Intergenic
1132281207 15:100617476-100617498 CAGAGCAAGGTGATGGGGCAGGG - Intronic
1132310462 15:100853915-100853937 CATAGCAGGGAGCTGGGGGCAGG - Intergenic
1132340914 15:101078170-101078192 CAGTGCAGGGAGATGGGGGTGGG - Intronic
1132513420 16:354756-354778 CAGAGCAGGTGGGCAGGGGCTGG + Intergenic
1132663958 16:1073252-1073274 CGGAGCCTGGGGCTGGGGGCCGG + Intergenic
1132890105 16:2199606-2199628 CAGAGGAAGGGGCTGCGGGCTGG - Intergenic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133033272 16:3021569-3021591 CAAAGCAGCCGGAAGGGGGCAGG - Exonic
1133040810 16:3059039-3059061 AGGAGCAGCGGGATGGGAGCAGG - Exonic
1133041785 16:3064856-3064878 CTCAGCTGGGGGAAGGGGGCTGG + Intergenic
1133069418 16:3235621-3235643 GAGAGTAGGGGGGTGGGGGGTGG - Intronic
1133069457 16:3235689-3235711 GAGAGTAGGGGGGTGGGGGTTGG - Intronic
1133209834 16:4257452-4257474 CAGAGGTGGGGGCTGGGGGGTGG + Exonic
1133484813 16:6209604-6209626 TAGGGCAGGAGGATGGTGGCAGG - Intronic
1133721949 16:8502838-8502860 TGGAGCAGGGGGAAGGGAGCAGG - Intergenic
1134028965 16:10976752-10976774 CAGGGCAGGGGCCTGGGGGAGGG + Intronic
1134063050 16:11210568-11210590 GAGGGCAGGGGGCTGGTGGCGGG + Intergenic
1134066432 16:11231520-11231542 GCAAGCAGGGGGATGGGGCCAGG + Intergenic
1134068538 16:11246129-11246151 CTGGGCAGGGGTGTGGGGGCAGG - Intergenic
1134781019 16:16895698-16895720 CGGGGCCGGGGGAGGGGGGCGGG - Intergenic
1135573274 16:23565846-23565868 GGGCGCAGGGGGAGGGGGGCAGG - Intronic
1135994368 16:27237288-27237310 GTGAGCAGGGGCATGGAGGCAGG - Intronic
1136038957 16:27562891-27562913 AAGAGCAGGGGGAAGGGATCAGG + Intronic
1136044004 16:27601483-27601505 CGGGGCAGGGGGAGTGGGGCGGG + Intronic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136365087 16:29806197-29806219 GTGGGCAGGGGGGTGGGGGCGGG - Intronic
1136381196 16:29896792-29896814 GACAGCAAGGGGATGGGGGTGGG - Intronic
1136412665 16:30086166-30086188 CAGGGCTGGGGGAAGGGAGCGGG + Exonic
1136421317 16:30135317-30135339 CAGAGCTGGAGGCTGTGGGCTGG + Intergenic
1136428980 16:30186229-30186251 CAGGACAGGTGTATGGGGGCTGG - Intronic
1136685893 16:31994765-31994787 GAGAGGAGGGGCATGGGGACAGG - Intergenic
1136786502 16:32938297-32938319 GAGAGGAGGGGCATGGGGACAGG - Intergenic
1136883266 16:33915497-33915519 GAGAGGAGGGGCATGGGGACAGG + Intergenic
1136985780 16:35103024-35103046 CAGAGCAGTGGGGAAGGGGCAGG - Intergenic
1137018418 16:35398260-35398282 CAGACCAGTGGCATGGGGGAGGG - Intergenic
1137607036 16:49793757-49793779 CAGAGCGGAGGCATGAGGGCAGG + Intronic
1137617530 16:49856334-49856356 CTGAGGAGGGGGAACGGGGCTGG + Intronic
1137665266 16:50246031-50246053 CGGGGCGGGGGGCTGGGGGCTGG - Intergenic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1138370862 16:56525257-56525279 CAGAGCAGGCGGAACGGGGCTGG + Intergenic
1138589045 16:57989721-57989743 CAGAGGCGGGGGATGGGGATGGG - Intergenic
1138647323 16:58434749-58434771 CTGATCAGGGGGATGGGTGCTGG - Intergenic
1138658020 16:58501755-58501777 CACCTCAGGGGGATGGGGACAGG + Intronic
1138851989 16:60640757-60640779 GAGGGCTGGGGGATGGGGGTGGG + Intergenic
1138961381 16:62034515-62034537 CAGATCCGAGGGATGGGGGCTGG - Intronic
1139375054 16:66491641-66491663 CAGGGTGGAGGGATGGGGGCGGG + Intronic
1139590543 16:67930666-67930688 CAGTGCAGGTGGGTGGGTGCTGG - Intronic
1139594418 16:67949761-67949783 CAGGGCAGGGGGATGGGGAAAGG - Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139652469 16:68369395-68369417 CAGAGGAGGGAGGTGGGGACAGG + Intronic
1139672212 16:68499630-68499652 GGGGGCAGGGGGCTGGGGGCAGG - Intergenic
1139851339 16:69952782-69952804 CAGGGCAGGGTGGTGGGGGCGGG + Intronic
1139880316 16:70175694-70175716 CAGGGCAGGGTGGTGGGGGCGGG + Intronic
1140072451 16:71663023-71663045 CAGAGCCTGGGGATGGGGCTAGG - Intronic
1140277501 16:73523585-73523607 CAGTGCTGGGGGTAGGGGGCAGG + Intergenic
1140372194 16:74419823-74419845 CAGGGCAGGGTGGTGGGGGCGGG - Intronic
1140741862 16:77948583-77948605 CAGGGAAGGAGTATGGGGGCAGG - Intronic
1141132465 16:81445211-81445233 CGGGGGAGGGGGCTGGGGGCGGG - Exonic
1141434762 16:83993752-83993774 CAGGGCCGGGAGATGGGGCCAGG + Intronic
1141637288 16:85321017-85321039 AAGATCGGGGTGATGGGGGCAGG - Intergenic
1141647800 16:85376767-85376789 GAGAGCAGGGGGCTGGGGCTGGG + Intergenic
1141900400 16:86987036-86987058 CAGAGGAGGGGGCTGGGGCCAGG - Intergenic
1142051284 16:87959819-87959841 GAGAGCAGGGCGATGAGGGTGGG + Intronic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142116406 16:88358294-88358316 CACACCCGGGGGAGGGGGGCTGG + Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1203088738 16_KI270728v1_random:1199964-1199986 GAGAGGAGGGGCATGGGGACAGG - Intergenic
1142476761 17:193510-193532 CCGAGCAGGGGCGTGGTGGCTGG - Intergenic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1142740734 17:1930546-1930568 GAGAGGAGAGAGATGGGGGCGGG + Intergenic
1142799665 17:2337425-2337447 CAGCGACGGGGGATCGGGGCGGG - Exonic
1142864075 17:2779785-2779807 CAAGGCAGGGGGCTGGGGGGGGG + Intronic
1142868824 17:2807729-2807751 GAGTGCAGGGGGCTGGGGGAAGG + Intronic
1142880612 17:2880068-2880090 GGGAGCAGGGGGCTGGGAGCAGG + Intronic
1142966563 17:3585548-3585570 CTGAGAAGCGGGAAGGGGGCGGG + Intronic
1143030305 17:3963978-3964000 CGGGGCTGGGGGCTGGGGGCTGG - Intronic
1143092634 17:4458008-4458030 CAGAGCCAAGGGGTGGGGGCGGG - Intronic
1143201383 17:5115931-5115953 TAGCGCCGGGGGATCGGGGCGGG + Intronic
1143216278 17:5227575-5227597 GAGAGAAGGGGCTTGGGGGCAGG + Intronic
1143274028 17:5696638-5696660 CTGGGCAGGTGCATGGGGGCGGG - Intergenic
1143282504 17:5765354-5765376 CAGAGCAGGGGGTTGGAGTCAGG + Intergenic
1143292118 17:5839163-5839185 GAGAGCAGGGGGAATGGGGTTGG + Intronic
1143329362 17:6122043-6122065 CAGAGCAGGACCATGGGGCCTGG - Exonic
1143637895 17:8176804-8176826 CAGAGGAGGGGAAGGGGAGCGGG - Intergenic
1143705938 17:8697704-8697726 GGGAGCAGGGAGCTGGGGGCGGG + Intergenic
1143751068 17:9028232-9028254 GAGAGGAGGTGGATGGGGGATGG + Intronic
1143870479 17:9954459-9954481 CAGTGATGGGGGATGGGGGGTGG + Intronic
1144027591 17:11292277-11292299 CAGAGTAGGGGGAAAGGGGAGGG - Intronic
1144092732 17:11872364-11872386 CATTGCAGGGGGTGGGGGGCGGG - Intronic
1144201477 17:12946244-12946266 CAAGGCAGGGGTTTGGGGGCAGG - Intronic
1144621499 17:16821379-16821401 GGGAGCAGGGGGGAGGGGGCTGG + Intergenic
1144681764 17:17200673-17200695 CAAGGAAGGGGGAAGGGGGCAGG + Intronic
1144816878 17:18040633-18040655 CAGAGCAGGGGCAGGAGGCCTGG - Intronic
1145013197 17:19381520-19381542 CAGGGCCGGGGCATGGTGGCGGG - Exonic
1145978500 17:28997956-28997978 CAGAGCCTGGGGGTGGGGGCAGG - Intronic
1145978886 17:28999817-28999839 CAGAGCAGAGTGATGTGGGGTGG - Intronic
1145982380 17:29020552-29020574 TGGGGCAGGGGGGTGGGGGCTGG + Intronic
1145994234 17:29096427-29096449 CAGAGCTGGGGGCTGAGGGCAGG + Intronic
1146178063 17:30679474-30679496 CAGAGGGGGAGGATGGGGGGAGG + Intergenic
1146514132 17:33475798-33475820 CAGGGGATGGGGATGGGGGAGGG - Intronic
1146685836 17:34841075-34841097 CAGGGCTTGGGGATGGGGGTGGG + Intergenic
1146884895 17:36464276-36464298 CTGAGCCTGGGGTTGGGGGCGGG + Intergenic
1147146849 17:38490429-38490451 GAGAGGAGGGGCATGGGGACAGG - Intronic
1147193445 17:38749815-38749837 CACACCAGCGGGACGGGGGCGGG + Exonic
1147213567 17:38886279-38886301 CAGGGCTGGGGGCTGGGGACTGG + Intronic
1147316198 17:39621614-39621636 CAGGGCAGGTGGGTGGGGGCAGG - Intergenic
1147329418 17:39688167-39688189 CACAGCAGGGGGACGAGGGGCGG - Intronic
1147359779 17:39923375-39923397 CTGGGCAGGGGGATATGGGCTGG + Intronic
1147465523 17:40607811-40607833 CGGAGCGGGGGGTTGGGGGAGGG + Intergenic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147592830 17:41695914-41695936 CAGCGTGTGGGGATGGGGGCAGG - Intergenic
1147924166 17:43936347-43936369 AAGAGCTTGGGGATGGGGGCTGG + Intergenic
1147945560 17:44078349-44078371 AAGCCCAGAGGGATGGGGGCCGG + Exonic
1147997334 17:44367839-44367861 AGGAGATGGGGGATGGGGGCAGG - Intergenic
1148029203 17:44608327-44608349 GAGGGCTGGGGGCTGGGGGCTGG + Intergenic
1148196189 17:45715087-45715109 CAGAGCAGGGGCAAGGGGCAGGG + Intergenic
1148281825 17:46354267-46354289 CAGAGGAGGAGGTTGGGGGTAGG - Intronic
1148304050 17:46572206-46572228 CAGAGGAGGAGGTTGGGGGTAGG - Intronic
1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG + Intronic
1148454545 17:47804011-47804033 CAGCCCAGGGGGATGTGTGCAGG - Intergenic
1148581141 17:48744849-48744871 CAGAGGAGGGGGTTGGGTGGGGG + Intergenic
1148640428 17:49183604-49183626 GAGGGCTGGGGGCTGGGGGCTGG - Intergenic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148797538 17:50204210-50204232 CAGACTGGGGGGATGGGGGGTGG + Intergenic
1148814714 17:50319226-50319248 CAGAGCGGGGTGGTGGGGGTGGG + Intergenic
1148889945 17:50800175-50800197 CATAGCAGGGGCATGCGGACCGG + Intergenic
1148889960 17:50800244-50800266 CAGAGGAGGGGGCTTGGGGAAGG + Intergenic
1148988829 17:51647544-51647566 CAGTGCTGGGGGATGGGTGGTGG + Intronic
1149313996 17:55421869-55421891 CAGACCGGGCGGCTGGGGGCGGG + Exonic
1150132002 17:62674441-62674463 GAGAACAGGGAGGTGGGGGCTGG + Intronic
1150250553 17:63702059-63702081 TAAAGCAGGGGGAGGAGGGCCGG + Intergenic
1150677284 17:67255423-67255445 CATGGCAGGGGGATGGGGGGGGG - Intergenic
1151087622 17:71398802-71398824 AACAATAGGGGGATGGGGGCAGG - Intergenic
1151116474 17:71740971-71740993 CAGAGCTGGGGGAAGGGGAGAGG - Intergenic
1151155535 17:72121360-72121382 CGGGGCAGGGGGCTGGTGGCCGG - Exonic
1151158265 17:72142596-72142618 GAGGGCAGGGGGATGGGGCAGGG + Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151538040 17:74749574-74749596 CAGACCCGAGGGAAGGGGGCTGG - Intronic
1151546851 17:74798564-74798586 CAGAGCAGGGTGCTGGGGGGTGG + Intronic
1151575845 17:74952230-74952252 CAGGGCCGGGGGTTGTGGGCGGG - Intronic
1151589410 17:75033703-75033725 CAGTGCCGGGGGCTGGGGGCTGG + Intronic
1151716372 17:75833092-75833114 CAGGGGAAGGGGATGGGGGTGGG - Intronic
1151784033 17:76266266-76266288 CAGAGCCAGGGGATGGGGAGGGG + Intronic
1151902637 17:77027000-77027022 CAGAGGAGGGGGTTGGGAGAGGG + Intergenic
1151953697 17:77369993-77370015 AAGGGAAGGGGGATGGGGACAGG - Intronic
1152060967 17:78074929-78074951 CACGGCAAGGGGATGGGGGTTGG - Intronic
1152095446 17:78269366-78269388 CAGAGTGGGGGGTGGGGGGCCGG - Intergenic
1152131699 17:78481089-78481111 AAAAGCCGGGGGATGGGGGGCGG - Intronic
1152218344 17:79047383-79047405 CGTGGCAGGGGGCTGGGGGCAGG + Intronic
1152228467 17:79103330-79103352 AAGAGGAGTGGGAGGGGGGCAGG + Intronic
1152552055 17:81034938-81034960 CGGAGAAGGGGGAGGGGGGCGGG - Intergenic
1152583749 17:81180157-81180179 GAGAGCAGTGGGATTGGGGGTGG + Intergenic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1152664505 17:81559471-81559493 CAGAGTGTGGGCATGGGGGCAGG + Intronic
1152688746 17:81707924-81707946 CTGCGCAGGGGGATTGGGGAGGG + Intergenic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1153633626 18:7095508-7095530 CAGAGCTGGAGCCTGGGGGCTGG - Intronic
1153677541 18:7468860-7468882 CAGAGCAGGGGGATGTTTGCTGG - Intergenic
1153715216 18:7840095-7840117 GAGGGCAGGGTGATGGGGGAGGG + Intronic
1153957761 18:10112620-10112642 TAGGGCAGGGGCATGGGGCCTGG + Intergenic
1154059624 18:11047321-11047343 AATAGCAGTGGGATGGGGGTGGG + Intronic
1154978394 18:21481224-21481246 CTGGGCAGGGGGATGGGGGCAGG + Intronic
1156389943 18:36640989-36641011 CAGAGAAGAAGGATGGGGTCTGG - Intronic
1156452687 18:37275385-37275407 CGGGGGAGGGGGACGGGGGCGGG + Intronic
1156457281 18:37301914-37301936 TAGAGCAGGGGGAAGGGGAAAGG - Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156592664 18:38509231-38509253 CCAAGCAGGAGGATGGGGGATGG + Intergenic
1157091166 18:44638660-44638682 CCAAGCAGGGGGGTGGGGGGGGG + Intergenic
1157166051 18:45359370-45359392 CAGAGGAGGAGGAGGGGTGCTGG - Intronic
1157700640 18:49759822-49759844 CAGTACCGGGGGCTGGGGGCGGG + Intergenic
1158075534 18:53523757-53523779 GAGGGCAGGGGGCTGGGGGAGGG + Intronic
1158599572 18:58845803-58845825 CAGAGCAGTGTGCTGGGGCCGGG - Intergenic
1158646999 18:59256121-59256143 GAGAGCAGGGGGTTGGGGTAAGG - Intergenic
1158658049 18:59359002-59359024 CGGAGCAGAGGGCTGGGGGCCGG - Intronic
1159572983 18:70141623-70141645 CAGAGTTGGGGGTTGGGGGAGGG + Intronic
1159586760 18:70289309-70289331 CAGGGCCGGGGAACGGGGGCCGG + Intronic
1160196100 18:76756897-76756919 CAGAGCTGCGAGATGGGGCCTGG + Intergenic
1160392266 18:78543130-78543152 CAGAGCAGGAGGCTGGAGGCAGG + Intergenic
1160450942 18:78965575-78965597 GAGGGCAGGGGGATGAAGGCTGG - Intergenic
1160632231 18:80254593-80254615 CAGGGCAGGGGGGTGGAGGGTGG + Intergenic
1160675131 19:386798-386820 GAGAGCACGGGGTTGGGGGTGGG - Intergenic
1160708773 19:541261-541283 CGGACCTGGGGGAGGGGGGCCGG + Intronic
1160769161 19:822471-822493 AAGAGCTGGGGGAGGGGGACTGG + Intergenic
1160849506 19:1183613-1183635 CAGAGCAAAGGGCCGGGGGCAGG + Intronic
1160871670 19:1280609-1280631 CAGATCACAGGGTTGGGGGCCGG - Intergenic
1160899056 19:1417812-1417834 AAGTGCAGAGGGCTGGGGGCTGG + Intronic
1160941416 19:1622023-1622045 CAGGGCAGGGGGCAGGGGGTGGG - Intronic
1161028259 19:2046517-2046539 CCCTGCAGGGGGGTGGGGGCCGG - Intronic
1161354265 19:3810377-3810399 CAGAGCAGGTGGGTCTGGGCTGG + Intronic
1161495477 19:4583899-4583921 CCAAGCAGGGGGGTGGGGGTAGG + Intergenic
1161514453 19:4688985-4689007 AGGGGCAGAGGGATGGGGGCGGG - Intronic
1161726957 19:5934966-5934988 CAAGGGAGGGGGTTGGGGGCAGG + Intronic
1161739074 19:6009329-6009351 GAGGGCAGGGGGGTGGGGGGCGG - Intronic
1161849594 19:6731572-6731594 GAGGGGAGGGGGCTGGGGGCTGG + Intronic
1161979662 19:7623973-7623995 CAGAGCACTTGGCTGGGGGCTGG - Intronic
1162022467 19:7874106-7874128 CAGGGGAGGCCGATGGGGGCTGG - Intronic
1162150901 19:8645011-8645033 CTGAGGTGGGGGATGGGGGGAGG - Intergenic
1162301378 19:9847020-9847042 CAGAGCAAGAGGATTGGGGTAGG + Intronic
1162315910 19:9937706-9937728 CAGAGGTGGAGGAGGGGGGCGGG + Intergenic
1162331649 19:10033467-10033489 GAGTGCAGGGGAATGGGGGTAGG + Intergenic
1162398795 19:10432460-10432482 CAGGGCAGGGGGCCGGGGCCGGG - Intronic
1162549570 19:11351055-11351077 CAGAACTGGGGAATGGAGGCAGG + Intronic
1162549734 19:11351740-11351762 GAGAGGAGGGGGATGAGGGTAGG + Intronic
1162582848 19:11540912-11540934 CATAGTTGGGGGATGGGGGCTGG - Intronic
1162780864 19:13006525-13006547 CTGAGCTGGGGGATGGGGCAGGG + Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1162927615 19:13938118-13938140 CAGAGCAGGGGTGGGGGGGCAGG + Intronic
1162949514 19:14062148-14062170 CAGAGAGGGGGGCTGGGGGCTGG + Intergenic
1162966570 19:14159029-14159051 CAGAGCTGGGGGGTGGGGGTGGG + Intronic
1162971615 19:14184146-14184168 GGAAGCAGGGGGCTGGGGGCGGG - Intronic
1163004589 19:14389307-14389329 AAGGGGAGGGGGATGGGGGAGGG + Intronic
1163081876 19:14950150-14950172 CAGAGAGGAGGGAAGGGGGCTGG - Intronic
1163110043 19:15154401-15154423 CAGAGAAAGTGGATGCGGGCAGG + Intergenic
1163305061 19:16472459-16472481 CGGGGCAGGGTGAGGGGGGCAGG - Intergenic
1163548487 19:17952516-17952538 CAGGGCATGGGGGTGGGGTCAGG - Intronic
1163566151 19:18052320-18052342 CAGAGGTGGGGGCTGGGGGCGGG + Intergenic
1163611533 19:18304396-18304418 GAGAGGAGGGGGATGGGGGATGG + Intergenic
1163623520 19:18374640-18374662 CTGAGCACGGGGGTGGGGGCGGG + Intergenic
1163633735 19:18429228-18429250 CCGAGGCGGGGGAGGGGGGCGGG + Intronic
1163640125 19:18457334-18457356 CAGGGTATGAGGATGGGGGCGGG + Intronic
1163850067 19:19657621-19657643 CAGAGCCGAGGGCTGTGGGCGGG - Intronic
1164555640 19:29248783-29248805 GGGAGCTGGGGGATGGAGGCAGG + Intergenic
1164643143 19:29840947-29840969 CAGAGGTGGGGGATGAGGGGCGG + Intergenic
1164768983 19:30793355-30793377 CAGAGAAGGGGGTTGGGGCAGGG + Intergenic
1164871438 19:31647580-31647602 CAGAGCAGGAGGAAGAGGGTGGG + Intergenic
1164907420 19:31978649-31978671 TATAGGAGGGGGCTGGGGGCTGG - Intergenic
1165020887 19:32923022-32923044 CAGGGCAGGCGGATGGAAGCTGG + Intronic
1165080377 19:33303009-33303031 CAGAGCAGCGGGGCTGGGGCCGG + Intergenic
1165095547 19:33407912-33407934 CAGAGAAGCGGGAAGGGGCCCGG + Intronic
1165104411 19:33460583-33460605 TAGAGCAGGGGGGTGGGTACGGG - Intronic
1165324632 19:35107387-35107409 CAGAGATGGGGGGTAGGGGCAGG - Intergenic
1165346346 19:35250670-35250692 CAGGGCAGGGGGATGAGGCTGGG + Intronic
1165655753 19:37530623-37530645 GAGAGCACGGGGTTGGGGGTGGG + Intronic
1165745604 19:38228447-38228469 CAGCGCACGGGGTTGGGGGAAGG + Intronic
1165851440 19:38852194-38852216 CCGAGCAGCGGGGTGGGGGCGGG - Intronic
1165994329 19:39833518-39833540 TAGAGCAGGTGGACGGGGGAGGG + Exonic
1166067218 19:40366883-40366905 CATAGCAGGGGGCTGGGCGCTGG - Exonic
1166219663 19:41356225-41356247 CAGACCAGGGGGGTTGGGGAAGG + Intronic
1166305821 19:41936362-41936384 CAGAGTTGGGGGATGAGGTCTGG + Intergenic
1166361216 19:42253760-42253782 CCGAGCAGGGGGATGGGGATGGG + Intronic
1166361265 19:42253918-42253940 CGGGGGAGGGGGAAGGGGGCCGG - Intronic
1167328274 19:48837921-48837943 GAGAGGAGGGGTCTGGGGGCCGG - Intronic
1167429603 19:49446981-49447003 CAGAGCAGGGGAATGAGGTCTGG - Intronic
1167465852 19:49650944-49650966 CAGAGGAGGGGGCAGGGGGTGGG - Exonic
1167527607 19:49994706-49994728 CAGCGGAGGGGGGTGGGGGCCGG + Intronic
1167529098 19:50003835-50003857 CAGTGCAGGGAGAGCGGGGCTGG - Intronic
1167643328 19:50693719-50693741 CTCAGCATGGGGAGGGGGGCTGG - Intronic
1167643835 19:50695403-50695425 CCGGGCAGGGGGGAGGGGGCCGG + Intronic
1167847732 19:52178279-52178301 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
1167913075 19:52720069-52720091 GAGAGCACGGGGTTGGGGGTAGG + Intronic
1168097841 19:54125668-54125690 CAGGGCTGGGGGGTGGGGCCAGG - Intronic
1168115802 19:54220944-54220966 CAGAGACAGGGGATGGGGGGAGG - Intronic
1168116329 19:54222948-54222970 CAGAGCAGGGCTGTGAGGGCGGG + Exonic
1168185686 19:54698062-54698084 CAGAGACAGGGGATGGGGGGAGG + Intronic
1168211558 19:54894398-54894420 CAGCGAAGGGGGATAGGGGTGGG + Intergenic
1168227514 19:55006928-55006950 CAGCGAAGGGGGATAGGGGTGGG + Intergenic
1168228303 19:55012115-55012137 CAGCGAAGGGGGATGGGGTGGGG + Intergenic
1168267507 19:55230735-55230757 CAGGGCGGGGGGGTGGGGGTGGG - Intronic
1168273221 19:55261682-55261704 CAGAGACGTGGGATTGGGGCGGG - Intergenic
1168294098 19:55370335-55370357 CAGGGCAGGGGGCAGGGAGCCGG + Exonic
1168315490 19:55483166-55483188 TGGAGCAGGGGGCTGGGGGCCGG - Exonic
1168485714 19:56760246-56760268 CAGAGCAGGGCACTGGGCGCAGG - Intergenic
1168599655 19:57707681-57707703 AAGAGCAGGGGGAAGGAGTCAGG - Intronic
1168705947 19:58470374-58470396 CTGAGAAGGGGGACAGGGGCGGG + Intronic
924971880 2:135898-135920 CAGAGCAGGAGGAAGGGAGGAGG - Intergenic
925254878 2:2474901-2474923 CTGAGCATGGGGGTGGGGGTGGG - Intergenic
925256514 2:2493940-2493962 CAGAGCAGAGGGAGTGGGGTGGG - Intergenic
925336897 2:3105275-3105297 GGGAGCAGGGGGTTGGGGGTGGG + Intergenic
925362719 2:3290642-3290664 AAGAGGAGGGTGCTGGGGGCAGG + Intronic
925379364 2:3414536-3414558 GACAGCTGGGGGATGGGGTCAGG - Intronic
925587071 2:5474951-5474973 CAGGGCAGGCGGGTGTGGGCGGG - Intergenic
925610562 2:5697485-5697507 CAGAGCGGGAGGCTGGGGGGCGG - Exonic
925730838 2:6918300-6918322 CAGTGCAGGGGGCTTGGGGTCGG - Intronic
925929298 2:8694179-8694201 CAGGGGAGGGGGCTGGGGGGTGG + Intergenic
925935124 2:8750216-8750238 AAGAGCACACGGATGGGGGCTGG + Exonic
926215104 2:10901448-10901470 AAGAGCAGGGGGAGGAGAGCGGG - Intergenic
927168614 2:20350415-20350437 CAATGCAGGGGGAGGGGTGCCGG - Intronic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927519496 2:23690380-23690402 AAGAGCAGGGGGCAGGGAGCTGG - Intronic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
927809310 2:26172978-26173000 CAGAGCAGGGGGCGGGGGTCCGG + Intergenic
927843374 2:26458889-26458911 CAGAGCCGGGGCTTGGGTGCAGG + Intronic
927887077 2:26725189-26725211 GAGAGCATGGGCCTGGGGGCAGG - Intronic
927989391 2:27436860-27436882 AAAAGCAGGGGGATGAGGACAGG - Intronic
928074523 2:28251005-28251027 CAGAGCTGTAGGATTGGGGCTGG + Intronic
928245450 2:29622716-29622738 CAGAGGAGGGGTGAGGGGGCTGG - Intronic
928280074 2:29938154-29938176 GAGGGCAGGGGGAAGGGGGAGGG + Intergenic
928375609 2:30770823-30770845 CAGAGGAGAGTGGTGGGGGCAGG + Intronic
928925938 2:36579553-36579575 TGGAGCAGGAGGAAGGGGGCTGG - Intronic
928943700 2:36753205-36753227 CAGAGTTGGGGGGTGGGGGAGGG + Intronic
929053622 2:37857776-37857798 GAGAACAGGGGGATGGCGGGAGG + Intergenic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929588066 2:43128330-43128352 CAGAGTAGGGGCATGGAGGAAGG + Intergenic
929830761 2:45344583-45344605 CAGAGCAAGGGGTTGGGAGAGGG - Intergenic
929924968 2:46200477-46200499 GAGAGCAGAGGGCTGAGGGCTGG - Intergenic
930029195 2:47048059-47048081 CAGAGCAGAGGAAGGGGGTCAGG - Intronic
930786794 2:55279397-55279419 GAGAGCACGGGGTTGGGGGTAGG - Intergenic
931188117 2:59973444-59973466 TAGGTCAGTGGGATGGGGGCTGG + Intergenic
931191166 2:60001741-60001763 CAGAGCAGGGGCCTGAGGGCTGG - Intergenic
931269158 2:60686643-60686665 CAGAGCAAGGGGATGATTGCAGG + Intergenic
931732388 2:65164830-65164852 GAGAGCTGGGGGAAGTGGGCAGG + Intergenic
932002242 2:67895667-67895689 CAGAGGAAGGGGTTGGGGGTTGG - Intergenic
932224514 2:70029068-70029090 CAGAGTAGGGGGTAGGGGACTGG + Intergenic
932306401 2:70706570-70706592 CAGAGCCTGGGGAGGAGGGCAGG + Intronic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932431680 2:71679356-71679378 GAGAGAGGGGGGATGGGGGCAGG - Intronic
932455667 2:71848259-71848281 GAGAGAAGGGGGGTGGGGGCGGG + Intergenic
932757993 2:74422008-74422030 CAGAGGACGGTGATGGGGGAGGG - Intronic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
932873912 2:75430972-75430994 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
933061989 2:77749240-77749262 GGGGGCAGGGGGATGGGGGAGGG + Intergenic
933412204 2:81940598-81940620 CAGAGGAGGGGGATGGGGTGGGG - Intergenic
933663230 2:84944443-84944465 CATAGCTTGAGGATGGGGGCTGG + Intergenic
933709248 2:85313720-85313742 CAGAGCAGGGGGGTCGGGCTTGG + Intergenic
933763981 2:85694887-85694909 GAGAGCAGGGTGCAGGGGGCAGG - Intronic
933807710 2:86012178-86012200 CAGGGCAGAGGGTAGGGGGCGGG - Intergenic
933850721 2:86364549-86364571 CAGAGCAGGAGCAAGGGGGTGGG + Intergenic
933975341 2:87504835-87504857 CAGGGCAGAGCGGTGGGGGCGGG + Intergenic
934080937 2:88467335-88467357 GAAAGCAGAGGGATAGGGGCCGG + Intergenic
934762791 2:96865607-96865629 CAGAGAAGGGTGAGGAGGGCGGG + Intronic
935096758 2:99952251-99952273 CAGAGCAGGAGGAAGGGGTTTGG - Intronic
935101236 2:99997964-99997986 CAGAGCAGGGGAAAGAGGGCTGG - Intronic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935673686 2:105576292-105576314 GTGAGCAGGGGGAGGAGGGCTGG + Intergenic
935689320 2:105716080-105716102 CAGGGCAGTTGGATGGGGGGTGG - Intergenic
936020045 2:108988029-108988051 CAGAGCAGTGGCCTGGGGACTGG + Intronic
936099444 2:109562367-109562389 GAGAGTTGGGGGAGGGGGGCAGG - Intronic
936318485 2:111445978-111446000 CAGGGCAGAGCGGTGGGGGCGGG - Intergenic
936522633 2:113220630-113220652 CACAGCAGGGGTATGGGGTTAGG + Intronic
937268736 2:120633619-120633641 CAGGGAAGGGGAAGGGGGGCAGG - Intergenic
937295410 2:120807088-120807110 CAGATCAGGGGGCTGGGGAGGGG + Intronic
938090067 2:128425584-128425606 AACAGGAGGGGAATGGGGGCGGG + Intergenic
938114408 2:128593642-128593664 CAGAGGAGAGGGATTGGGGCGGG + Intergenic
938374943 2:130798936-130798958 AACAGCAGGGGGATGGGGGAAGG - Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938569014 2:132545156-132545178 CAGAGGAGGGTGATAGTGGCAGG - Intronic
939154440 2:138507486-138507508 CAGAGCAGGGGCATCAGGGGAGG + Intronic
939211105 2:139175853-139175875 CAGAGCTTCTGGATGGGGGCGGG - Intergenic
939262356 2:139827413-139827435 CAGAACAGTGGGGTTGGGGCTGG - Intergenic
939552352 2:143630973-143630995 CAGAGCAGGTGGAAAGGGGAAGG - Intronic
940829591 2:158453370-158453392 CAGAGGATGGGGATGGGGTGGGG + Intronic
940901608 2:159131135-159131157 CATAGCTGGGGGCTGGGGGTGGG + Intronic
941538661 2:166754780-166754802 CAGGGATGGGGGATGGGGGAGGG - Intergenic
941657629 2:168160930-168160952 CAGAGTCGGGGGGTGGGGGTGGG + Intronic
941897584 2:170644942-170644964 CAGGGCAGGGGGTTGGGGGGAGG + Intronic
942058175 2:172204656-172204678 CAGAGCAGGGTGAGGGAGACTGG - Intergenic
942187772 2:173440617-173440639 AAGGGCAGGGGGTAGGGGGCCGG - Intergenic
942241068 2:173964563-173964585 CAGCGCGGGGGGGTGGGGGTGGG + Intronic
942456143 2:176139869-176139891 CAAAGCACGGGTGTGGGGGCGGG + Intergenic
942911025 2:181244778-181244800 CAGGGGCGGGGGTTGGGGGCGGG - Intergenic
943912492 2:193586380-193586402 CAGAGCAGGGGCCTGGTGGGAGG + Intergenic
944022716 2:195125725-195125747 GAGAGCAGGTTGATGGTGGCAGG - Intergenic
944022843 2:195126240-195126262 GAGAGCAGGTTGATGGTGGCAGG + Intergenic
944194065 2:197033615-197033637 AACAGCACAGGGATGGGGGCAGG + Intronic
944203741 2:197135750-197135772 CAGAGCAGGGGAGCAGGGGCCGG - Intronic
944256663 2:197629445-197629467 TGGGGCAGGGGGATGGGGGAGGG + Intronic
945259669 2:207831906-207831928 CCCAGCAGGGGAAAGGGGGCTGG - Intronic
945375771 2:209078346-209078368 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
945376652 2:209084256-209084278 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
945844368 2:214926746-214926768 CAGTGGAGGGGGGCGGGGGCAGG + Intergenic
946001413 2:216485622-216485644 GGGAGCAGGGGGAAGGGAGCAGG - Intergenic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946386506 2:219387410-219387432 CTGGGCAGGGACATGGGGGCGGG - Intronic
946885164 2:224215786-224215808 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
947202507 2:227627274-227627296 CAGGGCAGGGGGATGGTTTCAGG - Intronic
947444167 2:230150673-230150695 TAGAGCACCTGGATGGGGGCTGG + Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947629700 2:231644215-231644237 CAGGGCAGGGGCATTTGGGCAGG - Intergenic
947913346 2:233816902-233816924 CAGAGCAGCAGGCTGGGGGCTGG - Intronic
947991999 2:234495764-234495786 CTGAGCTGGGGGTGGGGGGCAGG + Exonic
948194702 2:236086851-236086873 TAGGGCAGGGGGGTGGGGGAGGG - Intronic
948217102 2:236239970-236239992 CACAGCAAAGGGATGTGGGCTGG - Intronic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
948497263 2:238359381-238359403 CAGAGCAGAGGGGTGGCTGCTGG - Intronic
948753331 2:240144810-240144832 GGGAACAGAGGGATGGGGGCTGG - Intergenic
948753397 2:240145033-240145055 TGGGCCAGGGGGATGGGGGCGGG - Intergenic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948910727 2:241001165-241001187 CACTGCAGTGGGATGGGGGCTGG - Intronic
948977738 2:241473767-241473789 GAGAGCCAGGGGATGGGGGCAGG + Intronic
949009801 2:241671975-241671997 CAGGGCAGGGTGAGGAGGGCAGG - Intronic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1168753721 20:301278-301300 GAGAGTGGGGGGATGGGGCCAGG - Intergenic
1168761787 20:354475-354497 AAGAGCCGGGGGTAGGGGGCAGG + Exonic
1168768982 20:402151-402173 CAGATCATGGGGGTGGGGGTGGG + Intergenic
1168837345 20:886023-886045 GAGAGGAGGAAGATGGGGGCAGG + Intronic
1168956608 20:1838675-1838697 TAAAGCAGGGGGATGGGAGGAGG - Intergenic
1169009258 20:2236691-2236713 CTGCGCAGGGAGATGGGGGCCGG + Intergenic
1169062957 20:2674842-2674864 CAAAAAAGGGGGATGGGGGAGGG - Intergenic
1169142526 20:3234411-3234433 CAGGGCTGGGGGCTGGGGGCTGG - Intronic
1169142814 20:3235780-3235802 CAGGGCAGGGGGAGCAGGGCTGG - Intronic
1169208582 20:3753577-3753599 CAGACCTGAGGGGTGGGGGCTGG + Exonic
1169868964 20:10231142-10231164 CATTGCTGAGGGATGGGGGCAGG - Intronic
1170195502 20:13685058-13685080 CAGAGCAGCAGAATGGGGGAAGG - Intergenic
1170664500 20:18375380-18375402 GAGAGCACGGGGTTGGGGGTAGG + Intergenic
1171384793 20:24763032-24763054 CAGAGGAGGGGAAGGTGGGCTGG + Intergenic
1171459369 20:25290309-25290331 CAGAGCTGGGGCCTTGGGGCCGG + Intronic
1171971745 20:31569248-31569270 CAGACCAGACAGATGGGGGCTGG + Exonic
1172028869 20:31968001-31968023 CAGCTCAGGCGGGTGGGGGCGGG + Exonic
1172149446 20:32779921-32779943 CTGAGCAGGGAGAGGGGGCCAGG + Intronic
1172284522 20:33731686-33731708 CAGAGCTGGGGGGTCGGGTCCGG + Exonic
1172465206 20:35151365-35151387 AAGAGGAGGGGGATGGGGAGGGG + Intergenic
1172513377 20:35515695-35515717 CAGAGCGGGGGAATGGGGCCAGG + Exonic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1172656267 20:36540792-36540814 GAGGTCAGGAGGATGGGGGCGGG - Intergenic
1172697944 20:36835295-36835317 GAGAGCTGGGGGTTGGGGGGGGG + Intronic
1172723462 20:37016935-37016957 GAGAGGAGGGGGATGGGGATGGG + Intronic
1172794455 20:37527480-37527502 CAGAGCCGGGGGCACGGGGCTGG - Intronic
1172874735 20:38157213-38157235 GGGAGGAGGGGGCTGGGGGCTGG - Intronic
1172979395 20:38929438-38929460 CAGACCTAGGGTATGGGGGCTGG + Intronic
1173100356 20:40082169-40082191 GAGAGCTTCGGGATGGGGGCTGG + Intergenic
1173370159 20:42427976-42427998 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1173453854 20:43188875-43188897 CAGAGTAGGGGGAGCGGGGGCGG - Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173849372 20:46208210-46208232 CAGAGGAGGAGGTTAGGGGCTGG - Intronic
1174181752 20:48679505-48679527 CAGGGCAGGGTAATGGGGGCAGG + Intronic
1174265011 20:49325057-49325079 CAGAGCACTGGGCTGGGTGCTGG - Intergenic
1174353440 20:49983508-49983530 GTGAGGAGGGGGATTGGGGCAGG + Intronic
1174358334 20:50012871-50012893 CAGAGCCGGGGCCTGGGAGCTGG + Intergenic
1174441733 20:50561080-50561102 CACAGCAAAGGCATGGGGGCTGG - Intronic
1174481551 20:50834712-50834734 CAGAGCCGGGGGCTGGGGAATGG - Intronic
1174543186 20:51305750-51305772 CAAAGGTGGGGGTTGGGGGCAGG + Intergenic
1174792688 20:53495378-53495400 AAGAGAGGGGGGATGAGGGCGGG + Intergenic
1175141018 20:56860220-56860242 ACGAGGAGGGGGATGGGGACGGG - Intergenic
1175199156 20:57266285-57266307 CCGAGCAGGGGGCGGGGGTCCGG - Exonic
1175216268 20:57392965-57392987 CAAAGAAGGGGGCGGGGGGCAGG + Intronic
1175224908 20:57439293-57439315 CAGTGCAGGAGGAGGGGGGGTGG - Intergenic
1175332782 20:58176464-58176486 CAGCCCAGGGGCATGGGGGCTGG - Intergenic
1175681814 20:60994790-60994812 CTGGGCAGTGGGATGGGGGAGGG - Intergenic
1175766143 20:61594193-61594215 CTGAGCAGGGGAAAGGGGTCAGG + Intronic
1175810980 20:61857124-61857146 CCGGGGAGGGGTATGGGGGCAGG - Intronic
1175912706 20:62412445-62412467 CAGAGGAGGGCGAGGGTGGCCGG - Intronic
1175990260 20:62785250-62785272 CAGAGGTGGGGGATGGAGGGTGG + Intergenic
1175994457 20:62805809-62805831 CTGGGCAGGGGGGTGGGGTCTGG + Intronic
1176126017 20:63475131-63475153 CAGAGGAGGGGACAGGGGGCAGG - Intergenic
1176198300 20:63847986-63848008 GAGAGGAGGGAGCTGGGGGCTGG + Intergenic
1176307479 21:5131509-5131531 CAGAGGAGGTGGTTGGGTGCAGG - Intronic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1176838716 21:13820006-13820028 GAGAGCACGGGGTTGGGGGTAGG - Intergenic
1176869962 21:14076303-14076325 CAGGGCAGAGGGACTGGGGCCGG + Intergenic
1177137195 21:17318188-17318210 CACTGCTGGGGGATGGGGGAGGG - Intergenic
1178249718 21:30990776-30990798 CCCAGCAGGGGGAGCGGGGCTGG + Intergenic
1178417903 21:32418684-32418706 CAGAGTACAGGGATGGGGCCAGG + Intronic
1178879891 21:36441054-36441076 CATGGCAGGGGGGTGGGGGCGGG - Intergenic
1179175611 21:39005752-39005774 AAAAGCTGAGGGATGGGGGCAGG - Intergenic
1179529752 21:42010463-42010485 CGGCGCAGGGGGACGGGGGAGGG + Intergenic
1179548241 21:42126282-42126304 CACAGCAGGGCGTGGGGGGCCGG + Intronic
1179584323 21:42365263-42365285 CAGAGCTGGGGGCTGGGGTGGGG + Intronic
1179607401 21:42525925-42525947 CAGAGGATGGGGATGGTAGCAGG + Intronic
1179727792 21:43350136-43350158 GAGAGGAGGGGGGAGGGGGCGGG - Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179788571 21:43743099-43743121 CAGAGCGGGGGGAGGGAGGTGGG - Intronic
1179810185 21:43865184-43865206 GAGGGCGGCGGGATGGGGGCCGG + Intronic
1179849581 21:44130521-44130543 CAGAGGAGGTGGTTGGGTGCAGG + Intronic
1179884323 21:44306985-44307007 CAGAGCACGGGCCTGGGGGCAGG + Intronic
1179897372 21:44370181-44370203 CAGAGCAGAGGGAGGGGGCGTGG + Intronic
1179958962 21:44757718-44757740 GAGAGCTGGGGGGTGGGGGGGGG + Intergenic
1180023635 21:45145734-45145756 CACAGCAGGAGGATGCCGGCAGG + Intronic
1180048969 21:45322797-45322819 CGGAGCAGGGGGAGGAGGGGCGG - Intergenic
1180062204 21:45391125-45391147 CAGAGCAGGGGAGTTGGGTCTGG + Intergenic
1180304922 22:11066469-11066491 CTGAGCAGTAGGATTGGGGCTGG + Intergenic
1180782436 22:18528729-18528751 CAGGGCGGGCGGAAGGGGGCGGG + Intronic
1180829006 22:18888251-18888273 CAGAGCGGGGAGATGGGCCCTGG + Intergenic
1180875925 22:19175258-19175280 CAGAGCAGGGGGCTGGGCCCAGG - Intergenic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181125989 22:20702756-20702778 CAGGGCGGGCGGAAGGGGGCAGG + Intergenic
1181155519 22:20917679-20917701 CAGAGCCGGGGGGTCGGGGCAGG - Exonic
1181239326 22:21468064-21468086 CAGGGCGGGCGGAAGGGGGCAGG + Intergenic
1181274137 22:21677865-21677887 CACAGCAGGGGGAGGGGAGAGGG + Intronic
1181376711 22:22464526-22464548 CAGAGCAGGCCGTTGGAGGCTGG + Intergenic
1181479116 22:23186554-23186576 CAGTGCCAGGGGCTGGGGGCAGG - Intronic
1181684042 22:24516279-24516301 CAGGGCTGGGGGATGAGGGGAGG + Intronic
1181916965 22:26289240-26289262 AAGAGCAGGGGGGAGGGGTCAGG - Intronic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182086309 22:27563547-27563569 CAGGGCAGAGGGATGGAGGCAGG - Intergenic
1182324780 22:29504294-29504316 CAGACCAGGGGGATGCCGCCTGG + Intergenic
1182357933 22:29730622-29730644 CACAGCTGGGGCATGGGAGCGGG - Exonic
1182444207 22:30380768-30380790 AAGTGCAGGAGGATGGGGGTGGG - Intronic
1182697637 22:32207309-32207331 CAGAGCAGTAGGAGGGCGGCTGG + Intergenic
1182715233 22:32352822-32352844 CAGAGCGGTAGGATGGCGGCTGG - Intergenic
1182866184 22:33606577-33606599 GAGAGCACGGGGTAGGGGGCGGG - Intronic
1183064185 22:35352433-35352455 TAGGGCAGGGGGCAGGGGGCAGG - Intergenic
1183123471 22:35751391-35751413 TAGAGCAGAGGGTTGGGGGATGG + Intronic
1183303653 22:37070647-37070669 CACAGTCTGGGGATGGGGGCAGG + Exonic
1183428047 22:37750236-37750258 CAGGGCTGGGAGATTGGGGCAGG - Intronic
1183489869 22:38110544-38110566 CTGAGCAGGAGGCTGGGAGCTGG + Exonic
1183503335 22:38194402-38194424 CAGAGGGAGGGGATGGGGACTGG + Intronic
1183507842 22:38219244-38219266 CAGAGCAGGGGGCAGGGAGGAGG + Intergenic
1183513058 22:38247071-38247093 CAGAGGAGGCTGATGTGGGCTGG - Intronic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1183671396 22:39274836-39274858 AAGAGAAGGGGGCAGGGGGCTGG + Intergenic
1183724563 22:39581228-39581250 CAGAGAAGTGGGATGGGGCATGG + Intronic
1183725171 22:39584553-39584575 GAGACCAGAGGGCTGGGGGCTGG + Intronic
1183742266 22:39675373-39675395 CAGAGCATGGGGAAGGGGAGAGG - Intronic
1183956300 22:41382307-41382329 CAGCGGAGGGGGATGGGGCCTGG + Intronic
1184034940 22:41913868-41913890 GAGGGCAGGGGGGTGGGGGCGGG - Intronic
1184092350 22:42299324-42299346 CAGAGCAGGGGGCTGGATGTGGG - Intronic
1184110157 22:42389603-42389625 CTGGGCTGGGGGTTGGGGGCTGG + Intronic
1184219901 22:43093248-43093270 CAGGGCGGGGGGAGGGGGGAGGG + Intergenic
1184554960 22:45228059-45228081 TAGAGCTGGGGGTTTGGGGCAGG + Intronic
1184561939 22:45268613-45268635 CGGGCGAGGGGGATGGGGGCGGG - Intergenic
1184571228 22:45326170-45326192 CAGAGAGGCGGGGTGGGGGCGGG - Intronic
1184628398 22:45755959-45755981 CAGAGCATGGGTCTGGGGCCAGG - Intronic
1184779658 22:46640799-46640821 CGGGGCAGGGGGTTGGGGGCAGG - Intronic
1185101004 22:48840769-48840791 CTGAGCAGGGAAATGGGGCCTGG + Intronic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
1185223152 22:49639310-49639332 GAGGGCAGGGGGATGGGCACGGG - Intronic
1185242358 22:49753468-49753490 AAGAGCAGAGTGATGGGTGCGGG + Intergenic
1185309569 22:50146461-50146483 CAGTGCAGGGGGGTGGGGTCGGG + Intronic
1185317715 22:50186088-50186110 CCGAGTCGGGGGGTGGGGGCCGG + Intronic
1185389211 22:50549745-50549767 CAGTGCAGTGGGGCGGGGGCGGG - Exonic
1185415188 22:50705695-50705717 CAGAGCCATGGGGTGGGGGCTGG - Intergenic
1185418828 22:50723878-50723900 CAGAGAGGGAAGATGGGGGCTGG - Intergenic
1203279097 22_KI270734v1_random:114239-114261 CAGAGCGGGGAGATGGGCCCTGG + Intergenic
949777694 3:7650972-7650994 CAGAGCTGGGGTTTGGGGGTAGG - Intronic
949827911 3:8182593-8182615 CAGCGCAGGGAGATAGGGGTGGG - Intergenic
950096078 3:10331432-10331454 TGGGGCAGGGGGATGGTGGCAGG + Intronic
950152119 3:10695990-10696012 CAGAGTGGGTGGCTGGGGGCTGG - Intronic
950157224 3:10730765-10730787 CAGCGAAGGGAGATAGGGGCGGG - Intergenic
950459497 3:13112739-13112761 CAGGGGAGGGGCATAGGGGCAGG - Intergenic
950530281 3:13549065-13549087 CAGGGGAGGGGGCCGGGGGCCGG + Intergenic
950542851 3:13622455-13622477 CAGAGCTGGTGGATGGAGGATGG + Intronic
951237100 3:20249474-20249496 CAGAGCAAGAGGTTGGGGGGAGG + Intergenic
953407714 3:42667686-42667708 CAGCGGTGGGGGATGGGGGATGG + Intergenic
953510603 3:43534520-43534542 GAGAGAAGGGGGTTGGGGGGAGG + Intronic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
953836979 3:46355254-46355276 CAGAGAAGGGGGATTTGAGCAGG + Intronic
953850485 3:46462792-46462814 CAGAGAAGGGGGCAGGGAGCTGG + Intronic
953979256 3:47405554-47405576 CAGAGCAGGAGACTGAGGGCTGG + Intronic
953979586 3:47406953-47406975 CAGAGCAGGTGGCTGGGGCAGGG + Intronic
954036227 3:47852657-47852679 CAAAGCAGGGAGATGGGCCCAGG + Exonic
954073157 3:48157996-48158018 CAGGGAAGGGGGGTGGGGGTAGG - Exonic
954111640 3:48436871-48436893 CAGAACATGGGGGTGGGGGACGG - Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954433906 3:50485895-50485917 CAGACCAGGGGCACGGGGACAGG + Intronic
954445325 3:50543180-50543202 CAGAGCAGGGGCAGGGGTGGGGG + Intergenic
954628035 3:52033378-52033400 GAGAGCAGGGAGAGGGGTGCAGG - Intergenic
955357440 3:58242862-58242884 TGGGGCAGGGGGATGGGGGAGGG - Intronic
956708915 3:72023411-72023433 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
956852716 3:73245519-73245541 AAGAGCAGTGGGATGGGTGTGGG - Intergenic
956860220 3:73315871-73315893 CAGAGCAGGGGGCTGGAGGGAGG - Intergenic
957407079 3:79785321-79785343 CACAGGAAGGGGATGGGGGAGGG + Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
957734387 3:84187912-84187934 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
957789367 3:84919213-84919235 GAGAGCACAGGGTTGGGGGCAGG - Intergenic
958586160 3:96091029-96091051 CAGAAGTGGGGCATGGGGGCAGG + Intergenic
958661733 3:97077536-97077558 CAGGGGAGGGGGATGGGGCGGGG - Intronic
958770212 3:98417152-98417174 TGGAGTAGGGGGATGGGGGAGGG - Intergenic
959095523 3:101951359-101951381 CAGGGCAGGGGTAGGGGAGCGGG + Intergenic
959599129 3:108159366-108159388 CTGACCAGGGGCAAGGGGGCGGG - Intergenic
960036913 3:113111093-113111115 CAGGGCAGCAGGGTGGGGGCAGG + Intergenic
960343608 3:116505557-116505579 CAGGGTAGGGGGAGGGGGGACGG - Intronic
960936040 3:122903296-122903318 CAGAGCAGCGTGTTTGGGGCTGG + Intergenic
960948406 3:122982688-122982710 CAGACCTGGGGGGTGGGGGGTGG - Intronic
960965862 3:123104307-123104329 CAGGGCAGAGGGAAGGGGACAGG + Intronic
961347991 3:126277191-126277213 CAGAGCAGGAGGAAGAGGGGTGG + Intergenic
961350777 3:126300573-126300595 CAGAGCATGGGGACGGGGAAAGG - Intergenic
961393717 3:126571477-126571499 CAAAGCAGGTGGAGGAGGGCTGG + Intergenic
961406291 3:126682134-126682156 CAGGGCTGGGAGCTGGGGGCAGG + Intergenic
961529643 3:127532767-127532789 AAGGCCAGGGGCATGGGGGCGGG - Intergenic
961537445 3:127578759-127578781 CAGAGGAGTGGGCTGTGGGCAGG - Intronic
961622721 3:128237598-128237620 CAGAGCTGGGAGAGGGGAGCAGG - Intronic
961629277 3:128284440-128284462 CAGTGCTGGGGGTTGGGGGTGGG + Intronic
961698883 3:128726389-128726411 CTGAGGGGGGGGATGGGGCCAGG - Intronic
962110769 3:132444212-132444234 CAGGGCAGGGGGATGGTTTCAGG - Intronic
962294431 3:134168620-134168642 TAGGGTAGGGGGATGGGGGAGGG + Intronic
962395272 3:135010284-135010306 CAGAGTAGGGGGATGAGGGAAGG - Intronic
962403396 3:135080328-135080350 GAGAGAAGGGGGAGGGGTGCAGG + Intronic
962458103 3:135583882-135583904 CTGAGCAGTGCCATGGGGGCTGG - Intergenic
962940804 3:140123161-140123183 CAGGGCGGGGGGGTGGGGGGCGG + Intronic
963598340 3:147356400-147356422 CAGATCTGGGGGCTGGGGGTGGG - Intergenic
963845538 3:150152496-150152518 CAGAGCTGAGGGATGGGGGATGG - Intergenic
963925267 3:150944471-150944493 CAGAGGGGAGAGATGGGGGCTGG + Intronic
964244373 3:154633601-154633623 CACGGCAAGGGGATGGGGGAGGG + Intergenic
964362848 3:155916388-155916410 AGGAGCTGGGGGGTGGGGGCAGG - Intronic
964487896 3:157205289-157205311 CAGAGGAGGTGGGTGGGGACTGG - Intergenic
964607564 3:158573368-158573390 CGGGGCGGGGGGAGGGGGGCGGG + Intronic
964817517 3:160732405-160732427 CAAAGCAGGAGGAAGGGGCCTGG - Intergenic
965343578 3:167519633-167519655 CAGGGGTGGGGGATGGGGGAGGG + Intronic
965640384 3:170823455-170823477 CAGAGAAGGGAGATAGGGGTGGG + Intronic
965714819 3:171591602-171591624 CCGGGCTGGGGGATGGGGGGAGG - Intergenic
966246042 3:177809005-177809027 CTGGGCACGGGGGTGGGGGCGGG + Intergenic
966314036 3:178625285-178625307 CAGGACAAGGGGGTGGGGGCGGG + Intronic
966454128 3:180095124-180095146 CACTGCCGGGGGATGGGGGAGGG + Intergenic
966885860 3:184377898-184377920 CAGAGCAGGGGTAGGGGGTGGGG - Intronic
966926052 3:184645324-184645346 CAGAGCAGGCAGGTTGGGGCAGG - Intronic
966944149 3:184765882-184765904 CAGAGGAGGTGGCTGGTGGCAGG + Intergenic
967152598 3:186663569-186663591 CAGAGAAGGGAGATGGGGTGGGG - Intronic
967303057 3:188035808-188035830 CAAAGCTGGGGGCTGGGGGTGGG + Intergenic
967870364 3:194224269-194224291 CAGAGCCGGGGCAGTGGGGCTGG - Intergenic
968221630 3:196944202-196944224 GAGAGCAGGGGGTTGGGGGTGGG - Intergenic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968266955 3:197369871-197369893 GAGAGAAGGGGGAGGGGGGTGGG - Intergenic
968432750 4:568366-568388 CTGAGAAGGGGGATGAGGGATGG - Intergenic
968523248 4:1043954-1043976 CAGAGCAGGGGGCAGGGACCTGG + Intergenic
968628267 4:1637673-1637695 CAGTGCTGGGGGCTAGGGGCAGG + Intronic
968642713 4:1722334-1722356 CAGGGCAGGGGAAGGGGTGCTGG - Intronic
968647800 4:1748999-1749021 GAGAGCAGTGGGGAGGGGGCAGG - Intergenic
968762877 4:2451413-2451435 CAGAGGAGGGGCCTGGGGGCTGG + Intronic
968818601 4:2834183-2834205 CAGGGCAGCTGGGTGGGGGCCGG + Exonic
968910588 4:3475376-3475398 CAGAGAAGGGGGAGGTGGGATGG + Intronic
969119814 4:4899884-4899906 CAGGGCTGGGGGCTGCGGGCAGG - Intergenic
969143873 4:5102930-5102952 GAGAGGAGGGGGAGGGGGGAGGG - Intronic
969285506 4:6199939-6199961 GAGAGCTGGGGGCTGGGGGCGGG + Intronic
969308799 4:6340318-6340340 AAGAGCCTGGGAATGGGGGCGGG - Intronic
969339169 4:6529625-6529647 CAGGGAAGAGGGATGGGGGATGG - Intronic
969490443 4:7496470-7496492 CTGAGATGGGGGATGGGGGACGG - Intronic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
969674669 4:8608143-8608165 CGCAGCTGGGGGCTGGGGGCTGG - Intronic
969684600 4:8664107-8664129 GAGAGGAGGGGGAGAGGGGCCGG + Intergenic
969939858 4:10721176-10721198 CTGAGGAGGGAGTTGGGGGCTGG + Intergenic
970323106 4:14894995-14895017 CAGAGAAAGGGGGTAGGGGCAGG - Intergenic
971130065 4:23798125-23798147 CAGAGAAGGGAGATGGGGTGGGG - Intronic
972305294 4:37824982-37825004 AAGAGCTGGGGGTTGGGGGAGGG - Intergenic
972605128 4:40606549-40606571 CAGAGCAGGGGCTTGGGGCCAGG - Intronic
972671126 4:41214680-41214702 CGGGGCCGGGGGGTGGGGGCCGG + Intronic
973752267 4:54033008-54033030 CAGAGCAGGAGCAAGGGGGTTGG - Intronic
973870804 4:55164423-55164445 CCTATCAGGGGGTTGGGGGCTGG - Intergenic
973964675 4:56149231-56149253 CCTAGCAGGAGGATGGGGGAGGG - Intergenic
974904414 4:68037452-68037474 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975441801 4:74419711-74419733 CAGACCAGGGGGTGGGGGGATGG + Intergenic
976273404 4:83252220-83252242 GGGAGCAGGGGGACGGAGGCTGG + Intergenic
977984288 4:103363564-103363586 AGTAGCAGGGGGAAGGGGGCTGG - Intergenic
978244094 4:106551518-106551540 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
978291780 4:107150535-107150557 CAGAGGTGGGGGATGGGGAGGGG + Intronic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
980928013 4:139158075-139158097 CAGAGAAGGGAGATAGGGGTGGG + Intronic
981045030 4:140256907-140256929 CAGAGCAGGTGGCTAGAGGCAGG + Intergenic
981394581 4:144233194-144233216 CACAGCCAGGGTATGGGGGCGGG - Intergenic
981824001 4:148918441-148918463 CGGGGCAGGGGGCTGGGGGTGGG + Intergenic
982075483 4:151732415-151732437 CAGAGCACAGGGTTGGGGGCAGG - Intronic
982180825 4:152746810-152746832 CAGCGAAGGGAGATGGGGGTGGG + Intronic
982460380 4:155662936-155662958 CAGGGTGGGGGGATGGGGGAGGG - Intergenic
982711485 4:158762436-158762458 CAGAACTGTGGGATGGGGGTGGG + Intergenic
982722780 4:158876583-158876605 CAGAACAGGGATATGGGGCCTGG - Intronic
983056023 4:163100040-163100062 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983056581 4:163103990-163104012 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983585856 4:169353724-169353746 CAAGGCAGGGAGATGGGGGTGGG - Intergenic
983635128 4:169890211-169890233 CTGGGCAGGTGGCTGGGGGCGGG - Intergenic
984713498 4:182905063-182905085 CAGAGAAGTGGGGTGGTGGCTGG - Intronic
984749348 4:183256888-183256910 CAGAGCCGGGGGGGGGGGGGGGG - Intronic
984769600 4:183425938-183425960 CACAGGAGGGGGAGGGGGGGAGG - Intergenic
985078065 4:186237807-186237829 CAGAGAGGTGGGAAGGGGGCGGG - Intronic
985404999 4:189629047-189629069 CAGGGGAGAGGGATGGGGGAAGG + Intergenic
985573988 5:665304-665326 AGGAGCAGGAGGAAGGGGGCAGG + Intronic
985636543 5:1038469-1038491 CGGAGGTGGGGGGTGGGGGCTGG - Exonic
985665684 5:1180605-1180627 CTGAGGCGGGGGATGGGGGTGGG + Intergenic
985671452 5:1208971-1208993 CAGAGCAGGGGCACCGAGGCCGG - Intronic
985702701 5:1383239-1383261 GTGAGCAGGGGGTTGGGGGGGGG - Intergenic
985706475 5:1404214-1404236 CGGAGGACTGGGATGGGGGCTGG + Intronic
985774115 5:1831780-1831802 AGGAGCCGGGGGAAGGGGGCTGG - Intergenic
985812891 5:2103267-2103289 GAGAGCAGGGGGGTGGCGGGAGG - Intergenic
986224655 5:5801502-5801524 CTGTGCAGTGGGATGGAGGCTGG + Intergenic
986250014 5:6046679-6046701 GAGAGGAAGGGGTTGGGGGCTGG - Intergenic
986433591 5:7705605-7705627 CAGGGCAGAGGGGTGGGGGTGGG + Intronic
987140157 5:14937684-14937706 CAGAGGAGGGCAATGGGGACTGG + Intergenic
987246753 5:16056845-16056867 GCGAGCAGGGGGATAGGGTCAGG - Intergenic
987497646 5:18668944-18668966 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
989103633 5:37841050-37841072 CAGAGCTCTGGAATGGGGGCCGG - Intergenic
989125012 5:38044603-38044625 CAGGGCTGGGGGAGGGGGGGTGG - Intergenic
989180911 5:38575992-38576014 CAGAGGAAGGTGATGGGGGAAGG + Intronic
989206629 5:38815736-38815758 CAGAGGAGGGGAGGGGGGGCAGG - Intergenic
990509440 5:56477132-56477154 CAGAGGGTGGGTATGGGGGCAGG - Intronic
991501520 5:67281999-67282021 CGGAGAAGGGGGAAGGGGGAAGG - Intergenic
992348714 5:75907465-75907487 CAGCGCGGTGGGATGGGGGGAGG + Intergenic
992415695 5:76550652-76550674 GAGAGCACGGGGTTGGGGGTAGG + Intronic
992444042 5:76818937-76818959 CAGGGAAGGGGGCCGGGGGCGGG + Intronic
992566427 5:77999461-77999483 GAAAGCAGGGGGACGGGAGCCGG + Intergenic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
994670763 5:102758824-102758846 CAGGGTAGGGGGAGGGGGGAAGG + Intronic
995083547 5:108081831-108081853 GAGAGCAGGTGGAGTGGGGCTGG - Intronic
995972942 5:117994947-117994969 CAGTTCAGGGGGATGGAGGGAGG + Intergenic
996319346 5:122196997-122197019 TGGAGCAGAGGGATGGAGGCAGG + Intergenic
997213829 5:132094477-132094499 CAGTTCAGGTGGCTGGGGGCTGG + Intergenic
998105026 5:139462933-139462955 AAGAGAATGGGGATGGGGCCAGG - Intergenic
998133188 5:139661216-139661238 CAGAGCAGGGTGAGCTGGGCGGG + Intronic
998142861 5:139709783-139709805 CAGAGCCGGGGCGTGGAGGCGGG - Intergenic
998485074 5:142494871-142494893 AAGAGTATTGGGATGGGGGCAGG + Intergenic
998532745 5:142900599-142900621 GAGAGTAGGGGGAGGGGGGGCGG + Intronic
998905544 5:146900786-146900808 CAGTGCATGGGGATGGGGCACGG - Intronic
999236830 5:150103657-150103679 CAGAGCAGTGGCATTGGAGCTGG + Intronic
999237793 5:150109355-150109377 CAGAGCAGGGCGGTGAGGGAAGG + Intronic
999310291 5:150547387-150547409 CAGGGGAGGGGGTTGGCGGCTGG + Intronic
999642601 5:153687033-153687055 AAGAGGAGGGAGATGGGGGGAGG - Intronic
1000018060 5:157295917-157295939 CAGAGCAGGGGAAATGGGCCTGG + Intronic
1000362537 5:160461249-160461271 CAGGGCAGGGGGATGGTTTCTGG + Intergenic
1001041552 5:168339272-168339294 AAGAGCAGAGGGATGAGGGTGGG + Intronic
1001333873 5:170782341-170782363 CAGAGCTGGGAGGTGGGGGTGGG - Intronic
1001370596 5:171196626-171196648 CTGAGCAGGGGGATGGGGCGAGG + Intronic
1001602072 5:172935345-172935367 CAGAGCAGGCGCAGGGTGGCTGG - Intronic
1001636081 5:173211361-173211383 CAAAGGAGGGGGCTGGGGGCTGG - Intergenic
1001788091 5:174431137-174431159 TATAGCAGGTGGATGTGGGCTGG - Intergenic
1001796747 5:174508478-174508500 CAAAGCAGGGGGCTGGGAGTGGG + Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1001963767 5:175896021-175896043 CTGAGCTGGGGGAGGGGGGAAGG - Intergenic
1002073545 5:176694895-176694917 CAGAGCAGTGGGCTGGTGGGTGG + Intergenic
1002078835 5:176725932-176725954 AGGAGCAGGCGGCTGGGGGCAGG + Intergenic
1002178334 5:177415570-177415592 CAGAGCCAGGGTATGGGCGCTGG + Intronic
1002621914 5:180494232-180494254 CAGCGCGGGGGTAAGGGGGCGGG + Intergenic
1002715297 5:181223418-181223440 CAGCGGCGGGGGATGGGGGTAGG + Exonic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1003139561 6:3458520-3458542 AAGAGCTGGGGGCTTGGGGCGGG + Intergenic
1003158799 6:3618263-3618285 CAGTGCCGGGGGTGGGGGGCAGG + Intergenic
1003268718 6:4589026-4589048 CCGAGCTGGGGGTGGGGGGCTGG - Intergenic
1003455547 6:6278521-6278543 CTGAGCAGGGGAATTGGGGGAGG + Intronic
1004342362 6:14818854-14818876 CAGGGCAGGGTGCTGGGGGTGGG - Intergenic
1004562568 6:16763345-16763367 CCAAGCAGGGTGTTGGGGGCGGG - Intergenic
1004574899 6:16886263-16886285 CAGTGAAGGGAGATGGGGGTGGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005410841 6:25544362-25544384 CAGAGTTGGTGGTTGGGGGCAGG + Intronic
1005897624 6:30191547-30191569 GAGTGAAGGGGGATGGGAGCAGG + Intronic
1005959753 6:30686699-30686721 CGGGGCAGAGGGGTGGGGGCTGG - Exonic
1006075310 6:31528896-31528918 CAGGGCTGGGGGCTGGGGCCTGG + Exonic
1006078285 6:31548326-31548348 CAGGGCAGGGGCATCGTGGCGGG - Exonic
1006295319 6:33167567-33167589 CAGAGGAGTGGGGTGTGGGCAGG + Intronic
1006303741 6:33207310-33207332 GAGAGCAGGAGGGAGGGGGCTGG + Intergenic
1006517161 6:34551455-34551477 CAGAGCAGGAGACTGAGGGCTGG - Intronic
1006990006 6:38207189-38207211 ATGAGCTGGGGGATGGGGGATGG + Intronic
1007721982 6:43890636-43890658 GAAACCAGGGGAATGGGGGCAGG - Intergenic
1007982298 6:46171380-46171402 CAAGGCAGGGGGCGGGGGGCGGG - Intergenic
1008088047 6:47264791-47264813 AAAGGCAGTGGGATGGGGGCGGG + Intronic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008536897 6:52513128-52513150 CAGAGCAGTGGGAGTGTGGCTGG - Intronic
1008761629 6:54859057-54859079 CAGTGCTGGGGGCTGGGGGGTGG - Intronic
1009307067 6:62103542-62103564 CAGAGGTGGGGGTGGGGGGCGGG - Intronic
1009359827 6:62797329-62797351 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
1009397453 6:63215834-63215856 CAGAGCAAAGTGCTGGGGGCTGG - Intergenic
1009464087 6:63950469-63950491 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1009596103 6:65738852-65738874 CAGAGCAGGAAGATGGGGCAAGG - Intergenic
1009624906 6:66126706-66126728 CAGAGACGGGGGATGGTAGCAGG + Intergenic
1010071204 6:71748460-71748482 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1011503189 6:88013268-88013290 AAGAGAAGGAGGATTGGGGCTGG + Intergenic
1011597434 6:89029593-89029615 CACAGCAGGGGCAGGAGGGCTGG - Intergenic
1012398725 6:98827684-98827706 CTGAGCAAGGGAAGGGGGGCCGG - Intergenic
1013479640 6:110542981-110543003 CAGGGTATGGGGTTGGGGGCTGG + Intergenic
1013618434 6:111866635-111866657 AAGAGCATGGGGTTGGGGCCGGG - Intronic
1014050951 6:116953675-116953697 CACAGCGTGGGGATGGGGGATGG + Intergenic
1014569968 6:122996602-122996624 CAGAGAAGAGGGGTGGCGGCGGG - Exonic
1014700883 6:124686445-124686467 CAGAGCAGGAGGAAAGGGGAGGG + Intronic
1016100887 6:140098745-140098767 AAGTGCAGGGGGAAGGGAGCAGG + Intergenic
1016608767 6:145964390-145964412 CAGCGCAGGAGAAAGGGGGCGGG - Intronic
1016879799 6:148899894-148899916 CACAGAAGGGTGATGGGGGGTGG - Intronic
1017858767 6:158376007-158376029 AAGAGCAGGGGCATGAAGGCCGG + Intronic
1017877822 6:158538121-158538143 CAGAGTAGGGGGCGGGGGACGGG - Intronic
1018252193 6:161882321-161882343 CACAGCAACGGCATGGGGGCGGG + Intronic
1018394805 6:163370050-163370072 CAGAGCAGCAGGATGGGGTGAGG - Intergenic
1018414563 6:163590169-163590191 CAGAGCAGAGGGAGGGCAGCTGG - Intergenic
1018443955 6:163838007-163838029 CAGTGCAGGGGGATGGGAAAGGG - Intergenic
1018558418 6:165074358-165074380 CAGTGCTGTGGGATGGGGACAGG - Intergenic
1018765895 6:166932440-166932462 CAGAGCTGGGGGCTGGGGGCTGG - Intronic
1018879323 6:167860966-167860988 CAGAGCATGGTGATGTAGGCAGG + Intronic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1019101377 6:169633264-169633286 AAGAGCAGGTGGACGGGGGTGGG + Intronic
1019146493 6:169978616-169978638 CTGAGCAGGTGGATGGCAGCGGG + Intergenic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019384799 7:748600-748622 CAGAGCAGGGGGGATGGGGGCGG - Intronic
1019417258 7:933511-933533 GAGAGCCGGGGGCCGGGGGCCGG + Intronic
1019429751 7:993202-993224 CAGGGCAGGGGGACGGCAGCTGG + Intergenic
1019446551 7:1074272-1074294 GATGGCAGCGGGATGGGGGCCGG - Intronic
1019480694 7:1265353-1265375 GGGAGCAGAGGGAGGGGGGCGGG + Intergenic
1019587774 7:1814314-1814336 GAAAGCAGGGTGGTGGGGGCTGG + Intergenic
1019712424 7:2523748-2523770 CTGAGCAGTGGGAGGGGTGCTGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019866171 7:3712517-3712539 CAGACCAGAGGGTTGGGGGATGG - Intronic
1020047144 7:5048843-5048865 CAGAGCAGGAGGAAGAGGGAGGG + Intronic
1020051355 7:5084109-5084131 CAAAAAAGGGGGATGGGGGCTGG - Intergenic
1020675396 7:11178098-11178120 GAGAGCAGTAGGGTGGGGGCTGG + Intergenic
1021126457 7:16855580-16855602 AAGAGAAGGGGGCTGGGGACAGG + Intergenic
1021758770 7:23882629-23882651 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1021819272 7:24480179-24480201 CAGAGCAGGGGGAAATAGGCAGG - Intergenic
1021906395 7:25338482-25338504 CTGAGCAGGGGAATGGGGGAGGG + Intergenic
1021915277 7:25425631-25425653 CAGAGAAGGGGGCTATGGGCTGG - Intergenic
1021969611 7:25952678-25952700 CCGAGGAGGGGGTGGGGGGCTGG - Intergenic
1022140204 7:27487055-27487077 CAGAGCAGGTAGATGTGGGAGGG - Intergenic
1022367059 7:29731547-29731569 CAGAACTGGGGGATGGGGGGTGG + Intergenic
1022465321 7:30649430-30649452 CAGGGCAGGGGGCTGGGGGCAGG + Intergenic
1022508774 7:30922356-30922378 CAGCGCTGGGGGCTGGGGGCAGG + Intronic
1022573031 7:31472078-31472100 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1023217851 7:37884582-37884604 CAGAGGATTGGGATGGGAGCAGG - Intronic
1023528922 7:41133573-41133595 CAGAAGAAGGGGGTGGGGGCGGG + Intergenic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1024024826 7:45401196-45401218 CAGTGCAGGAGGATGGTGGAGGG + Intergenic
1024030298 7:45455040-45455062 GGGAGTAGGGGGATGGGGGAGGG - Intergenic
1024427801 7:49247765-49247787 CAGGGTAGGGGGATGGGGATTGG - Intergenic
1024743964 7:52386054-52386076 GAGGGAAGGGGGATGGGGGTGGG + Intergenic
1025108971 7:56196856-56196878 CAGGGCAGGGGGATGAGGGGAGG - Intergenic
1025250853 7:57350463-57350485 GACAGCAGGGGCATGGGGGCAGG - Intergenic
1025275707 7:57580139-57580161 TAGAGCAGTAGGATGGTGGCCGG + Intergenic
1026035160 7:66825239-66825261 CAGGGCAGCTGGAGGGGGGCTGG + Intergenic
1026304135 7:69125224-69125246 AAGAGCAGGGGGAAGGGGGGCGG + Intergenic
1026555160 7:71401905-71401927 CAGAGCAGAGGGATGGTTTCAGG - Intronic
1026607190 7:71826215-71826237 GGGAGCAAGGGGATGGGGCCAGG + Intronic
1026724777 7:72862822-72862844 AGGAGCAGGGGGAGGGGGGTGGG - Intergenic
1026847308 7:73705369-73705391 CAGAATTGGGGGAGGGGGGCGGG - Intronic
1026896094 7:74010832-74010854 CAGAGCTGGGGGCTGGGTGCGGG - Intergenic
1027195839 7:76029529-76029551 CAGGGCAGTGGGCTGGGGGGCGG + Intronic
1027266626 7:76498351-76498373 CAGAGCCCTGGGCTGGGGGCAGG - Intronic
1027270349 7:76515355-76515377 CAGAGGAGAGGCAGGGGGGCTGG - Exonic
1027318007 7:76996469-76996491 CAGAGCCCTGGGCTGGGGGCAGG - Intergenic
1027990690 7:85357002-85357024 CAGAAATGGGGGATGGGGACAGG - Intergenic
1029211876 7:98916030-98916052 CAGGGCCAGGGGAGGGGGGCAGG - Intronic
1029269728 7:99369900-99369922 CAGACCAGGGAGATGGGAGATGG - Intronic
1029381129 7:100215425-100215447 CAGAGCTGGGGTGTGGGGGAAGG + Intronic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1029538121 7:101167511-101167533 GAGAGCAGTGGGATGGGGAGGGG + Intergenic
1029588765 7:101493215-101493237 AAGGGCAGGGGGAAGGGGGTGGG - Intronic
1030441978 7:109597290-109597312 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
1030665518 7:112273417-112273439 CACTGCTGGGGGATGGGGGAAGG + Intronic
1031297115 7:120014712-120014734 CAGCGCAGGGAGATAGGGGTGGG - Intergenic
1032097666 7:128947565-128947587 CAGTGCTGGGGGATTGGGGTAGG + Intronic
1032204594 7:129850849-129850871 GAGGGAAGGGGGATGGGGGGAGG + Intronic
1032283401 7:130523958-130523980 CGGGGCAGGGGGATGAGGGTGGG + Intronic
1032549415 7:132770706-132770728 AAGATCAGGTGGATGGGGGGGGG + Intergenic
1033168132 7:139059152-139059174 CAGAGTAGGAGGATGGGGAGGGG - Intronic
1033343890 7:140512539-140512561 CAGGGGTGGGGGATGGTGGCAGG + Intergenic
1033591081 7:142809055-142809077 CATAGGAGGGGGTTGGGTGCCGG - Intergenic
1033731720 7:144187226-144187248 CAGAGAGTTGGGATGGGGGCAGG - Exonic
1033742570 7:144285809-144285831 CAGAGAGTTGGGATGGGGGCAGG - Intergenic
1033743093 7:144289919-144289941 GAGAGGGGGGGGATGGGGGCAGG - Intergenic
1033750805 7:144359680-144359702 GAGAGGGGGGGGATGGGGGCAGG + Intronic
1033751333 7:144363805-144363827 CAGAGAGTTGGGATGGGGGCAGG + Exonic
1034226620 7:149489764-149489786 CAGGGCAGGAGGAGAGGGGCTGG + Intronic
1034270626 7:149802019-149802041 CACTGCAGGGGCATGGGGGCCGG - Intergenic
1034398572 7:150846464-150846486 CAGAGCAGGGGCATGTGGTGGGG - Intronic
1034707509 7:153158670-153158692 CAGAGATGGGGGTTGGGGGCTGG + Intergenic
1034774553 7:153813167-153813189 CAGGGTGGGGGGATGGGGGAAGG - Intergenic
1034895600 7:154874633-154874655 CTGAGGAGTGGGGTGGGGGCAGG - Intronic
1034937556 7:155209838-155209860 CAGGGTAGGGGGAAGGGAGCGGG - Intergenic
1035019894 7:155794574-155794596 CTCAGGAGGGGGGTGGGGGCAGG + Intergenic
1035221601 7:157409714-157409736 CAGAGCAGAGGGAGGGAAGCTGG - Intronic
1035262665 7:157671650-157671672 AAGGGCAGGGGCATGCGGGCTGG + Intronic
1035346800 7:158205717-158205739 CACTGCAGGGGGATGGGTGAGGG - Intronic
1035352952 7:158259269-158259291 CAGAGAAGGGCCATGGGAGCAGG + Intronic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035389726 7:158496694-158496716 CAGGGAAGGGGGAGGGGTGCAGG - Intronic
1035389946 7:158497219-158497241 CAGGGAAGGGGGAGGGGCGCAGG - Intronic
1035564347 8:631263-631285 TGGAGCAGGGGCACGGGGGCTGG - Intronic
1035690554 8:1556933-1556955 CAGCACAGCGGGATGGGGGCTGG + Intronic
1035690576 8:1557027-1557049 CTCAGCACGGGGGTGGGGGCTGG + Intronic
1035892623 8:3362205-3362227 CAGAGTAGGGATATGGTGGCTGG - Intronic
1036442963 8:8797561-8797583 CACTGCCCGGGGATGGGGGCAGG + Intronic
1036653967 8:10663666-10663688 GGGAGCATGGGGGTGGGGGCTGG - Intronic
1036685980 8:10910600-10910622 CTGAGCAGCTGGCTGGGGGCTGG + Intronic
1036708158 8:11060137-11060159 CAGAGCTTGGGGAGGGTGGCAGG + Intronic
1036788494 8:11703117-11703139 CAGATTAGAGGGATGGGGGAAGG - Intronic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037742910 8:21621735-21621757 CAGAGGGGGTGGATGGGGGTGGG - Intergenic
1037813984 8:22102380-22102402 CGGGGCAGGTGGTTGGGGGCTGG + Intronic
1037819069 8:22127104-22127126 CAGAACAGGGGGCTGGGGGTTGG - Exonic
1038275415 8:26117037-26117059 CTGAGCAGGGGGTGGGGGTCTGG - Intergenic
1038296132 8:26291957-26291979 CAGAGGGGTGGGGTGGGGGCGGG + Intronic
1038539997 8:28384421-28384443 CAGAGAAGGGAGTTGTGGGCAGG - Intronic
1039443427 8:37611471-37611493 CAGAGCAGGAAGAGGGGGACAGG + Intergenic
1039783760 8:40813996-40814018 GGGAGCAGGGGGCTGGGGACGGG + Intronic
1039881481 8:41627952-41627974 CAGTGCAGTGGGATGGGTGTGGG - Intergenic
1040011085 8:42661671-42661693 CAGAGCAAGAGCATGTGGGCAGG + Intergenic
1040279125 8:46029159-46029181 TAGAGCAGGGGGACTGGGGCCGG + Intergenic
1040389831 8:46940481-46940503 CAGTGGAGGGTGCTGGGGGCTGG + Intergenic
1040875915 8:52152097-52152119 CAGAGCAGCAGGCTGGGCGCAGG - Intronic
1040989628 8:53335917-53335939 CAGAGTAGGCAGATGGGGGGTGG - Intergenic
1041208512 8:55523192-55523214 CAGAGCTGGGGGCTTGGGGAAGG - Intronic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041648056 8:60273821-60273843 CAGCAGAGAGGGATGGGGGCAGG + Intronic
1042251024 8:66756394-66756416 CAGAGGAGGGTTATGTGGGCTGG + Intronic
1042631776 8:70825192-70825214 AAGTGCAGGGGGATAGAGGCAGG - Intergenic
1042820620 8:72926093-72926115 CAGGGCTGGGGGTTGGGGGAGGG + Intronic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1043463750 8:80486135-80486157 CCGGGCTGGGGGAGGGGGGCTGG - Intronic
1043606855 8:82011085-82011107 CAGACTAGGGGGACAGGGGCAGG - Intergenic
1044193189 8:89343359-89343381 CACAGCTGGGGGATGGCGGAGGG + Intergenic
1044560457 8:93606850-93606872 CTGAACAGGGGGATGGGAGGTGG + Intergenic
1044605070 8:94041325-94041347 CAGGGCAGGGGAGTGGGGGTGGG - Intergenic
1044731023 8:95228864-95228886 CAGAGCAGGTGGAAGAAGGCTGG - Intergenic
1044821533 8:96158977-96158999 AAGAGCTCGGGGCTGGGGGCGGG + Intronic
1044922470 8:97180614-97180636 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
1045249702 8:100473254-100473276 CAGAGCAGTGGGAAGGGAGGAGG + Intergenic
1045737857 8:105318257-105318279 CGGTGGTGGGGGATGGGGGCAGG - Intronic
1045987403 8:108264567-108264589 GAGAGCAGGAGGAAGGTGGCAGG - Intronic
1046511915 8:115213402-115213424 CAGAGAAGGGGGTTGGGGCACGG - Intergenic
1046520672 8:115321053-115321075 TAGAGCAGGAAGAAGGGGGCTGG - Intergenic
1046986279 8:120391813-120391835 TGGGACAGGGGGATGGGGGCTGG - Intronic
1047148191 8:122229885-122229907 GAGAGCAGGTGGATGGGGAGGGG + Intergenic
1047301617 8:123618326-123618348 CACAGCAGGAGGTGGGGGGCAGG + Intergenic
1047522559 8:125606448-125606470 CAGACCAGGGGACTGGGGGCAGG - Intergenic
1048764568 8:137830268-137830290 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1049023177 8:139971347-139971369 CAGGCCAGGAGGTTGGGGGCGGG - Intronic
1049145651 8:141000212-141000234 CAGAGTCGGGGGCTGGGGGCGGG + Intronic
1049204026 8:141355036-141355058 GAGAGCTGGGGGCTGGGGGAAGG + Intergenic
1049239862 8:141531838-141531860 CAGAGCAGGGGCAGGAAGGCAGG + Intergenic
1049308094 8:141918161-141918183 AAGAGGAGGGGGATGGGGTGAGG + Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049404179 8:142444299-142444321 GAGAGGAAGGGGATGGGGGATGG + Intergenic
1049408587 8:142462539-142462561 CAGAGCAGGGAGCTGGGCCCAGG - Intronic
1049422947 8:142524935-142524957 CAGAGTAGAGAGGTGGGGGCTGG - Intronic
1049567480 8:143348593-143348615 GAGAGCTGGGGGGTGGGGGGGGG + Intronic
1049774060 8:144396649-144396671 CAGAGGAGGGGGCTGGGGCCCGG - Exonic
1052834378 9:33239801-33239823 CAGAGAAGGGGGCTGGAGCCTGG - Intronic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1052947420 9:34179279-34179301 CGGAGTTGGGGGAGGGGGGCTGG + Intronic
1053142424 9:35690096-35690118 GGGAAGAGGGGGATGGGGGCGGG - Exonic
1053309772 9:37010399-37010421 AAGTGCTGGGGCATGGGGGCTGG - Intronic
1053350722 9:37411768-37411790 AGGAGCAAGGGGATGGAGGCAGG - Intergenic
1053454960 9:38226893-38226915 CAGAGTAAGGGGGCGGGGGCTGG + Intergenic
1053511614 9:38692860-38692882 CATAGGAGGGGGAGGGGTGCAGG - Intergenic
1053700605 9:40686073-40686095 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1053885926 9:42645213-42645235 CTGAGCAGTAGGAGGGGGGCTGG + Intergenic
1054224944 9:62452662-62452684 CTGAGCAGTAGGAGGGGGGCTGG + Intergenic
1054311897 9:63485471-63485493 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054410671 9:64809528-64809550 CAGTGTGGGGGGATGGGGGAGGG + Intergenic
1054907088 9:70420956-70420978 CGGCGCCGGGAGATGGGGGCGGG - Intergenic
1054978613 9:71177352-71177374 TAGACCAGGGGTAGGGGGGCAGG - Intronic
1055626366 9:78180982-78181004 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1055627259 9:78186697-78186719 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1056791395 9:89627607-89627629 CAGAGCAGGGCCAGTGGGGCAGG - Intergenic
1057067990 9:92073087-92073109 CTGGGCAGGGGCATGGGGGTCGG - Intronic
1057291207 9:93808625-93808647 CAGGGTAGGGGGATGGGGTTTGG + Intergenic
1057489030 9:95507797-95507819 CAGGGCAGGGGGCACGGGGCAGG + Intronic
1057813242 9:98273922-98273944 CAGTGCAGGGAGATGGGGTGGGG + Intergenic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057873639 9:98736425-98736447 CACAGCAGTGTGACGGGGGCAGG + Exonic
1057974464 9:99590008-99590030 CAGGGCCTGGGGATGGGGGTGGG + Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058045534 9:100353047-100353069 CAGAGCAGGGGGCTTCCGGCGGG - Intergenic
1058058465 9:100472976-100472998 CAGGGCAGGGGCGCGGGGGCCGG - Intronic
1060209215 9:121699822-121699844 CAAGGCAGGGGGATGGGTCCTGG - Intronic
1060301411 9:122376489-122376511 CAGGGCAGGGGATAGGGGGCAGG + Intronic
1060412188 9:123407148-123407170 CAGAGCAGGGGGGGAGGGGCGGG + Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060869852 9:127030770-127030792 CAGAGGGGTGGGATGGGGGCAGG + Intronic
1060882512 9:127128023-127128045 CAGAGAGGGGGGTGGGGGGCTGG - Intronic
1060892463 9:127197492-127197514 CAGAGCATGGGGGTGGGGGGCGG + Intronic
1061055420 9:128219901-128219923 GAGAGCAGGGGGATGGGAGTGGG + Intronic
1061147545 9:128808728-128808750 CAGGGCTGGGGGATGGGAACAGG - Exonic
1061159256 9:128883676-128883698 CAGAGCAGGGGGTGCAGGGCCGG + Intronic
1061162466 9:128903097-128903119 AATAGCAGGGGGATGTTGGCAGG + Intronic
1061209708 9:129183722-129183744 GAGACTGGGGGGATGGGGGCTGG + Intergenic
1061252689 9:129436016-129436038 CAGCGCTGGGGCAGGGGGGCGGG - Intergenic
1061551417 9:131336943-131336965 CAGCGCGGAGCGATGGGGGCCGG + Intergenic
1061559640 9:131394256-131394278 CAGACCAGGTGGGTCGGGGCCGG + Intronic
1061825561 9:133256360-133256382 CAAGGCAGGCGGACGGGGGCTGG + Intronic
1061854912 9:133436791-133436813 CAGAGGAGGGGGATGGCGGTGGG - Intronic
1061861896 9:133472573-133472595 CAGGGCAGGGGGGTTGGGGGAGG - Intronic
1061881918 9:133573001-133573023 CCGAGCCAGGGGGTGGGGGCTGG - Intronic
1061970021 9:134039905-134039927 GAAACCAGGGTGATGGGGGCAGG - Intronic
1062035906 9:134382414-134382436 CAGAGCTGGGGGCTGGGGCGGGG + Intronic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062190664 9:135246343-135246365 CCGAACAGGGCCATGGGGGCTGG + Intergenic
1062205733 9:135335856-135335878 CAGAGCAGGTGCAGGGGTGCTGG + Intergenic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1062251808 9:135601562-135601584 CAGAGCTGGGGGGTGGGGTGGGG + Intergenic
1062278220 9:135740553-135740575 CAGAGCCTGGGGCTGGGGTCGGG - Intronic
1062336818 9:136074893-136074915 CAGGGCCGGGGGATGCTGGCGGG + Intronic
1062338583 9:136083375-136083397 CAGAGAAGAGGGAGTGGGGCAGG + Intronic
1062402137 9:136377454-136377476 TGGAGCAGTGGGGTGGGGGCTGG - Intronic
1062430185 9:136523447-136523469 CACGGCAGGAGGAAGGGGGCAGG + Intronic
1062478847 9:136742353-136742375 CAGAGTTGGGGGCCGGGGGCCGG - Intronic
1062520071 9:136954097-136954119 CTTGGCAGGGGGTTGGGGGCTGG - Intronic
1062522770 9:136965298-136965320 CACAGCAGTGGCCTGGGGGCAGG + Intergenic
1062686629 9:137817013-137817035 CAGGGCTGGGGGAGGGTGGCAGG - Intronic
1203768187 EBV:37242-37264 CAGAGCAGGGGGAGGGGCAGGGG + Intergenic
1185450598 X:279010-279032 CAGCGAAGGGAGATGGGGGAGGG + Intronic
1185459824 X:328859-328881 GAGAGGAGGGGGAGGGGGGAGGG - Intergenic
1185617782 X:1433794-1433816 CAGCGCAGGGTGCTGGGTGCAGG - Intronic
1185857931 X:3553245-3553267 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1186287941 X:8065631-8065653 CAGGGGAGGGGAATGGAGGCAGG + Intergenic
1186342215 X:8657054-8657076 CAGAGAAGTGGGAAGGGGGCAGG + Intronic
1186391532 X:9164643-9164665 CAGAGCAGGGGCAAGGGGAGTGG + Intergenic
1186420401 X:9420936-9420958 TACGGCAGGGGGCTGGGGGCCGG - Intergenic
1186653892 X:11592150-11592172 CAGAGGAGGAAGATGGGGGAAGG + Intronic
1187086050 X:16044813-16044835 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1187375543 X:18749754-18749776 CAGAACGGGGGGGTGGGGGTGGG - Intronic
1188348099 X:29093323-29093345 CAGAGCAGGAGGAGGGGGGTGGG + Intronic
1188388488 X:29591098-29591120 CAGAGCAGTGGGAGGGGAGATGG + Intronic
1189256345 X:39642600-39642622 CAGAGGAGAAAGATGGGGGCAGG + Intergenic
1189483648 X:41412314-41412336 CTAAGCATGGGGGTGGGGGCAGG + Intergenic
1189515126 X:41705887-41705909 CAGACCACGGGGAGGGGTGCCGG - Intronic
1190053993 X:47171376-47171398 CAGTGCTGGGGGATAGGAGCTGG - Intronic
1190128690 X:47726811-47726833 CAGAGCAGGGTGGTGGGGGGAGG - Intergenic
1190367399 X:49709336-49709358 CAAAGCATGGGGGTGGGGGAGGG + Intergenic
1190736138 X:53256833-53256855 CTCAGCTGGGGGAAGGGGGCAGG + Intronic
1190874444 X:54449627-54449649 CAGTGCAGGGGAAAGAGGGCGGG + Intronic
1190957260 X:55207922-55207944 CAGGGCAGGGGGCGGGGGGCGGG + Intronic
1190979197 X:55440955-55440977 CACAGGAGAGGAATGGGGGCAGG - Intergenic
1191671738 X:63754745-63754767 GAGGGGAGGGGGATGGGGACGGG + Exonic
1192139870 X:68638365-68638387 GTGGGCAGGGGGGTGGGGGCAGG - Intergenic
1192808194 X:74528257-74528279 GGCAGCAGCGGGATGGGGGCAGG + Intronic
1192875362 X:75223706-75223728 CACTGCTGGGGGATGGAGGCGGG + Intergenic
1193278506 X:79620467-79620489 CAGAGCAGGAGGTAGGCGGCAGG + Intergenic
1193547427 X:82846920-82846942 CAGAGCAGGAGGAAGTGGGAGGG - Intergenic
1193701951 X:84773841-84773863 CAGAGTCGGGGGAGGGGGGAGGG - Intergenic
1193749652 X:85326551-85326573 CACAGCAGGGGATTGGGGGGCGG + Intronic
1193994042 X:88343514-88343536 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1194522453 X:94935751-94935773 CAGAGCAGGGGTATGGGGGTCGG - Intergenic
1195477682 X:105304994-105305016 CAGAGCAGGAGGAAAGGGGGAGG + Intronic
1195907267 X:109856768-109856790 CAGAGAGAGAGGATGGGGGCAGG + Intergenic
1195966378 X:110433475-110433497 AAGGGCAGGGAGATGGGGGAAGG + Intronic
1196287594 X:113900258-113900280 CAGTGAATGGGGATGGGGGTGGG - Intergenic
1196723335 X:118875136-118875158 CAGAGCAGGGCCTTGAGGGCAGG + Intergenic
1197706778 X:129639898-129639920 GAGTGCAGGGGGATGGAGGAGGG - Intergenic
1197727836 X:129788111-129788133 CTGGGCAGGGGGGTGGGGGTGGG + Intronic
1198161267 X:134010970-134010992 CAGAGCAGGGGGCAGGTGTCTGG + Intergenic
1198518148 X:137428549-137428571 CAGCCCGGGGGGAGGGGGGCTGG + Intergenic
1199612785 X:149631920-149631942 GATGGCAGGGGGATGGAGGCTGG + Intergenic
1199976023 X:152895366-152895388 CAGAGCCAGGGGGTGGGAGCTGG + Intergenic
1200065813 X:153503650-153503672 CAGAGGTGGGTGCTGGGGGCAGG + Intronic
1200069030 X:153518672-153518694 CAGGGCAGGGGCATGGCGCCGGG + Intronic
1200102370 X:153694465-153694487 CTGGGCTGGGGGATGGTGGCGGG + Intronic
1200164692 X:154027835-154027857 CAGAGCAGGTGGAAGGGATCAGG + Intronic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic
1202119572 Y:21509307-21509329 GTGGGCAGGGGGTTGGGGGCGGG + Intergenic
1202122024 Y:21532847-21532869 GTGGGCAGGGGGTTGGGGGCGGG + Intronic
1202156982 Y:21896535-21896557 GTGGGCAGGGGGTTGGGGGCGGG - Intronic
1202159428 Y:21920076-21920098 GTGGGCAGGGGGTTGGGGGCGGG - Intergenic
1202185876 Y:22184991-22185013 GTGGGCAGGGGGTTGGGGGCGGG - Intergenic
1202205484 Y:22401405-22401427 GTGGGCAGGGGGTTGGGGGCGGG + Intronic
1202334211 Y:23789816-23789838 CAGAGGAGAGGGCAGGGGGCGGG + Intergenic
1202536557 Y:25880243-25880265 CAGAGGAGAGGGCAGGGGGCGGG - Intergenic