ID: 1152879253

View in Genome Browser
Species Human (GRCh38)
Location 17:82806124-82806146
Sequence CGTGCACTCAGCGAAGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152879253_1152879265 27 Left 1152879253 17:82806124-82806146 CCGTCCCCTTCGCTGAGTGCACG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1152879265 17:82806174-82806196 CCCAGGCCTGTCCCTGACCATGG 0: 1
1: 0
2: 2
3: 61
4: 467
1152879253_1152879258 -4 Left 1152879253 17:82806124-82806146 CCGTCCCCTTCGCTGAGTGCACG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1152879258 17:82806143-82806165 CACGGTCACTGCCCGTCCTCTGG 0: 1
1: 0
2: 1
3: 8
4: 79
1152879253_1152879261 10 Left 1152879253 17:82806124-82806146 CCGTCCCCTTCGCTGAGTGCACG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1152879261 17:82806157-82806179 GTCCTCTGGCTCCTGAACCCAGG 0: 1
1: 0
2: 3
3: 15
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152879253 Original CRISPR CGTGCACTCAGCGAAGGGGA CGG (reversed) Intronic
905416129 1:37805685-37805707 CCTGCACTCTGAGAATGGGAAGG + Intronic
907502131 1:54888279-54888301 GGTGAACTCTGAGAAGGGGATGG - Intergenic
913592614 1:120342706-120342728 CAGGCACTGAGGGAAGGGGAGGG - Intergenic
913650739 1:120912424-120912446 CAGGCACTGAGGGAAGGGGAGGG + Intergenic
914170375 1:145216643-145216665 CAGGCACTGAGGGAAGGGGAGGG - Intergenic
914525491 1:148460609-148460631 CAGGCACTGAGGGAAGGGGAGGG - Intergenic
914598182 1:149175220-149175242 CAGGCACTGAGGGAAGGGGAGGG + Intergenic
914640909 1:149606519-149606541 CAGGCACTGAGGGAAGGGGAGGG + Intergenic
916408022 1:164516753-164516775 CGCACACTCAGAGAAAGGGAGGG - Intergenic
922972901 1:229758123-229758145 CACGCACTCAGCACAGGGGAAGG - Intergenic
923646479 1:235826563-235826585 CTTGCAGTGAGTGAAGGGGAGGG + Intronic
1063257262 10:4342110-4342132 CCTGCACTTAGGGAAGGAGAAGG + Intergenic
1065342034 10:24716555-24716577 GGTGCGCTCAGGGAGGGGGAAGG + Intronic
1067457242 10:46427809-46427831 AGGGCACTCAGGGAAGGAGACGG - Intergenic
1067629960 10:47956829-47956851 AGGGCACTCAGGGAAGGAGACGG + Intergenic
1069994549 10:72334565-72334587 CATGCACTGAGCCAAGGTGATGG - Exonic
1072298554 10:94036838-94036860 CGTGCACTCAGAGAATGTGAAGG + Intronic
1078414863 11:11156741-11156763 CGTGGACCCAGCCCAGGGGAGGG - Intergenic
1084610041 11:70196307-70196329 GCTGCACTCAGGGAAGGGAAAGG + Intergenic
1086063295 11:82721821-82721843 CGTGCATCCAAGGAAGGGGAAGG - Intergenic
1087268026 11:96082422-96082444 TGGACACTCAGGGAAGGGGATGG + Intronic
1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG + Intergenic
1089574321 11:119430871-119430893 GGTGCACTCAGCGCAGAGGTGGG + Intergenic
1091826287 12:3515162-3515184 CGTGCACTCAGCATAGGGTCTGG + Intronic
1102009143 12:109607322-109607344 TGTTCACTCAGCGCATGGGACGG + Intergenic
1102788771 12:115625774-115625796 CTTGGACTCAGTGAAGGGCAGGG - Intergenic
1104917761 12:132274616-132274638 ATTGCACTCAGCAGAGGGGAAGG + Intronic
1107818069 13:44262044-44262066 AGTGCACCCAGCTCAGGGGAGGG + Intergenic
1112197839 13:97242957-97242979 CATGCGCTCAGTGGAGGGGAGGG - Intronic
1116400034 14:44495446-44495468 CGTGCCCTCAGCTAAGAGAAAGG - Intergenic
1120760948 14:88284688-88284710 CGTGCTGGCAGCCAAGGGGATGG + Intronic
1122052602 14:99070240-99070262 CGTGCACTGAGGGAAGGACAGGG - Intergenic
1122261242 14:100524324-100524346 CGGGCACTCAGCGAGTGGCAGGG + Intronic
1124077799 15:26462251-26462273 TGGTCACTCAGGGAAGGGGAGGG - Intergenic
1128800155 15:70492174-70492196 AGTGCACCCAGGTAAGGGGAGGG + Intergenic
1140420931 16:74818113-74818135 TGTGCACTCAGCTAGGGGCATGG - Intergenic
1141046368 16:80719396-80719418 AGTGCACTCAGCACAGGGTAGGG + Intronic
1141472135 16:84246089-84246111 CGTGCAGTCAGAGATGGGGACGG + Intergenic
1141804776 16:86335516-86335538 AGTGGACGCAGCGAGGGGGAGGG - Intergenic
1144146370 17:12403212-12403234 CTGGCACTCAGGGAAGGGGAGGG + Intergenic
1144185271 17:12790296-12790318 CCTGAACTCGGCGCAGGGGAGGG - Intronic
1145877943 17:28334038-28334060 CATGCTCTCAGGGAAGGGGGTGG - Intronic
1146578006 17:34011821-34011843 GGAGCACTCAGAGAAGGGGCGGG - Intronic
1146694773 17:34900068-34900090 CCAGGACCCAGCGAAGGGGACGG - Intergenic
1147333005 17:39709898-39709920 CCTGGAGTCAGGGAAGGGGAGGG + Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1150389216 17:64781043-64781065 CGGGAACACAGAGAAGGGGAGGG + Intergenic
1152879253 17:82806124-82806146 CGTGCACTCAGCGAAGGGGACGG - Intronic
1155831886 18:30526336-30526358 GGTGCAGTCAGAGAAGGTGATGG - Intergenic
1160439280 18:78876565-78876587 AGTGCACTCAGCTCAGGGCAGGG - Intergenic
1161028565 19:2047743-2047765 CAGGCACTGAGCGAAAGGGAGGG - Intronic
1161238214 19:3208316-3208338 CCTGCAGTCGGAGAAGGGGAAGG - Exonic
925192354 2:1894735-1894757 CTTGCACTCAGCGTTGGTGAGGG + Intronic
931771333 2:65500630-65500652 CATGCACTAAGCCAAGGCGATGG - Intergenic
932422154 2:71607626-71607648 CTTGCACTGAGCAAAGGAGATGG + Intronic
938159444 2:128972639-128972661 CCTGCACTCAGCGGAGCGGAAGG - Intergenic
940225014 2:151392103-151392125 CATCCCCTCAGAGAAGGGGAGGG + Intergenic
942451356 2:176109523-176109545 CCTGCATTCACCGAAGAGGAAGG - Exonic
943496699 2:188629562-188629584 GGTGCCTTCAGCGAAGGGCAGGG + Intergenic
945093049 2:206194152-206194174 CATGAACTCAATGAAGGGGAGGG + Intronic
946190098 2:218003415-218003437 CGGGTACTCAGAGAAGGGGAGGG - Intergenic
948208976 2:236178626-236178648 CGCGCACTCGGAGAAGGGGCCGG - Intergenic
1169216817 20:3799026-3799048 CATGCCCACAGCCAAGGGGATGG - Intronic
1170870432 20:20200891-20200913 GGTGCACTGAGGGATGGGGAGGG + Intronic
1174758221 20:53181009-53181031 GGTACACTCAATGAAGGGGAGGG - Intronic
1176161288 20:63650220-63650242 CCTGAAGTCAGTGAAGGGGAAGG - Intronic
1176907499 21:14520725-14520747 TGTGCACTGGGGGAAGGGGACGG + Intronic
1179951449 21:44710997-44711019 CCTGCACTCAGCAAAGCGAAGGG - Intronic
1181518350 22:23430947-23430969 CCTGAACACAGTGAAGGGGATGG - Intergenic
1185341167 22:50291789-50291811 GGTGCACTCAGGGAAGATGATGG - Intronic
950865202 3:16183173-16183195 CCTGCACAAAGAGAAGGGGATGG + Intronic
961817347 3:129558015-129558037 CGAGCATTCAGTGAAGGGGTGGG - Intronic
966177576 3:177155764-177155786 CGTGCACTCCGGGAAGAGGGCGG + Intronic
969120092 4:4902100-4902122 GGTGTGCTGAGCGAAGGGGAAGG + Intergenic
973224133 4:47763396-47763418 GATGCACTCAGGGAAGGCGAGGG + Exonic
976123248 4:81805610-81805632 CCTCCATTCAGGGAAGGGGAAGG - Intronic
981004074 4:139857245-139857267 TGTGCACCCAGCCAAGCGGAAGG + Intronic
983217282 4:165013751-165013773 CCTGGACTCAGGGAAGGGGCAGG + Intergenic
989982999 5:50666166-50666188 CAGGCACTGAGGGAAGGGGAGGG + Intronic
993382792 5:87227085-87227107 CTTGCAGTGAGGGAAGGGGAAGG - Intergenic
995225400 5:109694871-109694893 ACTGCACTCAAGGAAGGGGAAGG - Intronic
995611155 5:113911743-113911765 CGTGCACTCAGCTAAGACCATGG - Intergenic
1004556635 6:16704886-16704908 TAAGCACTCAGCGAGGGGGAGGG + Intronic
1008807623 6:55451072-55451094 TGTGCACAAAGAGAAGGGGATGG + Intronic
1018388972 6:163328796-163328818 CGTGCACTCAGGGAATGTTAGGG - Intergenic
1019481959 7:1270951-1270973 TGTGCACTCAGGGCAGGAGATGG + Intergenic
1025144377 7:56491980-56492002 CCTGCCCTCAGCGATGTGGATGG + Intergenic
1026894889 7:74004261-74004283 CAGGCACCCAGGGAAGGGGAAGG - Intergenic
1029462811 7:100706042-100706064 CTTGCGCTCAGGGAAGGGGCGGG + Exonic
1031977513 7:128103537-128103559 CCTCCACTCAGCGCAGCGGACGG - Intergenic
1035308988 7:157952955-157952977 CATGCACACAGTGAAGGGGACGG + Intronic
1038000410 8:23386754-23386776 CTTGCATTCAGCGTAGAGGAGGG - Intronic
1039903182 8:41767331-41767353 CGTGCACTCACCGCAGGGTCTGG + Intronic
1059353377 9:113681791-113681813 CGTGCAGTTAGTGCAGGGGATGG - Intergenic
1059419354 9:114181359-114181381 GGTGCATTCGGAGAAGGGGAGGG + Intronic
1062286943 9:135777591-135777613 CGTGCCCTCTGCAAAGGCGAAGG - Intronic
1186522834 X:10221062-10221084 CGTGCAGCCAGAGAAGGGGGTGG + Intronic
1190316598 X:49155974-49155996 CGAGCACGCAGCGAAGGGGCAGG - Intergenic
1190318156 X:49164225-49164247 CGGGCACGCAGCGAAGGGGCAGG + Intronic
1201687884 Y:16727433-16727455 TGTGCATTCAGGGAAGTGGAGGG + Intergenic