ID: 1152881936

View in Genome Browser
Species Human (GRCh38)
Location 17:82822561-82822583
Sequence GGGCTTCAGGAACACAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152881932_1152881936 -10 Left 1152881932 17:82822548-82822570 CCAGATCCTAGAGGGGCTTCAGG 0: 2
1: 0
2: 1
3: 6
4: 136
Right 1152881936 17:82822561-82822583 GGGCTTCAGGAACACAGTGAGGG 0: 1
1: 0
2: 5
3: 53
4: 333
1152881929_1152881936 -2 Left 1152881929 17:82822540-82822562 CCTGGGGGCCAGATCCTAGAGGG 0: 1
1: 1
2: 0
3: 15
4: 157
Right 1152881936 17:82822561-82822583 GGGCTTCAGGAACACAGTGAGGG 0: 1
1: 0
2: 5
3: 53
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152881936 Original CRISPR GGGCTTCAGGAACACAGTGA GGG Intronic
900148608 1:1168735-1168757 GAGCTTCAGGAAGCCAGCGAGGG + Intergenic
900986400 1:6075392-6075414 CTCCATCAGGAACACAGTGATGG + Intronic
901232131 1:7647165-7647187 GGGCCTCCGGAACAGAGGGAGGG - Intronic
901497193 1:9628995-9629017 GGGCTTCATGACCCAAGTGAGGG + Intergenic
902636007 1:17735574-17735596 GGGCTGCAGGAACCCAGGGGAGG - Intergenic
902842369 1:19083133-19083155 GGGCCCCAGGAACACTGAGAAGG + Intronic
903127525 1:21258015-21258037 GGGATTCAAGAAGACAGTGCTGG + Intronic
903650588 1:24919304-24919326 GGGGTTGGTGAACACAGTGATGG + Exonic
904355579 1:29936887-29936909 GGCCCTAAGGGACACAGTGAAGG - Intergenic
905502700 1:38452250-38452272 GGGCTTCATGAAGTCAGGGAGGG - Intergenic
905580515 1:39080775-39080797 GGGCTTCTGGAACTGAATGAAGG - Intergenic
906089137 1:43163134-43163156 GGGCTGCAGAAACAGAATGAAGG + Intergenic
906288754 1:44605660-44605682 AGGCTTCGGGAACACAGAGGAGG + Intronic
906639149 1:47431219-47431241 GAGCTTCAGGAACACAGAGGTGG + Intergenic
906941650 1:50260835-50260857 GGGGTTCAGCAACTCAGTCAAGG + Intergenic
907305700 1:53511871-53511893 GGGCTTCAGGAAACCAGGGGAGG - Intronic
910254923 1:85238300-85238322 GTGCTTCCAGAAAACAGTGAAGG - Intergenic
912954230 1:114142311-114142333 GGGGTTCAAGACCTCAGTGAAGG + Intronic
913126656 1:115797015-115797037 GGGCTTCAGGGACTCAGAAACGG - Intergenic
913490056 1:119370740-119370762 GGCCTTCAGAAACACAGTCTGGG + Intronic
914913679 1:151805322-151805344 GGGGTTGAGGCACACAGGGAAGG - Exonic
915164346 1:153940327-153940349 GAGCTTCAGGCACAAAGTGAGGG - Intronic
915781996 1:158562686-158562708 GGCCTTCAGGAAGACAGTGATGG - Exonic
916705282 1:167342949-167342971 GAGCCTCAGGAGCTCAGTGAAGG + Intronic
916715539 1:167443886-167443908 GGGCCTGAGGAAGACAGTCATGG + Intronic
917029013 1:170669286-170669308 GGGCTTCAGGCAGACAGCAATGG + Intronic
917426215 1:174917195-174917217 GGGCTTCAGTATCTCAGTGTGGG + Intronic
918070382 1:181129853-181129875 GGGCTCCAGGAACAGAGCCAGGG - Intergenic
918315731 1:183321265-183321287 GGGCTTCATGAACATAATAAAGG - Intronic
920218363 1:204377662-204377684 GGGCTGCAGGGACACCGAGATGG - Intronic
920837607 1:209526196-209526218 GGGCTGCAGGAGCACAGAGGAGG - Intergenic
921578360 1:216864836-216864858 GGGATGCAGGATCACACTGAAGG + Intronic
922134146 1:222808225-222808247 GGGCTGCAGGAAGAAACTGAAGG + Intergenic
923941934 1:238837482-238837504 GGCCTTCAGGAAGGCAGTTAAGG + Intergenic
924605290 1:245529046-245529068 GGGCTTCAGGACCCAAGAGAAGG - Intronic
1063149274 10:3321936-3321958 GGCCTTCAGCAACAGACTGAAGG + Intergenic
1063306343 10:4904812-4904834 GGACTTTAGGAACACAAGGATGG - Intergenic
1063742628 10:8840432-8840454 AGGCTTCAAGAACACAGCCAAGG - Intergenic
1065759165 10:28965864-28965886 AGGCTTCAGGACCACACTGCTGG - Intergenic
1066263752 10:33754756-33754778 GGGCTTCAGGCATCCACTGAGGG + Intergenic
1067279169 10:44858346-44858368 GGGCTTAAGAGACAGAGTGAGGG + Intergenic
1067531226 10:47075271-47075293 GGGCTTCAGAAAGAGAGAGATGG - Intergenic
1067700020 10:48564679-48564701 GGGCTGCAGAAACACTGTGCAGG - Intronic
1067792130 10:49296374-49296396 AGGCCTCTGGAACACTGTGAGGG - Intergenic
1070148833 10:73793063-73793085 GGGCAACAGGAACCCATTGAAGG - Intronic
1070558414 10:77547433-77547455 TGGCTTTAGGAAGACAGGGAGGG + Intronic
1070823847 10:79379708-79379730 GAGCTTCAGCACCACAGTGGGGG + Intergenic
1071054830 10:81497400-81497422 GTGGTGCAGGAACACAGAGAAGG - Intergenic
1071114551 10:82202181-82202203 GGGCTTAGTGAACACAGTGCTGG - Intronic
1071420398 10:85491492-85491514 TTGCTTCTGGAACACAGTGCAGG - Intergenic
1072756905 10:98027517-98027539 GGGTTCCAAGACCACAGTGAGGG + Intronic
1072825258 10:98599402-98599424 GGGCTTCAGGCCCACCCTGAAGG - Intronic
1073335581 10:102705770-102705792 GGGCTTTAGGAACACAGATGGGG - Intronic
1073706495 10:105989872-105989894 GGGCTTCAGTGACACATTGCAGG + Intergenic
1073766196 10:106685360-106685382 GGGCTTCATGAACCTAGGGACGG - Intronic
1075648153 10:124109861-124109883 GGGCCTCGGGAACCCACTGAAGG + Intergenic
1076607576 10:131699300-131699322 GGGAGTCAGAAACCCAGTGACGG - Intergenic
1077052672 11:574826-574848 GGGCTTCTGGAAGCCAGAGAGGG - Intergenic
1077781449 11:5334320-5334342 GGGCTTTAAGAACACAGTTCTGG - Intronic
1078134315 11:8639796-8639818 GAGCTTAAGGAGCAGAGTGAGGG - Intronic
1078387312 11:10903848-10903870 GGGCTTCTACATCACAGTGATGG + Intergenic
1078581760 11:12544277-12544299 AGGCTCCTGGAACACAGGGAAGG + Intergenic
1079032550 11:16996514-16996536 AGGTTTCAGGTACACAGGGATGG + Intronic
1079234871 11:18681012-18681034 GGGCTCCATGAAGACAGGGAAGG + Intergenic
1079314989 11:19399914-19399936 GGGCTTCAGGAATAGATTGTTGG + Intronic
1079989293 11:27230213-27230235 GAGCACCAGGAACACAGTAAAGG + Intergenic
1080657779 11:34271325-34271347 GGGACTCAAGGACACAGTGAGGG - Intronic
1081338189 11:41894270-41894292 GTACTCCTGGAACACAGTGAAGG + Intergenic
1083208814 11:61169935-61169957 GTGGTTCAGGAAACCAGTGAGGG + Intergenic
1083717794 11:64588465-64588487 GGGCTCTAGGCACACAGTGAGGG + Intergenic
1083749368 11:64752934-64752956 AGGCTTGGGGAACACAGTGCAGG + Intronic
1083913778 11:65726943-65726965 GGGCTTCTGGGTCACCGTGATGG - Intergenic
1084368139 11:68717065-68717087 GTGCTGCAGGAACACGGCGAGGG + Intronic
1084440176 11:69168231-69168253 GGGCTTCAGGCACCCACTGAGGG + Intergenic
1084946083 11:72639332-72639354 GGGCTGCAGCCACACAGAGAAGG + Intronic
1085397439 11:76213748-76213770 GGGCTTAGGGAAGACAGAGAAGG - Intergenic
1085715047 11:78864949-78864971 GGGCTAGAAGAACACAGGGAAGG + Intronic
1088838725 11:113604006-113604028 GGTATTCAGGAACAAAGGGAAGG + Intergenic
1089343916 11:117778047-117778069 GGGCTGCAGGTGCACAGTCAGGG - Intronic
1090037801 11:123263928-123263950 GGGCTGGAGGAACAGAGAGAAGG + Intergenic
1090737961 11:129628301-129628323 GGGCTTCAGGAGTTCAGTGGAGG - Intergenic
1091119191 11:133042581-133042603 GAGCTTCAGGAAGCCAGTGTGGG - Intronic
1091682938 12:2539954-2539976 AGGCTGGAGGAACAAAGTGAGGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1091790279 12:3268222-3268244 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790291 12:3268292-3268314 AGGCTGCAGGAACACAGAGGGGG - Intronic
1091790297 12:3268316-3268338 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790301 12:3268340-3268362 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790305 12:3268364-3268386 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790309 12:3268388-3268410 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790327 12:3268484-3268506 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790331 12:3268508-3268530 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790335 12:3268532-3268554 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790339 12:3268556-3268578 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790348 12:3268604-3268626 AGGCTGCAGGAACACAGGGAGGG - Intronic
1091790363 12:3268676-3268698 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790372 12:3268724-3268746 AGGCTGCAGGAACACAGGGAGGG - Intronic
1091790382 12:3268772-3268794 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790386 12:3268796-3268818 AGGTTGCAGGAACACAGAGAGGG - Intronic
1091790404 12:3268892-3268914 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790407 12:3268912-3268934 AGGCTGCAGGAACACAGGGCAGG - Intronic
1091790412 12:3268936-3268958 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790416 12:3268960-3268982 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790425 12:3269008-3269030 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790429 12:3269032-3269054 AGGCTGCAGGAACACAGGGAGGG - Intronic
1091790440 12:3269080-3269102 AGGCTGCAGGAACACAGGGAGGG - Intronic
1091790446 12:3269104-3269126 AGGCTGCAGGAACACAGGGAGGG - Intronic
1091790463 12:3269198-3269220 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790467 12:3269222-3269244 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790470 12:3269242-3269264 AGGCTGCAGGAACACAGGGCAGG - Intronic
1091790474 12:3269262-3269284 AGGCTGCAGGAACACAGGGCAGG - Intronic
1091790479 12:3269286-3269308 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790488 12:3269334-3269356 AGGCTGCAGGAACACAGGGAGGG - Intronic
1091790494 12:3269358-3269380 AGGCTGCAGGAACACAGGGAGGG - Intronic
1091790505 12:3269406-3269428 AGGCTGCAGGAACACAGGGAGGG - Intronic
1091790511 12:3269430-3269452 AGGCTGCAGGAACACAGGGAGGG - Intronic
1091790524 12:3269500-3269522 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790533 12:3269548-3269570 AGGCTGCAGGAACACAGAGAGGG - Intronic
1091790537 12:3269572-3269594 AGGCTGCAGGAACACAGAGAGGG - Intronic
1092095245 12:5836825-5836847 GGGCTTATGAAATACAGTGAAGG - Intronic
1092464837 12:8721629-8721651 GGGCTTCAAGACTTCAGTGAAGG - Intronic
1093680916 12:22002262-22002284 GGGTTTCAGGTAGTCAGTGATGG + Intergenic
1095491321 12:42736842-42736864 GGGCTTCAGGAATGATGTGATGG + Intergenic
1095754496 12:45748934-45748956 GGGCTTCAAGATTACAGTGGAGG - Intronic
1097107258 12:56633152-56633174 GTGCTGCAGGAACACAGGGAGGG - Intronic
1098831568 12:75371183-75371205 GGCCTTCAGCCACACACTGAAGG - Intronic
1099326310 12:81219282-81219304 GTGCTCCAGGAACACAAAGAAGG + Intronic
1099525443 12:83713123-83713145 GGGCTTGAGGGAACCAGTGAGGG + Intergenic
1100266591 12:92982489-92982511 GGCCTTCAGCCACAGAGTGAGGG + Intergenic
1101156893 12:101936160-101936182 GGGCCTGACGAACACAGGGAGGG + Intronic
1101911367 12:108862462-108862484 GGGCTGTAGGAGCACAGAGAAGG - Intronic
1102212953 12:111140118-111140140 GTCTTTAAGGAACACAGTGAGGG - Intronic
1102278234 12:111599020-111599042 GGGCTTCAGCGACATGGTGAGGG + Exonic
1103011937 12:117464657-117464679 GGGCGTCAGGAAGGCACTGAAGG + Exonic
1105439174 13:20401688-20401710 CAGCTTCAGGAAGACAGTTATGG - Intergenic
1105626409 13:22117277-22117299 GGGCTCCAGAAAGACAGGGATGG + Intergenic
1107795742 13:44049683-44049705 GTGATTCTGGAACACTGTGAAGG + Intergenic
1113676893 13:112213903-112213925 GGGCTTCAGGGCCACTGCGATGG + Intergenic
1113965739 13:114152563-114152585 GAGCTACAGGAAAACAGTGTTGG - Intergenic
1114021810 14:18486606-18486628 AGGATTCAAGAACACAGTGGCGG + Intergenic
1114967579 14:27982364-27982386 GGGCTCCTGGAAAACAGTAATGG + Intergenic
1115685097 14:35788588-35788610 CAGCTTCAGCAACATAGTGAGGG + Intronic
1115816081 14:37165818-37165840 GGTCTTTGGGAACACAGGGAAGG + Intronic
1117269679 14:54129806-54129828 GGGCTTCAAGACGTCAGTGAAGG + Intergenic
1117649941 14:57893241-57893263 TAGCTTCATGAAGACAGTGAGGG - Intronic
1117858409 14:60060906-60060928 GGGGTTCAGGACTTCAGTGAAGG + Intronic
1118378538 14:65198605-65198627 GGGCATCTGGAACTTAGTGAGGG + Intergenic
1119620892 14:76131218-76131240 GGGCTTTTGGGAAACAGTGACGG + Intergenic
1120015376 14:79467318-79467340 GGGCTTCAGCACCACTGTGAAGG + Exonic
1120525822 14:85575771-85575793 GGGCTTCAGGAGCTGGGTGAAGG - Intronic
1121001774 14:90456279-90456301 GGGCATCTGGAGCACAGGGAGGG + Intergenic
1121251684 14:92504463-92504485 GGGCTGCAGGAGCCCAGAGAAGG + Intergenic
1122342278 14:101036146-101036168 GAAGTTCAGGAACACAGTGTGGG + Intergenic
1124036648 15:26059300-26059322 GGGGTTCAGGACTTCAGTGAAGG + Intergenic
1124995484 15:34719608-34719630 TGGCTTCAGGACCCCTGTGAGGG + Intergenic
1125956761 15:43795711-43795733 GGGCAGCAGAAACACAGTGAGGG + Exonic
1127223753 15:56909042-56909064 GGGCATCAGAATCACAGGGAGGG + Intronic
1128118091 15:65125007-65125029 GGGCTTTAGGAGAGCAGTGAAGG - Intronic
1129743153 15:77999980-78000002 GGCCTTCAGAAACACAGGGAGGG - Intronic
1129842329 15:78751460-78751482 GGCCTTCAGAAACACAGGGAGGG + Intergenic
1129960005 15:79675593-79675615 AGAGTTCAGGAACACAGTGCTGG - Intergenic
1130316504 15:82801221-82801243 GAGGTTCTGGATCACAGTGATGG + Intronic
1131294554 15:91135700-91135722 GAGTTTCAGAAACACAGTAACGG - Intronic
1132062158 15:98701233-98701255 GGTCTACAGGCACACTGTGAAGG - Intronic
1132481253 16:167244-167266 GGGCTGCAGGGTCACAGGGAGGG - Intergenic
1132666854 16:1084907-1084929 GAGCTTCAGGAAGGCAGTGCTGG + Intergenic
1133203290 16:4217853-4217875 GGGCTAAAGGAACAGCGTGAAGG - Intronic
1136142104 16:28294180-28294202 GGGGTTCAGGACCTCACTGAGGG - Intronic
1136227614 16:28869480-28869502 GGGCATCTGGAAAACAGGGATGG - Intronic
1138650411 16:58457364-58457386 GGGCTGCAGGAGCACTATGATGG + Intergenic
1139443826 16:66984368-66984390 GGGCTTCTGGGACACATGGATGG + Intergenic
1139475952 16:67202655-67202677 GGGCTTCAGGGCCAGAGTGCGGG - Exonic
1141087252 16:81105081-81105103 GGGTTTCAGGAGCTCTGTGATGG - Intergenic
1141996071 16:87637057-87637079 GGGCTTTGAGAACACAGTCAGGG - Intronic
1142466335 17:139541-139563 GGACATCAGGAACACACTCAGGG + Intergenic
1143382385 17:6504429-6504451 GGGCTACAGAAACAGGGTGATGG - Intronic
1143393613 17:6575296-6575318 GGGCTTCCGGGACACAGGCACGG + Intergenic
1144467600 17:15508800-15508822 AGGCATGAGGAACACAGGGAAGG - Intronic
1145244986 17:21262806-21262828 GGGCTGCAGGAGCCCTGTGAAGG - Intergenic
1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG + Exonic
1146562699 17:33884769-33884791 GGGCTTCAGGGAACCATTGAAGG - Intronic
1148145461 17:45361816-45361838 GGGCTTCTGGGGCACTGTGAGGG - Intergenic
1148794845 17:50192009-50192031 GGTCTCCAGGAACACCCTGAGGG + Exonic
1150006288 17:61470906-61470928 GGGCTTCAGGAAGTCAGGGAGGG + Intronic
1150437452 17:65165058-65165080 GGGCTCCAGGGACACAGAGATGG + Intronic
1150610253 17:66727781-66727803 GGTCTTCAGGAAGACAGAGGAGG + Intronic
1151042550 17:70880109-70880131 GGACTTCTGGAAGACAGTAATGG + Intergenic
1151250667 17:72831828-72831850 CAGCTTCAGCAACACAGAGATGG - Intronic
1151748413 17:76023712-76023734 GGGGCTCAGGCCCACAGTGATGG - Intronic
1152225786 17:79092067-79092089 GGGCTCCAGGCACCCAGTGTGGG - Intronic
1152459976 17:80437392-80437414 GGGTTTCAGGAGGACAGTGGGGG + Exonic
1152881936 17:82822561-82822583 GGGCTTCAGGAACACAGTGAGGG + Intronic
1152897472 17:82921023-82921045 GGGCTGCCAGAGCACAGTGAAGG + Intronic
1153089246 18:1324900-1324922 GGGCTTGGGTAACACAGGGAAGG + Intergenic
1155150832 18:23121619-23121641 GGTCTCAAGGAACACAGAGATGG - Intergenic
1155441812 18:25870120-25870142 AGGCTGCAAGAACCCAGTGAGGG - Intergenic
1155717370 18:28961822-28961844 GGGCGCCAGGAACACATTGCAGG + Intergenic
1156325950 18:36075444-36075466 GAGATTCAAGAACATAGTGAGGG - Intergenic
1157845315 18:50998946-50998968 GGGCTGGTGGAACACTGTGAGGG - Intronic
1157987611 18:52457450-52457472 GGGGGTCACCAACACAGTGATGG + Intronic
1160072466 18:75640673-75640695 GGGTTTCTGCAACACAGCGACGG - Intergenic
1160401974 18:78618112-78618134 GGGCTGTAGGAACTCAGGGAGGG + Intergenic
1161153280 19:2720611-2720633 GGGCTTCAGGGACCCAGGGCTGG - Intronic
1163492973 19:17627796-17627818 GGCCTGCAGGGACACAGTGGTGG + Intronic
1164721657 19:30436759-30436781 GGGCTTCAGGGACAGACTGAGGG + Intronic
1165565828 19:36726827-36726849 TGGTTTCAGGAAGACTGTGAAGG - Intronic
1166687269 19:44802827-44802849 GGGCTACAGGAACCCAGAGTGGG + Intergenic
1167108675 19:47446304-47446326 AGGCTTCAGGCACACATTGGGGG + Intronic
925101570 2:1251044-1251066 GGCCTTCAGAACCACAATGATGG - Intronic
925326296 2:3024459-3024481 GGGCACCAAGAACACAGGGAGGG + Intergenic
925730323 2:6915670-6915692 GGGCTGCAGGAAGAGAGTTAAGG - Intergenic
926357508 2:12055037-12055059 GGGCTTCAGGGATACAGTGATGG + Intergenic
927179855 2:20437315-20437337 GGGCTTAAGGAGGTCAGTGAAGG - Intergenic
927189358 2:20506544-20506566 GGATTCCAGGATCACAGTGAGGG + Intergenic
927938925 2:27091630-27091652 GGGCTCCAGTAACACTGTGAGGG + Intronic
929299339 2:40285061-40285083 GGACTCCAGGAACAGAGAGATGG + Intronic
929565370 2:42980467-42980489 TGCCTACAGAAACACAGTGATGG + Intergenic
930014660 2:46962103-46962125 GGGCTTCAGGAAAGGAGAGAGGG - Intronic
931797913 2:65729392-65729414 GGGTTTCACAAACAGAGTGAGGG - Intergenic
932401182 2:71482137-71482159 TGGCTTCAGGAACTCAGCCATGG + Intronic
932667131 2:73707156-73707178 GTCCTTCAGGAACACAGTCCTGG - Intergenic
932669794 2:73727674-73727696 GTCCTTCAGGAACACAGTCCTGG - Intergenic
932740556 2:74287621-74287643 AGCCTTGAGGGACACAGTGAGGG - Intronic
933158371 2:78998500-78998522 TGGCATCGGGAATACAGTGATGG - Intergenic
933747080 2:85579189-85579211 GGGCTGGAGGAAAACAGGGAGGG + Intronic
934542016 2:95183468-95183490 GGTCTTGAGGAAGGCAGTGATGG - Intronic
934978926 2:98824376-98824398 GGGCTTCAGGAGGCCAGAGAAGG - Intronic
935424748 2:102908306-102908328 GGGATTCAGGAACACATAGCAGG + Intergenic
935559817 2:104548466-104548488 GGGTTTCAGGATCAGAGTGGGGG - Intergenic
939825341 2:147008737-147008759 TGGCTCCAAGAACCCAGTGATGG + Intergenic
940749833 2:157612785-157612807 GGGCTACAGGGGCACAGTGCTGG - Intronic
942453999 2:176125278-176125300 GGGCTTCAGGAGCCCAGGGAAGG - Intergenic
942481608 2:176394221-176394243 GGGCTTCAGGTACATAGAAATGG + Intergenic
943365769 2:186966361-186966383 GGGCTTCAGGAAGACCCTGGAGG + Intergenic
943542846 2:189239427-189239449 AGGCAGGAGGAACACAGTGAGGG + Intergenic
944619862 2:201503362-201503384 GGACTTCAGGCACACATTGCTGG + Intronic
945756513 2:213854031-213854053 GGATTTCAGGAACACACTGAGGG - Intronic
946034734 2:216732583-216732605 GGGCTCCAGGTGCACAGAGAAGG - Intergenic
946426688 2:219602208-219602230 GTGCTGCGGGAACACAGAGAGGG - Intronic
946792720 2:223317697-223317719 GGGTTGCTGGATCACAGTGATGG + Intergenic
946881507 2:224181528-224181550 GGGCTTTAAGGACACAGAGAAGG + Intergenic
948139513 2:235662055-235662077 GGGCTCCAGGAATTCAGGGAAGG + Intronic
1170246842 20:14230555-14230577 GGGCTTCAAGACTTCAGTGAAGG - Intronic
1170951198 20:20937966-20937988 GAGCTTCACGAACAAAGGGAAGG - Intergenic
1171970199 20:31559700-31559722 GGCCTTCAGGAGCCCAGAGAAGG + Intronic
1172169601 20:32920998-32921020 GGGAGTCAGTATCACAGTGAGGG - Intronic
1172879649 20:38191229-38191251 AGGCTTCTGGGACAGAGTGACGG + Intergenic
1173361732 20:42350654-42350676 GGGTTTCAGCATCACTGTGATGG + Exonic
1174136426 20:48383095-48383117 GGGCAGCAGGGACAGAGTGACGG + Intergenic
1175465867 20:59191168-59191190 GGCCTTCAGGAACACAGTGGGGG - Exonic
1179784874 21:43723876-43723898 GTGCTGCAGGACCACAGTGCAGG + Intronic
1179912347 21:44456835-44456857 GAGCTTCAGGAGCACGGTGTTGG - Exonic
1179923160 21:44518420-44518442 GGGCTTTAGGATCACGGTGTTGG + Intronic
1180127493 21:45802307-45802329 ACGCTTCAGGAACACAGCAAGGG - Intronic
1180446270 22:15416952-15416974 AGGATTCAAGAACACAGTGGCGG + Intergenic
1181116472 22:20635178-20635200 GGGCCTCAGGGTCACTGTGAGGG - Intergenic
1184995016 22:48199210-48199232 GGGCCTGGGGAAGACAGTGAGGG + Intergenic
1185151057 22:49164217-49164239 AAGCTTCCGGAAGACAGTGAGGG + Intergenic
950495492 3:13331619-13331641 GGGCTCCAGGAACACAGATATGG - Intronic
952368780 3:32699521-32699543 GTGTTTGAGGAACACTGTGAAGG + Intronic
953792364 3:45958019-45958041 GAGCTTCAGGAAGAGACTGAAGG + Intronic
953856703 3:46504855-46504877 AGGCCTCAGGAACACAATCATGG + Intergenic
954855976 3:53643743-53643765 AGGCTGCAGGGACACAGTGGAGG - Intronic
955472512 3:59300696-59300718 GTGTTTAAGGAACACAGAGAAGG + Intergenic
955535242 3:59916319-59916341 GGCCTTCAGCAACAGACTGAAGG + Intronic
955624288 3:60900207-60900229 GGGATTCAGGGCCACAGTTAGGG + Intronic
956146607 3:66197301-66197323 AGGCATCAGGGACATAGTGACGG + Intronic
957117925 3:76050356-76050378 GGTCTTCAGCCACACACTGAAGG + Intronic
958092022 3:88888988-88889010 GGGGTTCAAGAATTCAGTGAAGG + Intergenic
958803623 3:98783662-98783684 AGGTTTCAGGCACACACTGAAGG + Intronic
959151238 3:102610750-102610772 GTACTTCTGGAAAACAGTGAAGG + Intergenic
961111075 3:124283408-124283430 TATTTTCAGGAACACAGTGAGGG - Intronic
961547346 3:127644528-127644550 TGGCCTCAGGACCACAGTGGAGG + Intronic
962262030 3:133916574-133916596 GAGCTACAGGAACACATGGAGGG - Intergenic
967058201 3:185848443-185848465 GGGTTTCAGAAACCCATTGAGGG - Intergenic
968503891 4:963240-963262 GGGGTTCACGAACACAAGGAGGG + Exonic
971481058 4:27115445-27115467 GGGCTCCAGGAAGAAAGAGAAGG + Intergenic
978511123 4:109519208-109519230 GGATTTCTGGAGCACAGTGACGG - Intronic
978985153 4:115003079-115003101 GGGCTGCAGGGACAAAGGGAGGG + Intronic
981286612 4:143025818-143025840 AGGATCCAGCAACACAGTGAGGG + Intergenic
981485948 4:145286166-145286188 GTGATTCAGGAACAAACTGAGGG + Intergenic
981642456 4:146960416-146960438 CTGCTTCAGCAACACACTGAAGG + Intergenic
982117429 4:152109176-152109198 GGGCTGCAGGAACATGGGGATGG + Intergenic
983216230 4:165005433-165005455 GGGCTTTATCCACACAGTGACGG - Intergenic
986714119 5:10510361-10510383 GTGCTTCTGGAACCCACTGAGGG + Intronic
986728505 5:10617862-10617884 GGGCCACAGGGACACAGAGAGGG - Intronic
987215900 5:15736926-15736948 TGGTTTCTGGAATACAGTGAGGG - Intronic
989095225 5:37775709-37775731 GGGCTTTTGGAACACCTTGATGG + Intergenic
989166072 5:38434654-38434676 GGGCTGAAGGAACAGAGGGAAGG + Intronic
990748990 5:58991543-58991565 GGGTTTTAGGAAAACAGTTAAGG - Intronic
991200519 5:63986506-63986528 GGGCTTCAGTCACCCAGTGGTGG + Intergenic
992206373 5:74434232-74434254 GGGCTGCAGGGCCTCAGTGATGG - Intergenic
993318352 5:86440358-86440380 GGCCTTCAGGCACAGACTGAAGG - Intergenic
993532048 5:89037163-89037185 TGGCTCCCGGTACACAGTGATGG - Intergenic
994425203 5:99576552-99576574 GGCCTGCAGGAGCACAGGGATGG + Intergenic
994436136 5:99735681-99735703 GGCCTGCAGGAGCACAGGGATGG - Intergenic
994671364 5:102765498-102765520 GTGCTGCAGGAACTCTGTGAGGG + Intronic
994967217 5:106689763-106689785 GGGGTTCAAGAACTCAGTGCAGG + Intergenic
997829708 5:137139477-137139499 GGACTTCAGGAACAGAGGGAAGG + Intronic
998367356 5:141639951-141639973 GGACTGCACGAACACCGTGATGG + Exonic
999069170 5:148725452-148725474 AGGTTTCAGGAAGACAGTAAGGG + Intergenic
999707292 5:154285217-154285239 GGCCTCCAGGGACACTGTGAGGG + Intronic
1000464160 5:161554543-161554565 TGGCTTGAGGAACTCAGTGGTGG + Intronic
1001665025 5:173425530-173425552 GGGATTCAGGAACAAGGAGAGGG - Intergenic
1001805483 5:174582089-174582111 GTGATTCAGGAACCCACTGAGGG + Intergenic
1002100647 5:176855932-176855954 GCGGTTGAGGAACACAGCGAGGG - Intronic
1002358426 5:178649939-178649961 GGTCGTCAGGGAGACAGTGACGG + Intergenic
1002439045 5:179254666-179254688 GGGCTTCAGGGACAGTGAGAGGG - Intronic
1003567053 6:7230672-7230694 GGGTTCCAGGAAGGCAGTGAGGG - Exonic
1003955795 6:11164014-11164036 CAGCCTCAGGACCACAGTGAAGG - Intergenic
1004519977 6:16352715-16352737 GGGTTTCAGGAACCCACTGGGGG - Intronic
1005212861 6:23488703-23488725 GGCCTTCTGGAGCACAGTGCTGG + Intergenic
1006094867 6:31649503-31649525 AAGCTTCAGGAATACAGTAAGGG - Exonic
1006381661 6:33701788-33701810 GGGCTACAGGGACTCAGTGGGGG + Intronic
1006408379 6:33857969-33857991 GTGCTCCAGGAAGACAGGGATGG - Intergenic
1007004695 6:38349776-38349798 AGACTTCAGGAACACAGGGAGGG + Intronic
1007321118 6:41029278-41029300 GGGCTTCAGGGAGGAAGTGATGG - Intronic
1010099297 6:72084572-72084594 AGCATTCAGGAACACAGTGAAGG + Intronic
1010342298 6:74768383-74768405 GGCCTCCAGGAACTCAGTCAAGG + Intergenic
1011987923 6:93473716-93473738 TTGCTTGAGGAATACAGTGAAGG + Intergenic
1017990531 6:159484466-159484488 GGTGTTCAGGAGCACAGAGAAGG + Intergenic
1018143386 6:160861835-160861857 GGTCTTCAGGGCCTCAGTGAGGG + Intergenic
1018892297 6:167990626-167990648 GGGCCTCAGGAGCAGAGGGACGG - Intergenic
1018955586 6:168408129-168408151 AGACTTCAGGAAGACAGAGAAGG - Intergenic
1019008173 6:168821040-168821062 GGGCATCTGGAACACCGTGAGGG - Intergenic
1020211115 7:6158838-6158860 GGGCTACTGGGAGACAGTGATGG + Intronic
1020538886 7:9436229-9436251 GGGCTCCTAAAACACAGTGAGGG - Intergenic
1022472415 7:30689867-30689889 TGGATTCAGGAAGACAGGGAAGG + Intronic
1022668322 7:32431580-32431602 GTGCTTCTGGAAAACAGGGAAGG + Intergenic
1025000292 7:55310351-55310373 GAGCTGCAGGAGCAGAGTGAAGG + Intergenic
1026123645 7:67560042-67560064 GGGCTTTAGGAAGACAGAGGTGG - Intergenic
1026446362 7:70488070-70488092 GGGCTTCTGGAACCCAGCAATGG + Intronic
1027712521 7:81623505-81623527 GGGCTACAGGAAGAAGGTGAAGG + Intergenic
1029102431 7:98143166-98143188 GGGCTTCAGTAAAACAGAAAGGG - Intronic
1030102239 7:105956621-105956643 GGGCTCCAGGAAGCCAATGAAGG + Intronic
1030354423 7:108526536-108526558 GGGCTTCAGGGACGCGGAGAGGG - Intronic
1030823589 7:114126188-114126210 GGGCTTCAGGAAAAAAATTATGG + Intronic
1031235412 7:119169148-119169170 GGGCTACAGTAGCACAGTGCTGG - Intergenic
1033461249 7:141549446-141549468 GGGCTGCAGGAACCCATTCAGGG + Intergenic
1033614970 7:143005182-143005204 GGTCTTCATGAACACTATGAAGG + Intergenic
1033636471 7:143216396-143216418 GGGCTTCAGGCACAGAGTGTTGG - Intergenic
1033861204 7:145630341-145630363 GGCCTTCAGCAACAGACTGATGG + Intergenic
1034069165 7:148165989-148166011 GGGCTTCAGGAAAAAGGTAAGGG - Intronic
1034422880 7:150998544-150998566 GCGCTGCGGGAACACTGTGATGG - Exonic
1035313774 7:157985640-157985662 AGGCTTCAGGACCACAGTGATGG - Intronic
1035606290 8:931720-931742 GGGCTGCTGAAACACAGTGGTGG + Intergenic
1035938991 8:3875104-3875126 GGGCTTCAGGAACACATTGTGGG + Intronic
1036211217 8:6842744-6842766 GGGATTCAGGGCCACAGTGGTGG - Intergenic
1036420370 8:8590054-8590076 GGGCTTCAGGAACCAAGTCCGGG - Intergenic
1037655644 8:20881819-20881841 GGGGTTGAGGAACACAGTATAGG - Intergenic
1037889137 8:22614072-22614094 GGGCTACAGGAAGACAGCAAGGG - Exonic
1038271296 8:26078219-26078241 GGACTTCAGGAAACCAGAGATGG + Intergenic
1038396043 8:27246208-27246230 GAGTTTTAGGAACACAGAGAAGG + Intronic
1038706743 8:29901294-29901316 GGGCTGCAGGGACACAGTCTTGG - Intergenic
1039030091 8:33299487-33299509 GGGCTTGTGGGGCACAGTGAGGG + Intergenic
1039556424 8:38479033-38479055 GGGGTTCAAGACTACAGTGAAGG + Intergenic
1040625743 8:49147973-49147995 GGGCTTCAGGATCACTGGGTTGG + Intergenic
1041457138 8:58073351-58073373 GGGCTTCAGGAGAAGAGAGATGG + Intronic
1041990179 8:63978765-63978787 GGGCTGCAGTTTCACAGTGAAGG + Intergenic
1042840983 8:73123610-73123632 GGCCTTCAGCAACAGACTGAAGG - Intronic
1044848439 8:96404870-96404892 GGGGCTCAGGAACACAGAGGGGG - Intergenic
1044871728 8:96626407-96626429 GGGGTTTAGGACCTCAGTGACGG + Intergenic
1045430914 8:102114455-102114477 GGGGTTCAGGAAAGCAATGAAGG + Intronic
1045780840 8:105861665-105861687 GGGCTGAAGGAACACATTGTAGG + Intergenic
1045941866 8:107748462-107748484 GGACTTCTGCAACACATTGAAGG - Intergenic
1046452462 8:114411961-114411983 GAGTTTTAGGGACACAGTGATGG + Intergenic
1046948698 8:119999806-119999828 AGGCATCAGGAATTCAGTGAAGG + Intronic
1047537245 8:125731287-125731309 GGGGATCAGGAACAGAGGGATGG + Intergenic
1048136651 8:131752829-131752851 GGGCTACAGGAAACCAGTGGGGG - Intergenic
1048622362 8:136147838-136147860 CGGGTTCAGGAACCAAGTGATGG - Intergenic
1048837387 8:138533493-138533515 AAGCTTGAGGAACACAATGAAGG + Intergenic
1048871580 8:138803604-138803626 GGGCCCCAGGTACACAGGGATGG - Intronic
1052556640 9:30027156-30027178 GGCCTTCAGCTACACACTGAAGG - Intergenic
1054918930 9:70522555-70522577 TGGCATCAGGAACAGAGTGTGGG - Intergenic
1055664933 9:78543957-78543979 GGGCTTTAGAAACAGAGTGAAGG + Intergenic
1056074031 9:83020207-83020229 GGGCATCAAGAAGAAAGTGAGGG + Intronic
1057740385 9:97706194-97706216 GGGCTACAGGAACCAGGTGATGG - Intergenic
1058868207 9:109180647-109180669 TGGCTTCAGCCACACAGGGAGGG - Intronic
1059021515 9:110580946-110580968 GGGAGTCAGGAACACCGTGTAGG + Intergenic
1059037687 9:110775327-110775349 GGGCTCGAGGAACACAGTCTGGG - Intronic
1061102341 9:128501698-128501720 TGGATTCAAGAACACAGAGAAGG - Intergenic
1061672017 9:132194172-132194194 GGACTTCAGGAAGGGAGTGATGG + Intronic
1187305875 X:18094822-18094844 GGGTTTCCTGAACCCAGTGATGG + Intergenic
1189079406 X:37954252-37954274 TGGCTTCAGGAACTGACTGAAGG + Intronic
1189630233 X:42944589-42944611 AGGCTTCAAGATCACAGGGATGG + Intergenic
1190603581 X:52117471-52117493 GGACTCCAGACACACAGTGAAGG + Intergenic
1191645702 X:63478686-63478708 GGGCTTCAGGGACCCACTTAAGG - Intergenic
1192210136 X:69122701-69122723 GGTCTTAATGAACACAGGGAAGG - Intergenic
1196400577 X:115312012-115312034 GGGCTGCCGGAGCACAGGGAGGG - Intergenic
1197170278 X:123426266-123426288 AGCCTTCAGCAACACTGTGAAGG + Intronic
1201617795 Y:15920946-15920968 GTGTTGCAGGATCACAGTGAAGG - Intergenic
1201689943 Y:16752491-16752513 GGGGTTCAGGAACCCACTTAAGG + Intergenic