ID: 1152883328

View in Genome Browser
Species Human (GRCh38)
Location 17:82832979-82833001
Sequence TTTCCTCGAAAGCGCCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152883323_1152883328 16 Left 1152883323 17:82832940-82832962 CCTTTGAGTTTTGGGAACTTTCA 0: 1
1: 0
2: 0
3: 30
4: 242
Right 1152883328 17:82832979-82833001 TTTCCTCGAAAGCGCCCTGCCGG 0: 1
1: 0
2: 0
3: 5
4: 56
1152883321_1152883328 24 Left 1152883321 17:82832932-82832954 CCTGTAAGCCTTTGAGTTTTGGG 0: 1
1: 0
2: 1
3: 12
4: 143
Right 1152883328 17:82832979-82833001 TTTCCTCGAAAGCGCCCTGCCGG 0: 1
1: 0
2: 0
3: 5
4: 56
1152883325_1152883328 -8 Left 1152883325 17:82832964-82832986 CCTGTGACCTGGACCTTTCCTCG 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1152883328 17:82832979-82833001 TTTCCTCGAAAGCGCCCTGCCGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152883328 Original CRISPR TTTCCTCGAAAGCGCCCTGC CGG Intronic
902839120 1:19064333-19064355 TTTCCTAGAAAGGGCCAAGCAGG + Intergenic
903011196 1:20331627-20331649 TTTGCTCCAGAGCTCCCTGCTGG - Intronic
906163852 1:43671194-43671216 TTTCCTCCAAAGTCTCCTGCAGG - Intronic
906222169 1:44089380-44089402 TTTGCTCCAGAGCTCCCTGCTGG - Intergenic
907264182 1:53245935-53245957 TTTCCTCTGAAGCACCCTGAAGG - Exonic
914807419 1:151001814-151001836 TTTCCTCCAAAGAGCACTGAAGG + Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
921615689 1:217264185-217264207 CTTCCTCCAAACGGCCCTGCAGG + Intergenic
923084011 1:230688511-230688533 TTTCCTAAAAAGCGCCCTGGAGG + Exonic
1070120870 10:73575511-73575533 CTTCCTCAACAGTGCCCTGCAGG - Exonic
1073041426 10:100609669-100609691 TTTCCTGGAAAACTACCTGCAGG - Intergenic
1074437246 10:113444661-113444683 TTTCCTTGTAAGAACCCTGCGGG + Intergenic
1076902247 10:133345496-133345518 TTTCCTCGACAACCCCCAGCGGG - Intronic
1080861748 11:36155929-36155951 TTTCCTCCACAGAGCCCTGCAGG - Intronic
1081995552 11:47361383-47361405 TTTCCTGGAAAACCCCCTGTGGG + Intronic
1093135619 12:15446839-15446861 TTTCCTCAACGGCTCCCTGCTGG - Intronic
1094531896 12:31283701-31283723 TTTCCTATGAAGCCCCCTGCAGG + Intronic
1097175778 12:57142143-57142165 TTTCCCCCAAAGGGCCCTGTGGG + Intronic
1104169837 12:126269403-126269425 TTTCCTCAAATGCCCACTGCAGG - Intergenic
1104994198 12:132643775-132643797 TTTCCTCCATACCACCCTGCTGG + Intronic
1112331843 13:98482908-98482930 TTTTCTGGAAAGCTCCCTGAGGG - Intronic
1118447001 14:65861185-65861207 TTTCTTCAAAAGCTCCCTCCAGG - Intergenic
1123955809 15:25333197-25333219 TTTCCTGGAATACACCCTGCTGG + Intergenic
1133072313 16:3254600-3254622 CTTCCTCGACAGCCCCCTCCCGG + Exonic
1141929692 16:87193890-87193912 GTTCCTCGGAAGCTCCCAGCAGG - Intronic
1152883328 17:82832979-82833001 TTTCCTCGAAAGCGCCCTGCCGG + Intronic
942999661 2:182310344-182310366 TTTCCTCCATAGCCCCCTGAAGG - Intronic
945617463 2:212090443-212090465 TATCCTCTAAAGCTCCCTGGAGG + Intronic
948287612 2:236798648-236798670 TTTGCTCCAAAGCCCCCTCCAGG - Intergenic
1169800229 20:9506615-9506637 TTTCCCGGAAAGAGCCCTGGGGG - Intergenic
1175712503 20:61232438-61232460 TTTCATCCCAAGTGCCCTGCTGG + Intergenic
1176180655 20:63747897-63747919 CTTCCTCCAAACCTCCCTGCAGG + Intronic
1181283196 22:21734640-21734662 TTGCCTCGCAAGAGCCCTGAGGG + Intronic
1181617189 22:24062961-24062983 TCTCCTCGGAACTGCCCTGCTGG + Exonic
1183859835 22:40661872-40661894 TTTCCTCTGAAGCTTCCTGCTGG + Intergenic
1184259536 22:43306724-43306746 TTTCCTGGAAAGGGGCATGCTGG - Intronic
1184887641 22:47356163-47356185 CTACCTCGAAAGCACCTTGCGGG + Intergenic
1185165819 22:49261598-49261620 ATTCCTCAAAAGAGGCCTGCTGG + Intergenic
951714470 3:25624973-25624995 TTTCCTAGAAAGCCATCTGCAGG + Intronic
954379803 3:50213421-50213443 TTTCCTGGAAGGCCCCCTGAGGG + Intronic
959524572 3:107362072-107362094 TTTGCTCCAAAGCTCCCTGTTGG + Intergenic
962146867 3:132848811-132848833 TTTCCTTGAATGCACCCTGAAGG - Intergenic
962330435 3:134473131-134473153 TTTCCTCGAGAGCTCACTGATGG + Intergenic
969438431 4:7201979-7202001 TTTCTTGGAAAGCGCCGTCCTGG + Intronic
969456340 4:7301858-7301880 TATCCAAGAAAGAGCCCTGCAGG - Intronic
969877148 4:10144152-10144174 CTTGCTCCAAAGCTCCCTGCTGG - Intergenic
978445328 4:108774991-108775013 TTTCCTGGAAAGCTGCCTGGAGG - Intergenic
984786440 4:183571709-183571731 TTTCCTGGAAAGCATGCTGCTGG + Intergenic
985795956 5:1962263-1962285 TTTCCTAGAAGGCGCCCACCTGG + Intergenic
986789821 5:11148751-11148773 TTTCCTCCCAAGCACCCAGCCGG - Intronic
997460820 5:134051122-134051144 TTTCCTTGAAGGCACCCTGTGGG + Intergenic
1004193268 6:13483330-13483352 TTTCCTTGAATGGGCCCTGTTGG - Intronic
1005378021 6:25204563-25204585 TTTCTTTGAAAGCGCCTTTCAGG - Intergenic
1007794794 6:44338802-44338824 TCTCCTCGAAAGAGCACTGCAGG - Intronic
1015869511 6:137761690-137761712 TTTTCTCAAAATGGCCCTGCTGG - Intergenic
1016324012 6:142879360-142879382 CTTCCTCAAAAGCTCCCTGCTGG - Intronic
1027231272 7:76274111-76274133 TTTGCCCGAAAGGGCCCTGAAGG - Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1049439603 8:142603072-142603094 TTTCCTGGAAACCTCCCTCCTGG - Intergenic
1049610762 8:143553730-143553752 TGTCCTCGCCAGCGCCCAGCTGG + Exonic
1062419736 9:136474438-136474460 TGGCCTCGAAAGAGCCCAGCAGG - Exonic
1200294298 X:154902707-154902729 GTTCCCTGAAAGTGCCCTGCAGG + Intronic